ID: 1113437991

View in Genome Browser
Species Human (GRCh38)
Location 13:110307706-110307728
Sequence CTTCTTTCCGGGTCGTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437981_1113437991 3 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437982_1113437991 -6 Left 1113437982 13:110307689-110307711 CCTAACGGGAGGCTCTCCTTCTT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437972_1113437991 20 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437971_1113437991 27 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437980_1113437991 4 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437976_1113437991 14 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437991 Original CRISPR CTTCTTTCCGGGTCGTGGGG GGG Intronic