ID: 1113437994

View in Genome Browser
Species Human (GRCh38)
Location 13:110307718-110307740
Sequence TCGTGGGGGGGACGGCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437976_1113437994 26 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437980_1113437994 16 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437981_1113437994 15 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437982_1113437994 6 Left 1113437982 13:110307689-110307711 CCTAACGGGAGGCTCTCCTTCTT 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437989_1113437994 -10 Left 1113437989 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437994 Original CRISPR TCGTGGGGGGGACGGCCCTC CGG Intronic
900933030 1:5748491-5748513 TCGAGGGGCGAACGGTCCTCGGG - Intergenic
902531265 1:17092161-17092183 TCGTAGGGAGGAAGGGCCTCTGG + Intronic
902985012 1:20149746-20149768 AAGTGGAGGGGACGGCCCTGCGG + Exonic
905901799 1:41586275-41586297 TCCTGGGGAGGAGGGCCCTGAGG - Intronic
1063385873 10:5616239-5616261 CCGGGGGGTGGACGGCACTCAGG - Intergenic
1063385912 10:5616353-5616375 TCGGGGGGTGGGCGGCACTCGGG - Intergenic
1063385934 10:5616409-5616431 TCGGGGGGTGGGCGGCACTCGGG - Intergenic
1063385942 10:5616427-5616449 TCGGGGGGTGGGCGGCACTCGGG - Intergenic
1063385959 10:5616464-5616486 TCGGGGGGTGGGCGGCACTCGGG - Intergenic
1063385985 10:5616520-5616542 TCGGGGGGTGGGCGGCACTCGGG - Intergenic
1063385993 10:5616538-5616560 TCGGGGGGTGGACGGCACTCGGG - Intergenic
1065022207 10:21509956-21509978 GCGCGCGGGGGCCGGCCCTCGGG - Intergenic
1077024533 11:433353-433375 GCGTGGGGGGCAGGCCCCTCAGG + Exonic
1077108690 11:852843-852865 TGGTGGGAGGGACGTCCCCCCGG + Intronic
1090796029 11:130136267-130136289 TGATGAGGGGGACGGCTCTCAGG - Intronic
1104992919 12:132636255-132636277 TCGTGCTGGGGATGGCCCACAGG + Intronic
1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG + Intronic
1122871546 14:104641121-104641143 TCGTGGGGGTGAAGGACCTCAGG + Intergenic
1131152950 15:90058258-90058280 TTGGGGTGGGGAGGGCCCTCTGG + Intronic
1131158350 15:90088674-90088696 TCCTGGGGGGGACTGTCTTCCGG - Exonic
1131263722 15:90903372-90903394 GCGTGGGCGGGACCGCGCTCCGG - Exonic
1138448272 16:57078053-57078075 TGGTGGGGAGGAGGGTCCTCGGG + Intronic
1142094700 16:88233225-88233247 ACCTGGCGGGGACGGCTCTCTGG - Intergenic
1143493343 17:7296362-7296384 TGGTGGGGGAGGCGGCCCTAGGG - Intergenic
1145176663 17:20706903-20706925 ACCTGGAGGGGACGGCCCTGGGG + Intergenic
1145909336 17:28533499-28533521 TGGTGGGGAGGCCAGCCCTCAGG - Intronic
1146208163 17:30922275-30922297 GTGTGGTGGAGACGGCCCTCGGG - Intronic
1147211671 17:38875555-38875577 TCTTGGGGAGGACGGCCAGCCGG - Intronic
1147429468 17:40362786-40362808 GCGTTGTGGGGACGGCCCGCGGG - Intronic
1151750926 17:76037148-76037170 TCGTGAGGGGGACGGGCATGGGG - Intergenic
1152930779 17:83108538-83108560 GCGTAGGGGGGACGGGGCTCTGG + Intergenic
1160955916 19:1691666-1691688 TGGTGGGGAGGACGGGCTTCAGG - Intergenic
925845953 2:8033712-8033734 TGGTGAGGGTGACGGGCCTCTGG - Intergenic
933876080 2:86623255-86623277 AGGTGGCGGGGTCGGCCCTCCGG + Exonic
948596398 2:239082279-239082301 TGGGGTTGGGGACGGCCCTCAGG - Intronic
1175765343 20:61588613-61588635 TCGGGAGGGGGAGGGCCCTGGGG - Intronic
1176380583 21:6110685-6110707 TCCAGGAGGGGACGGCTCTCGGG - Intergenic
1176550423 21:8218659-8218681 TGGAGGGGGGGGCGGCCCGCCGG - Intergenic
1176577265 21:8445929-8445951 TGGAGGGGGGGGCGGCCCGCCGG - Intergenic
1179742889 21:43427555-43427577 TCCAGGAGGGGACGGCTCTCGGG + Intergenic
1185010285 22:48309082-48309104 TGGGGGGAGGGACGGCCCTAGGG + Intergenic
961379334 3:126487071-126487093 TCTTGGGGAGGCCTGCCCTCAGG + Intronic
965362289 3:167756066-167756088 TCGTGGGCAGGATGGCTCTCTGG - Intronic
968066237 3:195761337-195761359 TGGTGGTGGGGACAGCCCTGGGG + Intronic
968697521 4:2040499-2040521 CCCTGGGGGGGACGTGCCTCCGG - Intronic
969259608 4:6025132-6025154 TTGTGGGGGGAAGGTCCCTCAGG - Intergenic
988029510 5:25745105-25745127 TCCTGGGGGGGTCAGCCCTTTGG + Intergenic
993467722 5:88268889-88268911 GCGTGGGGTCGACGGCGCTCTGG - Intronic
1002170270 5:177370854-177370876 TTGGCGGGGGGCCGGCCCTCCGG + Intronic
1002664172 5:180810513-180810535 TCGCGGGGGGGTTGGCCCTTGGG + Intronic
1015244781 6:131063353-131063375 TCGGGGGCGGGACCGCCCGCGGG - Intergenic
1015366264 6:132401178-132401200 TCGTGGGCGGGGTGGCCCACGGG - Exonic
1019361106 7:604562-604584 CCGTGGGGGGCACGTGCCTCGGG - Intronic
1019708923 7:2509614-2509636 TGGTGGGGCGGGCGGCCCTGGGG - Intergenic
1035337935 7:158142108-158142130 TCGTGGGAGGGGCAGCCCCCAGG - Intronic
1049593694 8:143473911-143473933 TCGTGGAGGGGAGGGGCCTCGGG - Intronic
1190474468 X:50813446-50813468 GCCTGGGAGGGACGGCCCGCCGG + Intronic
1200003936 X:153075332-153075354 GGGTGGGGGGGGCGGCGCTCAGG + Intergenic