ID: 1113439580

View in Genome Browser
Species Human (GRCh38)
Location 13:110317678-110317700
Sequence CGGTTGGGGGTTGTGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113439580_1113439586 -6 Left 1113439580 13:110317678-110317700 CCTGCAGACACAACCCCCAACCG 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1113439586 13:110317695-110317717 CAACCGGCCCTCTCCAAGTCTGG 0: 1
1: 0
2: 1
3: 1
4: 73
1113439580_1113439593 15 Left 1113439580 13:110317678-110317700 CCTGCAGACACAACCCCCAACCG 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1113439593 13:110317716-110317738 GGCTTGAAACTCCGGGCCACTGG 0: 1
1: 0
2: 0
3: 13
4: 293
1113439580_1113439591 7 Left 1113439580 13:110317678-110317700 CCTGCAGACACAACCCCCAACCG 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1113439591 13:110317708-110317730 CCAAGTCTGGCTTGAAACTCCGG 0: 1
1: 0
2: 2
3: 19
4: 238
1113439580_1113439592 8 Left 1113439580 13:110317678-110317700 CCTGCAGACACAACCCCCAACCG 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1113439592 13:110317709-110317731 CAAGTCTGGCTTGAAACTCCGGG 0: 1
1: 0
2: 13
3: 332
4: 4826
1113439580_1113439595 17 Left 1113439580 13:110317678-110317700 CCTGCAGACACAACCCCCAACCG 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1113439595 13:110317718-110317740 CTTGAAACTCCGGGCCACTGGGG 0: 1
1: 0
2: 1
3: 20
4: 192
1113439580_1113439594 16 Left 1113439580 13:110317678-110317700 CCTGCAGACACAACCCCCAACCG 0: 1
1: 1
2: 0
3: 9
4: 109
Right 1113439594 13:110317717-110317739 GCTTGAAACTCCGGGCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113439580 Original CRISPR CGGTTGGGGGTTGTGTCTGC AGG (reversed) Intronic
900256752 1:1701564-1701586 CGGGGGGGGGCTGTGCCTGCAGG + Intronic
900913506 1:5618649-5618671 CTGTTGTTGGCTGTGTCTGCTGG - Intergenic
901476279 1:9491824-9491846 CAGTTGGGGGTAGTGCATGCAGG - Intergenic
905540244 1:38755018-38755040 GGGTTGGGGGTGTTCTCTGCTGG - Intergenic
910669873 1:89762344-89762366 CGGGTGGGGGGTGTGTGGGCAGG - Intronic
912956349 1:114156461-114156483 TGTTTGGGGGTTGGGTTTGCAGG - Intergenic
916233414 1:162561942-162561964 GGGCTGGGGTGTGTGTCTGCGGG - Intronic
918553108 1:185766830-185766852 CGGTGGTTGGTTGTTTCTGCTGG - Intronic
919386853 1:196933771-196933793 CGGGTGGGTGTGGTATCTGCGGG + Intronic
919739229 1:200972402-200972424 AGCATGGGGGCTGTGTCTGCTGG - Intronic
922030176 1:221790178-221790200 TGGTTGGGGGTTGTGTCATGAGG + Intergenic
922620167 1:226984017-226984039 TGGTTGGGGGGTGTGTGTGGGGG + Intronic
922794734 1:228334463-228334485 CGGTGGGGGCCTGTGTGTGCTGG + Intronic
1063575874 10:7261533-7261555 CGGGTGGGGGTTACGTATGCAGG + Intronic
1069526943 10:69180586-69180608 CGGCAGAGGGTGGTGTCTGCTGG + Intronic
1074154108 10:110783226-110783248 GGGTGGAGGGATGTGTCTGCAGG + Intronic
1077881103 11:6351058-6351080 CAGTTTGAGGTTGTGTATGCAGG - Intergenic
1078062686 11:8058332-8058354 CGCTTGTCTGTTGTGTCTGCGGG + Intronic
1078353891 11:10618950-10618972 GGGTTGGGGGTTGGGAGTGCAGG + Intronic
1083611767 11:64007766-64007788 CTGGTGGGTGTTGTGTGTGCAGG - Intronic
1083666431 11:64277363-64277385 AGGTTGGGGGTGTTCTCTGCAGG - Intronic
1084447141 11:69210213-69210235 AGGTTGGGGGCTGTGTTTGAAGG - Intergenic
1088112368 11:106277368-106277390 GGGTTGTGGGATATGTCTGCAGG + Intergenic
1089534213 11:119150541-119150563 AAGTAGGGGGCTGTGTCTGCAGG + Intronic
1090533221 11:127612853-127612875 AGGTTGGTGGTTGTGCCTGGTGG - Intergenic
1090700146 11:129287060-129287082 CGGTCGGGGATGGTGTCAGCAGG + Intergenic
1095954462 12:47798372-47798394 GGGTGGGGGGTGGTGTCTGGAGG - Intronic
1106927882 13:34632105-34632127 GGTTTGGGGCTTCTGTCTGCAGG + Intergenic
1107430738 13:40338167-40338189 GGATTGGGGGTTCTGCCTGCTGG - Intergenic
1108615659 13:52129211-52129233 CGGTTGCGGGGTGACTCTGCCGG - Intergenic
1110985031 13:81956538-81956560 GGGTTGTGGGGTGTGTTTGCAGG - Intergenic
1113439580 13:110317678-110317700 CGGTTGGGGGTTGTGTCTGCAGG - Intronic
1113439730 13:110318933-110318955 AGGTTGGGGGTTGTGTCTGCAGG + Intronic
1121540537 14:94722624-94722646 TGGTTGGGGGTTGTGGTTGGTGG + Intergenic
1122210173 14:100168382-100168404 GGGTTGGGGGGTGTGTGTGTTGG - Intergenic
1123132306 14:105998663-105998685 TGGGTGGGGGTTATGTCTGCAGG + Intergenic
1123582525 15:21729775-21729797 TGGGTGGGGGTTATGTCTGCAGG + Intergenic
1123619175 15:22172371-22172393 TGGGTGGGGGTTATGTCTGCAGG + Intergenic
1125341848 15:38683240-38683262 AGTTGGGGGGTTGTTTCTGCAGG - Intergenic
1128555829 15:68631061-68631083 CGGTTGGGGGTAGGGGGTGCTGG + Intronic
1134828987 16:17308172-17308194 GGGTTGTGGGATGTGTCTACAGG - Intronic
1135967231 16:27046166-27046188 CAGTTGGTGGTTTTGGCTGCTGG - Intergenic
1136872239 16:33817918-33817940 TGGATGGGGGTGATGTCTGCAGG - Intergenic
1141684372 16:85561906-85561928 GGGTTGGGGGTGGTGTCTGGAGG + Intergenic
1141685443 16:85567211-85567233 CGGCTGGTGGGTGGGTCTGCAGG + Intergenic
1141963564 16:87425725-87425747 CGGCAGGGGTTTGTGTCTGTTGG - Intronic
1142133798 16:88442615-88442637 CGCCTGGGGGCTGCGTCTGCTGG - Intergenic
1142150395 16:88510100-88510122 AGGTTAGGGGGTGTGTCTGCCGG - Intronic
1203099933 16_KI270728v1_random:1298150-1298172 TGGATGGGGGTGATGTCTGCAGG + Intergenic
1144037676 17:11382021-11382043 TGGTTGGGGGTAGTGGGTGCAGG + Intronic
1147214283 17:38890413-38890435 CTGCTTGGGGTAGTGTCTGCAGG - Exonic
1147717527 17:42518534-42518556 CTGGTGGGGGTTGTGACTGAGGG - Intronic
1149601546 17:57896114-57896136 GGGTTGGGAGTTCTGTTTGCAGG - Intronic
1150624095 17:66830331-66830353 GGGGTGGGGGTGGAGTCTGCAGG - Intergenic
1157100570 18:44725397-44725419 GGGTTGGGGGGTGTGTGTGGAGG + Intronic
1163111968 19:15166806-15166828 CTGGTGGGGGTCGGGTCTGCTGG - Intronic
1163129825 19:15265419-15265441 CGGGTGGGGGTTGTGGCTGGGGG + Exonic
927333330 2:21891613-21891635 CTGTTGGGAGCTGTGACTGCGGG + Intergenic
936729255 2:115360809-115360831 GGGTTGTGGGGTATGTCTGCTGG + Intronic
937304325 2:120861869-120861891 CAGGCAGGGGTTGTGTCTGCAGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
947719544 2:232362134-232362156 TGGTGGAGGGTTGTGACTGCAGG - Intergenic
948624702 2:239261836-239261858 CGGGTGGGGGGTGTCCCTGCCGG - Intronic
1172855282 20:37996953-37996975 AGGTTGGAGGCTGTTTCTGCAGG - Exonic
1172971404 20:38875587-38875609 CGCTGGGGGGTTTTGTTTGCGGG - Intronic
1175190771 20:57211012-57211034 TGGTGGGGGGCTGTGTCTGAAGG - Intronic
1175932811 20:62501020-62501042 GGGTTGGGATTTGTGTGTGCGGG + Intergenic
1175932826 20:62501216-62501238 GGGTTGGGATTTGTGTGTGCGGG + Intergenic
1175932832 20:62501266-62501288 GGGTTGGGATTTGTGTGTGCGGG + Intergenic
1176266421 20:64211857-64211879 GGGTGGGGAGTTGTGTCTGCAGG + Intronic
1176304020 21:5114128-5114150 GGGTTGGGGGTTGAGTGTGGAGG + Intergenic
1176373184 21:6074649-6074671 CAGGAGGGGGCTGTGTCTGCAGG + Intergenic
1179610604 21:42547750-42547772 GGGGCGGGGGGTGTGTCTGCGGG - Intronic
1179750293 21:43463594-43463616 CAGGAGGGGGCTGTGTCTGCAGG - Intergenic
1179853010 21:44147822-44147844 GGGTTGGGGGTTGAGTGTGGAGG - Intergenic
1180926699 22:19560055-19560077 GGGTTGGGGGTGGGGGCTGCTGG + Intergenic
1181024996 22:20123008-20123030 TGGTTGGGTGTGGTGTCTGGCGG + Intronic
1183663837 22:39236082-39236104 CTGTTGGGGGTTGAGGGTGCAGG - Intronic
1183959985 22:41405712-41405734 CGAGTGGGGGTGGTGTGTGCAGG + Intergenic
953545892 3:43863378-43863400 GGGTTGGGGCCTGTGGCTGCAGG + Intergenic
954502283 3:51029746-51029768 GGGTTGTGGGGTATGTCTGCTGG + Intronic
956788627 3:72663040-72663062 GGGTTGGGGGTTGTTTATGGTGG - Intergenic
962444544 3:135452947-135452969 AGGCTGGGAGCTGTGTCTGCTGG - Intergenic
969670338 4:8586692-8586714 CGGTAGCTGGTTGTGTGTGCAGG + Intronic
972726607 4:41750983-41751005 GGGTTGGGGGATGTGCTTGCTGG + Intergenic
975413375 4:74080740-74080762 CTGTTGGGGGTTGGGGCTGGGGG + Intergenic
983877349 4:172892941-172892963 AGGTTGTGGTGTGTGTCTGCAGG + Intronic
993452446 5:88089667-88089689 GGGTTAGGGGTTATGTCTGGGGG - Intergenic
995689621 5:114809859-114809881 CTGTTGGTGGTTGTTTCTGTTGG - Intergenic
998096129 5:139396371-139396393 CGTTTGGGGGAGGTGTCAGCAGG + Intergenic
998350291 5:141496063-141496085 GGGTGGGGGGTTGTGTGTGCTGG - Intronic
999118358 5:149185251-149185273 CAGTTGGCGGGTGGGTCTGCTGG + Intronic
999857177 5:155607449-155607471 CCCTTGGAGGTTGTGTCTGGAGG - Intergenic
1004116969 6:12778900-12778922 TGGCTTGGGGCTGTGTCTGCAGG - Intronic
1004811672 6:19269874-19269896 TGGCTTGGGGATGTGTCTGCTGG - Intergenic
1007506624 6:42340373-42340395 CGGTTGAGGGTTCTTTCTGGTGG + Intronic
1008092672 6:47309058-47309080 GGGTGGGGGGCTGTGGCTGCGGG + Intronic
1011584477 6:88909439-88909461 GGGTTGTGGGGTATGTCTGCAGG - Intronic
1014721877 6:124926855-124926877 ATGTCTGGGGTTGTGTCTGCAGG - Intergenic
1019274228 7:167364-167386 CGGTTGGAGGCTCTGCCTGCAGG + Intergenic
1029633710 7:101769723-101769745 TGGTTGGGGCTTGTGTATGTGGG - Intergenic
1031076607 7:117219455-117219477 TGGTTTGGGCTGGTGTCTGCTGG + Intronic
1033652081 7:143351306-143351328 CAGTGGGGGGATGTGGCTGCAGG + Intronic
1035109100 7:156465376-156465398 CTCTTGGGAGATGTGTCTGCCGG - Intergenic
1037911092 8:22743987-22744009 AGCCTGGGGGTTGTGGCTGCAGG + Intronic
1045217925 8:100167009-100167031 CTGTTGGGGGTGGTGTATGAAGG - Intronic
1046138551 8:110061627-110061649 GGGTGGGGGGTTTTGTCAGCAGG - Intergenic
1049602630 8:143515001-143515023 CGGGAGGGGTGTGTGTCTGCAGG - Intronic
1053071840 9:35106508-35106530 CCGTTGGGGTTTGTGATTGCCGG - Intronic
1056589082 9:87951278-87951300 AGGCTGTGGGTTATGTCTGCAGG + Intergenic
1057826821 9:98378002-98378024 GGGTTTGGGGCTGTTTCTGCAGG - Intronic
1062410723 9:136422767-136422789 GGGCTGGGGGTTTTTTCTGCAGG + Intronic
1186410402 X:9341141-9341163 GGGTTTGGGGATGTGTCTGTAGG - Intergenic
1191256288 X:58281001-58281023 GGGTTGGGGGCAGTGTCTACTGG + Intergenic
1194317929 X:92405061-92405083 TGGTTGGGGGTTGTGACTTGAGG + Intronic
1194349452 X:92808359-92808381 AGGTTGTGGGGTATGTCTGCAGG + Intergenic
1194671189 X:96734592-96734614 TGATTGGGGTTTGTGTCAGCAGG + Intronic
1197076850 X:122363580-122363602 GGGTTGGGGGTTGGGTATGCAGG + Intergenic
1200037074 X:153338525-153338547 CATTTGGGGGTTGTGGCTCCAGG + Intronic
1200657774 Y:5924960-5924982 AGGTTGTGGGGTATGTCTGCAGG + Intergenic