ID: 1113437987

View in Genome Browser
Species Human (GRCh38)
Location 13:110307703-110307725
Sequence CTCCTTCTTTCCGGGTCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437980_1113437987 1 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437981_1113437987 0 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437982_1113437987 -9 Left 1113437982 13:110307689-110307711 CCTAACGGGAGGCTCTCCTTCTT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437971_1113437987 24 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437972_1113437987 17 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437976_1113437987 11 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437987 Original CRISPR CTCCTTCTTTCCGGGTCGTG GGG Intronic
901504971 1:9679035-9679057 AACCTTCTTTCCGGGTAGTCAGG + Intronic
905707211 1:40069813-40069835 CTCCTTCTTTGTGGCTCGTTTGG - Exonic
908298861 1:62741369-62741391 TTCCTTCTTTCCCTGTCTTGTGG - Intergenic
915378097 1:155415788-155415810 CTTCTTCTTTGGGGGACGTGGGG + Exonic
924328980 1:242923588-242923610 GTCCTTCCTTCTGGGGCGTGGGG - Intergenic
1069150171 10:64950451-64950473 CTCCTTCTTTCTCTGTCTTGTGG + Intergenic
1080052401 11:27870816-27870838 CTCCTTCTCTCCAGATCATGTGG + Intergenic
1084911340 11:72391906-72391928 CTCTTGCTTTCAGGGTGGTGGGG + Intronic
1085312864 11:75526241-75526263 CTCCCTCCTTCCGGGTCCCGAGG - Intergenic
1093030504 12:14284349-14284371 CTCCTTCCCTCCTGGTTGTGTGG - Intergenic
1101059265 12:100954155-100954177 CTCTTTCATTCAGGGTTGTGCGG + Intronic
1106437060 13:29732488-29732510 GTCCTTTTTTCCTGGTAGTGTGG + Intergenic
1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG + Intronic
1117467329 14:56006448-56006470 CCCCTTCTTTCTGGCTCCTGTGG - Intergenic
1120993454 14:90397829-90397851 CTCCTTCTTCCCGGGGGGCGCGG + Intronic
1125535014 15:40437640-40437662 CACCTTCTTTCCTGGAAGTGGGG - Intergenic
1129540997 15:76346838-76346860 CTCCTCCTCTCCGGGACGAGGGG + Intergenic
1131912836 15:97226296-97226318 TTCCTTCTTTGCGGGGCGTCGGG - Intergenic
1136927777 16:34389715-34389737 CACCTGCTGTCTGGGTCGTGGGG + Intergenic
1136976797 16:35022091-35022113 CACCTGCTGTCTGGGTCGTGGGG - Exonic
1141841140 16:86574843-86574865 TTCCTACTTTCAGGGTCTTGGGG + Intergenic
1142840864 17:2628621-2628643 CTCCTTCTTTCTCTGTCTTGTGG + Intronic
1144466279 17:15500038-15500060 CTCCTTCTTTCCTGGAGCTGGGG - Intronic
1147909618 17:43847630-43847652 CTTCATCTTTCAGGGTTGTGGGG - Intronic
1151490940 17:74432103-74432125 CTCGTACTTTCCGGCTGGTGAGG - Exonic
1155244484 18:23894369-23894391 CTCCTCCTTTCCAAGTTGTGGGG + Intronic
1157295137 18:46437100-46437122 CTCCTTCTTTCTGTTTCTTGGGG - Intronic
1162155118 19:8672798-8672820 CTCCTTCATTCCTGATCCTGGGG + Intergenic
925141186 2:1550766-1550788 CTCCGTCTTTGCGGGATGTGGGG + Intergenic
929899262 2:45987161-45987183 CTCCTTCTTCCAGGGTCATTGGG - Intronic
945960429 2:216128660-216128682 CCCCTACTTTCCAGGTCTTGTGG - Intronic
947239833 2:227982403-227982425 CTCCATCTTTCCTGATCCTGTGG - Intronic
1168849716 20:968143-968165 CTCCTTCTGCCCTGGTCTTGTGG - Intronic
1173315630 20:41940708-41940730 CTCCTACTTTCCAAGTCCTGAGG + Intergenic
1175874333 20:62222240-62222262 CTCCCTCTGTCTGGGTCGTCTGG - Intergenic
1179116059 21:38493802-38493824 CTCCTTCCTTCCCTGTCCTGTGG + Intronic
1181813869 22:25421746-25421768 CTCCTTCTTCCCGGGCTCTGTGG + Intergenic
1184443088 22:44530636-44530658 CTCCTTCTTCCTGGGTTTTGGGG + Intergenic
950945736 3:16944343-16944365 CTCCATCTTTCCAGGTGGTCAGG + Intronic
957220047 3:77370496-77370518 CTCCTTCTTCCCTGGGCTTGTGG + Intronic
961181700 3:124883007-124883029 TTCCTTCTTTCCGGTTCGAATGG - Intronic
961417919 3:126774844-126774866 CTGCTTCTTTCCTGGTCCTTTGG + Intronic
968878909 4:3288628-3288650 TTCCTCCTTTCCGGGACGTATGG + Intergenic
970676777 4:18459462-18459484 CTCTTTCTTTCCAGTTCATGTGG + Intergenic
972451920 4:39209416-39209438 CTCCTTTTTTCAGTGTCTTGAGG - Intronic
983371851 4:166870039-166870061 TTCCTTCTTCCAGGGTCATGTGG - Intronic
985535959 5:465904-465926 CTCCTTCTGTCTGGGGCGGGTGG + Intronic
985783045 5:1880944-1880966 CTCCTTCCTGCCGGGGCGTAGGG - Intronic
1003061948 6:2870470-2870492 CTCCCTCTTACCGGGAAGTGTGG - Intergenic
1006007031 6:31010726-31010748 CTCCTGCTTTCTGGTTCCTGTGG + Exonic
1007361223 6:41357896-41357918 CTGCTTCTTTCCTGGTCCTTTGG - Intergenic
1012923033 6:105239182-105239204 CTCCTTCTTTCTCTGTCTTGTGG - Intergenic
1015573456 6:134646039-134646061 CTCCTCCTTTCTGGGACCTGAGG + Intergenic
1016185653 6:141195470-141195492 CTCTTCCTTTCAGGGTAGTGAGG + Intergenic
1018583908 6:165334792-165334814 CTCCTTCCTTCCTGCTCCTGTGG - Intronic
1019452615 7:1107741-1107763 CTGCTTCCTCCCGGGGCGTGGGG - Intronic
1021939790 7:25668409-25668431 TTCCTTCTTACCTGGTCATGTGG + Intergenic
1022419072 7:30203581-30203603 CTCCCTCTTTCCTGGTCATTTGG + Intergenic
1024620025 7:51148997-51149019 CTCCCTATTTCTGGGTGGTGTGG + Intronic
1025772014 7:64517555-64517577 TTCCCTCTTACCGTGTCGTGTGG - Intergenic
1026739074 7:72967165-72967187 CTGCTCCTGTCGGGGTCGTGAGG - Intronic
1028162297 7:87499176-87499198 CTTCTTCTTTCTGGGAGGTGAGG + Intergenic
1029243979 7:99185139-99185161 CTCCTTCTCTCCGCACCGTGGGG - Exonic
1049523098 8:143104838-143104860 TTCCTTCATTCCGGGGAGTGGGG - Intergenic
1185724357 X:2407441-2407463 CTCCCTCTCTCCGGGTTGCGGGG - Intronic
1195796065 X:108648362-108648384 CTCCTTCTTTCTCTGTCTTGTGG - Intronic
1196076230 X:111579608-111579630 CTCCATCTTTCAGGGTTGTTGGG - Intergenic
1196524771 X:116719375-116719397 CACCTTCTTTCCTCGACGTGTGG - Intergenic
1197171872 X:123443778-123443800 CTACTTCTTTCCAGGTTCTGTGG - Intronic
1199575100 X:149306382-149306404 CTGCTCCTTTCCGGGTCCTTTGG - Intergenic
1201226361 Y:11822690-11822712 GTCCTTCCTTCTGGGGCGTGGGG - Intergenic
1201747033 Y:17387990-17388012 ATCCAACTTTCCGGGTCCTGAGG + Intergenic