ID: 1113437986

View in Genome Browser
Species Human (GRCh38)
Location 13:110307702-110307724
Sequence TCTCCTTCTTTCCGGGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437971_1113437986 23 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437980_1113437986 0 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437976_1113437986 10 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437972_1113437986 16 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437982_1113437986 -10 Left 1113437982 13:110307689-110307711 CCTAACGGGAGGCTCTCCTTCTT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437981_1113437986 -1 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437986 Original CRISPR TCTCCTTCTTTCCGGGTCGT GGG Intronic
904321999 1:29703864-29703886 TCTCCTTCCTTCCGGGTGCTTGG - Intergenic
904772087 1:32886305-32886327 TCCCCTTCTCTCCGGGGCGGGGG + Intronic
915931573 1:160063596-160063618 TCTGCTTCTTTCCCCGTCTTAGG + Intronic
917507868 1:175644966-175644988 TTTCCTTCTTTCAGAGTCTTGGG + Intronic
919870465 1:201817073-201817095 TCACCTTCTTTCCAGGTCCATGG + Exonic
1073243138 10:102071241-102071263 TCTCCTTCCTTCCGAGTAGCTGG + Intergenic
1073527187 10:104195023-104195045 TCTCCTTCATTCCAGGGCGATGG + Intronic
1074183821 10:111084699-111084721 TCTCCTTCTGTCCAGGCCATGGG + Intergenic
1076474169 10:130740919-130740941 TCTCCCTCATTCCTGGTCCTTGG - Intergenic
1079385791 11:19978188-19978210 TCAACTTCACTCCGGGTCGTAGG - Intronic
1080637805 11:34139058-34139080 TCTCCTTCTTTCCAGGCTGGGGG - Intronic
1081204336 11:40257586-40257608 TCACTTTCTTTCCTGGTCATTGG + Intronic
1089705679 11:120276015-120276037 TCTCCATCATTCTGGGTCCTTGG - Intronic
1090433307 11:126664718-126664740 TGTCCTTGTTTCAGGGTCCTGGG + Intronic
1093690756 12:22106059-22106081 TCACCTTCTGTCCTGGTTGTGGG - Intronic
1106017800 13:25885459-25885481 TCTCCTTCTTTTGGGGTGGCTGG + Intronic
1109933343 13:69245521-69245543 TGTGCTTCTTTCTTGGTCGTAGG + Intergenic
1111611769 13:90615323-90615345 TCCCCTTCTTTCAGGGGTGTTGG + Intergenic
1112091969 13:96091420-96091442 TCTCCTTCTTGCCAGGCCGGTGG - Exonic
1112278216 13:98040122-98040144 TCTCCTCCTTTCCGGCCCGTTGG + Intergenic
1113111630 13:106829886-106829908 TGTGCTTCTTTCTGGGTTGTAGG + Intergenic
1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG + Intronic
1113950447 13:114068585-114068607 TCTCCTTGTTTTAGGGTCGTGGG + Intronic
1115381841 14:32748670-32748692 TCTCCTTTTTTCCTAGTCTTGGG - Intronic
1128199811 15:65794922-65794944 TCTCCTGCTTCCCGGGTAGCTGG + Intronic
1129614067 15:77084089-77084111 TCTCCCTCTTCCTGGGTTGTGGG + Intergenic
1131912837 15:97226297-97226319 CTTCCTTCTTTGCGGGGCGTCGG - Intergenic
1141841139 16:86574842-86574864 TTTCCTACTTTCAGGGTCTTGGG + Intergenic
1144404960 17:14943185-14943207 TCTGCTTCTTTACTGGTGGTGGG + Intergenic
1147909619 17:43847631-43847653 TCTTCATCTTTCAGGGTTGTGGG - Intronic
1148397623 17:47323243-47323265 TCTCATTCTTCCAGGGTTGTGGG - Intronic
1149391455 17:56195588-56195610 TCTACTTCCTTCTGGGTCCTGGG - Intronic
1152322200 17:79614010-79614032 TCTCCTATTCTCCAGGTCGTTGG - Intergenic
1152647507 17:81476311-81476333 ACTCCTTCTTTCCGGGTCCCTGG - Intergenic
1167539412 19:50075569-50075591 GCTCCTTCTTTCAGGGTGGGGGG + Intergenic
929899263 2:45987162-45987184 CCTCCTTCTTCCAGGGTCATTGG - Intronic
935676174 2:105596534-105596556 GCTCCTTCTTTCTGGGGCTTTGG + Intergenic
942941272 2:181620643-181620665 TCTACCTCTTTCCTGGTCCTAGG - Intronic
1171047151 20:21820744-21820766 GCTTCTTAATTCCGGGTCGTTGG + Intergenic
1174746765 20:53071510-53071532 CCTCCTTCTTTCCTGTTCATGGG + Intronic
1176119444 20:63447416-63447438 TCTCCTTCCTCCCGGGTTGCAGG + Intronic
1181359289 22:22322649-22322671 TCTCCTGCTTCCAGGGTCCTGGG + Intergenic
1182890180 22:33811638-33811660 TGGCCTTCTTTCCTGGTCTTGGG - Intronic
1185004733 22:48269045-48269067 CCTCCTTCTTTCGGTGTCGGTGG - Intergenic
953411182 3:42691321-42691343 TCTCCTGCCTTCCGGGTGCTTGG + Intronic
954774537 3:53004828-53004850 TCTCATTCTTTCCGGTTCCAGGG - Intronic
963490371 3:145992819-145992841 TCTCCTTCTGTCTGGGACATTGG - Intergenic
964328260 3:155572128-155572150 TCTCCTTCTTTCCTTCTGGTTGG + Intronic
964668718 3:159202285-159202307 TCACCTTCTTTCCAGGTCTCAGG - Intronic
964969921 3:162547428-162547450 TCTCATTCATTCCTGGCCGTAGG - Intergenic
965183645 3:165435916-165435938 TCTTGTTCTTTCCTGGGCGTAGG + Intergenic
966521867 3:180882154-180882176 TCTCCTTCTTTCTGGACCCTGGG + Intronic
971593945 4:28503574-28503596 TCGTCTTCTTTCCTGGTCTTTGG - Intergenic
985783046 5:1880945-1880967 GCTCCTTCCTGCCGGGGCGTAGG - Intronic
986266097 5:6192330-6192352 TTTCCTTCTTTACAGGTCCTGGG - Intergenic
991991719 5:72346141-72346163 TCTCCATCTTTCTGGTTCCTTGG - Intronic
994874761 5:105405132-105405154 TCTCCTTTTTTTCAGGTAGTAGG - Intergenic
996757732 5:126952187-126952209 TATCCTTCTTACAGGGTAGTGGG - Intronic
1000359284 5:160432697-160432719 TTTCCTCCTTTCTGGGTGGTGGG + Intergenic
1002545575 5:179941550-179941572 TCTCCTTCTCTCTCGGTCTTTGG + Intronic
1010541907 6:77101980-77102002 TTTCCTTCCTTCCAGGTCTTGGG + Intergenic
1014363449 6:120508700-120508722 TCTGCTTCTTTCCTTGTTGTAGG + Intergenic
1014740615 6:125144180-125144202 ATTCCTTCTTTCCAGGTGGTAGG - Intronic
1019452616 7:1107742-1107764 TCTGCTTCCTCCCGGGGCGTGGG - Intronic
1025003924 7:55340934-55340956 TCTCCTTCTCTCAGGATCTTTGG + Intergenic
1026092245 7:67309875-67309897 TCACCTTTTTTCTGGGTTGTGGG + Intergenic
1026487743 7:70835971-70835993 TCTCCTTCTTCCCAGGACTTGGG + Intergenic
1039504251 8:38040517-38040539 TCTCCATCTTTTGGGTTCGTTGG + Intronic
1048640409 8:136352156-136352178 TTTCCTTCTTTCCTTGTTGTTGG - Intergenic
1052472056 9:28911474-28911496 TCTCCTTCTTTCTAGATAGTAGG - Intergenic
1057038054 9:91825970-91825992 TCTCCTCCTTTCTGGCTCTTAGG + Intronic
1057337263 9:94166016-94166038 TCTCCTTCTTTCCTAGTGGAGGG - Intergenic
1062636299 9:137493415-137493437 TGTCCTGCCTTCAGGGTCGTGGG - Intronic
1185724358 X:2407442-2407464 TCTCCCTCTCTCCGGGTTGCGGG - Intronic
1187694627 X:21906251-21906273 TCTCCTTGTTTCCAGGTGTTAGG + Intergenic
1191009389 X:55744969-55744991 TGTGCTTCTTTCTGGGTTGTAGG + Intronic
1192774167 X:74224362-74224384 TCTCCTTTTATTCGGGTCTTCGG - Intergenic
1196076231 X:111579609-111579631 TCTCCATCTTTCAGGGTTGTTGG - Intergenic