ID: 1113437990

View in Genome Browser
Species Human (GRCh38)
Location 13:110307705-110307727
Sequence CCTTCTTTCCGGGTCGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437976_1113437990 13 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437972_1113437990 19 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437982_1113437990 -7 Left 1113437982 13:110307689-110307711 CCTAACGGGAGGCTCTCCTTCTT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437971_1113437990 26 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437981_1113437990 2 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437980_1113437990 3 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437990 Original CRISPR CCTTCTTTCCGGGTCGTGGG GGG Intronic
900951981 1:5863395-5863417 GCTTATTTCCAGGTCGGGGGTGG - Exonic
901295626 1:8158839-8158861 CCTTCTTTCCTTATCCTGGGTGG - Intergenic
903462877 1:23531355-23531377 CGTTCTTTCCGGGGGGGGGGGGG - Intergenic
904772091 1:32886308-32886330 CCTTCTCTCCGGGGCGGGGGTGG + Intronic
907828530 1:58041663-58041685 CCTTCTTTGAGGGTGGTGTGTGG - Intronic
916875196 1:168961567-168961589 CCTTCTTTCCAGTCCTTGGGTGG - Intergenic
917670680 1:177270641-177270663 CCTTCTTTCCTGGACCTGGTTGG + Intronic
918847689 1:189639729-189639751 CATTCTTTGAGGGTCGTGGAAGG - Intergenic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
921003329 1:211067373-211067395 CCTTCTTGCTTTGTCGTGGGTGG - Intronic
1073130711 10:101187395-101187417 CTTTCCTTCCTGGTCGTGGTCGG - Intergenic
1073326877 10:102648278-102648300 TCTTCTTTCCATGTCATGGGGGG - Intronic
1077225037 11:1435934-1435956 CCTGCTGTCCAGGACGTGGGAGG + Intronic
1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG + Intergenic
1079385790 11:19978185-19978207 ACTTCACTCCGGGTCGTAGGAGG - Intronic
1080751965 11:35158947-35158969 CCTTCTGTCCTGGCAGTGGGTGG + Intronic
1081812393 11:45921458-45921480 CCCCCTTTCCAGGTCATGGGAGG + Intergenic
1085322634 11:75583994-75584016 CCTTCTTTCTGGGTAGTGGAGGG + Intergenic
1089398743 11:118152558-118152580 CCTTCTTTGGGGGTGGGGGGAGG + Intronic
1090433309 11:126664721-126664743 CCTTGTTTCAGGGTCCTGGGAGG + Intronic
1091205472 11:133817996-133818018 CCATCTTTCCTGGGCGTGTGAGG - Intergenic
1091445521 12:542524-542546 GCTTCTGTCCAGGTTGTGGGAGG - Intronic
1096382784 12:51173001-51173023 CCATGTTTCCAGGCCGTGGGGGG - Intronic
1102644520 12:114395578-114395600 CCTTCTTTGAGGGGTGTGGGTGG - Intronic
1105594421 13:21823324-21823346 CCATCTTTTGGGGTGGTGGGGGG - Intergenic
1106437063 13:29732490-29732512 CCTTTTTTCCTGGTAGTGTGGGG + Intergenic
1109933344 13:69245524-69245546 GCTTCTTTCTTGGTCGTAGGAGG + Intergenic
1113111631 13:106829889-106829911 GCTTCTTTCTGGGTTGTAGGAGG + Intergenic
1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG + Intronic
1115381839 14:32748667-32748689 CCTTTTTTCCTAGTCTTGGGAGG - Intronic
1122822911 14:104356073-104356095 CCTCCATTCTGGGTTGTGGGAGG + Intergenic
1122939758 14:104976045-104976067 CTTTCTTGGGGGGTCGTGGGAGG + Intronic
1124581511 15:30959619-30959641 CCTTCTTTCCCCGACGTGGCTGG + Intronic
1129144344 15:73633396-73633418 CCTTCGCTCCGGGTCGTGGGCGG + Exonic
1129614069 15:77084092-77084114 CCCTCTTCCTGGGTTGTGGGTGG + Intergenic
1133393183 16:5425789-5425811 CCAGCTTTCAGGGACGTGGGGGG - Intergenic
1133809373 16:9149299-9149321 CCTTCTTTCGGGATGGTGGTGGG + Intergenic
1135743451 16:24996516-24996538 TCTGCTTTCCGAGTTGTGGGTGG - Intronic
1141231526 16:82171463-82171485 CCTTCTTTCCGGTTCTTATGGGG - Intergenic
1142893165 17:2958093-2958115 CCTTCTTTCCAGCTCGTGCTAGG - Intronic
1144404961 17:14943188-14943210 GCTTCTTTACTGGTGGTGGGAGG + Intergenic
1152334004 17:79690103-79690125 CCCTTTGTCGGGGTCGTGGGAGG - Intergenic
1156352010 18:36309894-36309916 CCCTCTTTCAGGGTCATGAGAGG - Intronic
1159464781 18:68767357-68767379 CCTTCTTTCTGGGCCATGTGAGG + Intronic
1161406783 19:4095317-4095339 CACTCCTTCCGGGTCCTGGGTGG - Intronic
1162767556 19:12929165-12929187 CCCTCTTTCCGGGGCTTGTGGGG - Intronic
1164724653 19:30457935-30457957 TCTTCTTTTTGGGTGGTGGGTGG + Intronic
1165419909 19:35717660-35717682 CCCGCTTTCCGGGTCCTGGCCGG + Intergenic
1168165671 19:54545799-54545821 CCTTCTTGGCGGGGGGTGGGTGG - Intergenic
931551220 2:63449373-63449395 CCTTCTTTCTGGAAAGTGGGGGG - Intronic
933702404 2:85264797-85264819 CCTTCTTTCTGGGTTGGGAGAGG - Intronic
934298281 2:91760724-91760746 CCTTCTTTCAGGGGAGTGCGGGG + Intergenic
934977103 2:98810430-98810452 CTTTCTTCCCAGGTCGTGGGTGG - Intronic
938919843 2:135985372-135985394 CCTCCTTTCCTGGGCCTGGGAGG - Intronic
1175924861 20:62466642-62466664 CCTTCTCACCGGGTCCTGCGTGG - Intronic
1182003747 22:26942017-26942039 CCTTCTTGCCGGGTGGCAGGGGG - Intergenic
1182316962 22:29454109-29454131 CCTGCTTTCTGGGTGGTGGCTGG + Intergenic
1184297007 22:43531209-43531231 CCTTCTTTCCGGGTTGCCAGTGG - Intronic
1184745665 22:46454239-46454261 CCTGCATTCAGGGGCGTGGGCGG - Intronic
1185158434 22:49208137-49208159 CATTCGTGCCGGGTCTTGGGGGG + Intergenic
951895942 3:27609732-27609754 CCTTCTTTCTGGGTATGGGGCGG - Intergenic
955909435 3:63845093-63845115 CCTTCTTTTCTGGGGGTGGGGGG + Intronic
963973825 3:151458798-151458820 CCTTCTTTAAGGGTCGTAAGTGG + Intergenic
966576249 3:181505864-181505886 CCTTCTTTCCGTGTTTTGGGTGG + Intergenic
967172292 3:186831137-186831159 CCTTCTTTCCGGTCCATAGGTGG - Intergenic
968617346 4:1583727-1583749 CGTTCTTGCCGGCTCATGGGTGG + Intergenic
979970380 4:127127575-127127597 CCTTCTTTCCCTGTTGTGTGAGG + Intergenic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
983309636 4:166042671-166042693 CTTTCTTGCCAGGTTGTGGGTGG + Intronic
986896029 5:12369710-12369732 CCTTGTTTGGGGGTTGTGGGAGG + Intergenic
995566687 5:113438184-113438206 CCTTATTTTTGGGTTGTGGGGGG + Intronic
1000622879 5:163505496-163505518 CCCTCTTTCTGGGGCGTCGGCGG + Intronic
1001286440 5:170427290-170427312 CTTTCTCTCCTGGTCGTTGGAGG - Intronic
1004509659 6:16275077-16275099 CCTTCTGTCCTTGTCATGGGTGG + Intronic
1013319041 6:108968580-108968602 ACTTCTGACCGGGTCGTGGCTGG + Intronic
1018710413 6:166494725-166494747 CCTTCCTTCCAGGTCTGGGGAGG + Intronic
1019585967 7:1803702-1803724 ACTTCTTTCCGGCTGGAGGGGGG + Intergenic
1024646474 7:51375259-51375281 CCTTCTTTCCAGGCAGTGGTGGG + Intergenic
1028862186 7:95665344-95665366 CTTTCTTTGAGGGTGGTGGGAGG + Intergenic
1031236781 7:119187668-119187690 GCTTCTTTCTTGGTTGTGGGAGG - Intergenic
1032861099 7:135880181-135880203 CCTTCTTCCTGGGTTGTAGGTGG + Intergenic
1033442197 7:141390228-141390250 CCTTCTTTCCTGGGCTTTGGGGG + Intronic
1036946450 8:13099385-13099407 CCTTCTTTCCGGGATCTCGGAGG + Exonic
1045931278 8:107629758-107629780 CCTTTTTTCTGGGTAGAGGGAGG - Intergenic
1046493829 8:114987317-114987339 CCTTCTTTGCGGGGAGGGGGCGG - Intergenic
1054807282 9:69406939-69406961 CTTTCTTTCCGGGGCATGGTTGG - Intergenic
1055090935 9:72364638-72364660 CCTTGTTGCCGGGCCGGGGGCGG - Intronic
1060814285 9:126626588-126626610 CCTTCCTTCCAGGTCAGGGGTGG + Intronic
1061746731 9:132745648-132745670 CTTTCTTTCCGGGTAGTGGAGGG + Intronic
1062636297 9:137493412-137493434 CCTGCCTTCAGGGTCGTGGGTGG - Intronic
1191009390 X:55744972-55744994 GCTTCTTTCTGGGTTGTAGGAGG + Intronic
1192326294 X:70134874-70134896 CTTTCTTGGCGGGTGGTGGGGGG + Intronic
1196241555 X:113347913-113347935 CCTGCTTTCCTGGGTGTGGGAGG + Intergenic
1196335648 X:114529640-114529662 CCTTCTTACTGGGGCGGGGGTGG + Intergenic
1196524768 X:116719373-116719395 CCTTCTTTCCTCGACGTGTGGGG - Intergenic
1200822893 Y:7606181-7606203 CCTGCTGTCCAGGTCCTGGGAGG - Intergenic
1200878046 Y:8180355-8180377 CCTGCATTCCAGGTCCTGGGAGG - Intergenic
1202189952 Y:22231437-22231459 CCTGCTGTCCAGGTCCTGGGAGG - Intergenic
1202237162 Y:22724908-22724930 CCTGCTGTCCAGGTCCTGGGAGG + Intergenic