ID: 1113440086

View in Genome Browser
Species Human (GRCh38)
Location 13:110322173-110322195
Sequence CTGCTCCTTCATCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 316}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113440086_1113440102 26 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440102 13:110322222-110322244 GCCTGCCTGTCTCTCGGAGGCGG 0: 1
1: 0
2: 2
3: 21
4: 198
1113440086_1113440101 23 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440101 13:110322219-110322241 CCTGCCTGCCTGTCTCTCGGAGG 0: 1
1: 1
2: 5
3: 35
4: 347
1113440086_1113440095 -5 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440095 13:110322191-110322213 AGCAGGGGGCAAGGAAGCCTGGG 0: 1
1: 0
2: 4
3: 50
4: 432
1113440086_1113440094 -6 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440094 13:110322190-110322212 GAGCAGGGGGCAAGGAAGCCTGG 0: 1
1: 0
2: 6
3: 71
4: 572
1113440086_1113440096 -4 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440096 13:110322192-110322214 GCAGGGGGCAAGGAAGCCTGGGG 0: 1
1: 0
2: 0
3: 63
4: 525
1113440086_1113440097 0 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440097 13:110322196-110322218 GGGGCAAGGAAGCCTGGGGCTGG 0: 1
1: 0
2: 8
3: 72
4: 674
1113440086_1113440099 20 Left 1113440086 13:110322173-110322195 CCCAGCTCCAGATGAAGGAGCAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 1113440099 13:110322216-110322238 TGGCCTGCCTGCCTGTCTCTCGG 0: 1
1: 0
2: 7
3: 53
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113440086 Original CRISPR CTGCTCCTTCATCTGGAGCT GGG (reversed) Intronic
900096762 1:942955-942977 CGGCCCCTCCAGCTGGAGCTTGG - Exonic
900420808 1:2555223-2555245 GTGCACCTGCCTCTGGAGCTCGG + Intergenic
901417656 1:9128733-9128755 CAGCTCCTTCTTCTGGACCGTGG - Exonic
901457210 1:9369920-9369942 CTGCTCCTTCCCCTAGAGCCTGG - Intergenic
901499611 1:9643726-9643748 CTGCTTCCTCATCTGTAGCCTGG - Intergenic
901511976 1:9722039-9722061 CAGCTCCTTGGTCTGGGGCTTGG - Exonic
901654133 1:10759697-10759719 CTGCCCCTCCCTCTGGGGCTGGG - Intronic
901885636 1:12220996-12221018 ATGCTCCTTGTTCTGCAGCTTGG + Intergenic
902573357 1:17361048-17361070 CACCCCCTTCTTCTGGAGCTGGG + Intronic
903363871 1:22794115-22794137 ATCCTCCGTCATCTGGAGGTAGG - Intronic
903520960 1:23949430-23949452 CTTCTCCTTCGGCTGGAGCTCGG + Intergenic
904330900 1:29757332-29757354 CTGCTTCTTCAGCCGGGGCTGGG + Intergenic
905222786 1:36460433-36460455 CTGCTTCCTCATCTGGAAATGGG - Intronic
905253346 1:36664371-36664393 TTTCTCCTTCACCTAGAGCTTGG - Intergenic
905441863 1:38000955-38000977 CTTCTCCTTCAGCTTGAGCCAGG - Intronic
906184637 1:43852063-43852085 CTGCTCCTTAGTCTGCACCTAGG - Intronic
906489073 1:46253819-46253841 ATTCTCCTTCAGCTGGAGCTTGG + Intronic
906614932 1:47227510-47227532 CTGCAGCCTCCTCTGGAGCTTGG + Intronic
907503040 1:54897298-54897320 TTGCTCTCTCTTCTGGAGCTAGG + Intergenic
907722456 1:56984482-56984504 CTGCTTCTGCATATGGAGGTGGG + Intergenic
912124249 1:106513456-106513478 CTGCATTTTCTTCTGGAGCTTGG + Intergenic
912699579 1:111867077-111867099 CTGTTCCTTCATCTGTAGAAAGG + Intronic
913389307 1:118292873-118292895 CTGCTCCTTAGTGTGGAGCCTGG - Intergenic
913578101 1:120197331-120197353 CAGCTCCTGCCTCTGGAGCCCGG + Intergenic
913630069 1:120701021-120701043 CAGCTCCTGCCTCTGGAGCCCGG - Intergenic
914560019 1:148808751-148808773 CAGCTCCTGCCTCTGGAGCCCGG + Intronic
914612814 1:149321464-149321486 CAGCTCCTGCCTCTGGAGCCCGG - Intergenic
918144883 1:181746910-181746932 CTGCTTCTTCATCTGTAAATGGG + Intronic
919804828 1:201375361-201375383 CTGCTCCCTCTGCTGGAGCAGGG + Intronic
919891510 1:201978730-201978752 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
920033091 1:203048946-203048968 CTGCTCCTCAATCTGCCGCTGGG - Intronic
920101821 1:203521744-203521766 CTGGTCATTTATCTGGGGCTGGG - Intergenic
920348385 1:205321515-205321537 CTGCTTCTTCATTAGGGGCTTGG + Exonic
921557357 1:216614933-216614955 CTGCTCATTTATCTGGGCCTTGG - Intronic
921941155 1:220841383-220841405 TTGCATTTTCATCTGGAGCTTGG + Intergenic
922496667 1:226062785-226062807 CTTCTCCTTCGGCTGGAGCTCGG - Intronic
922843680 1:228665687-228665709 TTGCTCTTTATTCTGGAGCTAGG - Intergenic
923510326 1:234646075-234646097 CTGCTCCTTCAGCTGCATCCTGG + Intergenic
923816067 1:237380482-237380504 CAGTTCCTTCATCTGGAGTCTGG + Intronic
924204934 1:241702605-241702627 CTGTTCCTGCATCTAGAGCAGGG + Intronic
924367711 1:243313541-243313563 CTGCTCTTTCATCTGGATCATGG + Intronic
924801223 1:247331007-247331029 CGGCTCCGGCATCTGGAGCCCGG + Intronic
1063523474 10:6761537-6761559 CTCCTGTTTCATCTGGACCTTGG + Intergenic
1065918054 10:30368562-30368584 CTGCTCCTTCCTCGGGTGCTCGG + Intronic
1067082852 10:43221427-43221449 CTGTTCCTTCATCTGGAGAAGGG - Intronic
1067480750 10:46595963-46595985 CTGACCCTTGATTTGGAGCTTGG - Intergenic
1067613989 10:47745838-47745860 CTGACCCTTGATTTGGAGCTTGG + Intergenic
1067694912 10:48527816-48527838 CTGGCCCTTCTTCTGGAGCAAGG - Intronic
1067756944 10:49012362-49012384 CTGCTTCTTCATCTGCAAATTGG + Intergenic
1069854004 10:71429297-71429319 CTGCTCATTCTTCTGGGGCCAGG + Intronic
1069859340 10:71460770-71460792 CTGCTCCTGAATGTGGAGTTGGG + Intronic
1069889804 10:71645757-71645779 CTGCTCCTCCATTTGGGTCTAGG + Intronic
1070692128 10:78534665-78534687 CTGTTTCTTCATCTGGCTCTGGG + Intergenic
1070825540 10:79388375-79388397 CAGCTCCTCCATCTGGGGCTTGG + Intronic
1070965917 10:80530333-80530355 CTGCTTCTTAATCTGGGGCCTGG - Exonic
1071629397 10:87205813-87205835 CTGACCCTTGATTTGGAGCTTGG + Intergenic
1072356248 10:94614538-94614560 CTGCTCCTGAAGCTGGAGGTGGG - Intergenic
1072854469 10:98932580-98932602 CTGTAACTCCATCTGGAGCTGGG + Intronic
1072916747 10:99541373-99541395 CTGCTTCTTCATCTGGGAGTTGG - Intergenic
1074094660 10:110300586-110300608 CTGCTCCTTCATCGACAGATGGG + Intronic
1076464289 10:130667577-130667599 CTGCTCCATCAGCTGGATCCTGG + Intergenic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1077196725 11:1284707-1284729 CTGCTCTTTCCTCTGGAGAAAGG + Intronic
1078428934 11:11272396-11272418 CTACTCCTGCCTCTGGAGGTTGG - Intronic
1078874989 11:15384538-15384560 CTGCTCCATCTTCTGTAGCTGGG + Intergenic
1081713759 11:45234247-45234269 TTGCTCCATCATCTGGTGCCTGG - Intronic
1083856493 11:65395656-65395678 CTCCTCCTTCATGTGGGGCGGGG + Intronic
1084185079 11:67467311-67467333 CTGCTCCTGCTGCTGGGGCTGGG - Exonic
1084246462 11:67860883-67860905 CCCCACCTTGATCTGGAGCTGGG + Intergenic
1084793467 11:71489601-71489623 AAGCTCCTTCAGCAGGAGCTGGG - Intronic
1085496175 11:76971891-76971913 CCACCCCTTCATCTGGATCTAGG - Intronic
1085650269 11:78261600-78261622 CTGTTCCTTCGTGTGGGGCTTGG + Intronic
1086550935 11:88050918-88050940 CTGCACCTCCATCTGGAGCCAGG - Intergenic
1087177551 11:95109332-95109354 CTGCTCCTTGATCTGCTGCAAGG - Intronic
1087810770 11:102607365-102607387 AGGCTCATTCTTCTGGAGCTGGG - Intronic
1088407396 11:109497103-109497125 GTGTTCCTTCCTCTGGAACTAGG + Intergenic
1089399009 11:118153594-118153616 CTGCTCCCTAACCTGGAGCGTGG - Intergenic
1089459085 11:118642243-118642265 CAGCTTCTCCATCTGGAGGTGGG - Exonic
1091109219 11:132950058-132950080 CTGCACCTTCATCTGCTGCTGGG - Intronic
1091515344 12:1174612-1174634 CTACTCCATCATCTGCATCTAGG - Intronic
1093291982 12:17337319-17337341 TTGCTCTTTCTTCTGGAGCTTGG + Intergenic
1095102924 12:38202139-38202161 GTGCTCGTGGATCTGGAGCTGGG + Intergenic
1095487439 12:42699717-42699739 CTGTGCTCTCATCTGGAGCTTGG + Intergenic
1096223525 12:49848363-49848385 CTTCTCCCTCATCTGCAGCCAGG - Intergenic
1096820223 12:54227923-54227945 CTGCTTCTACATCTGCAGCAAGG - Intergenic
1098257023 12:68627074-68627096 ATGCTCCTTGTTCTGCAGCTTGG + Intronic
1098859257 12:75688991-75689013 GTGCTCCTTGTTCTGCAGCTTGG + Intergenic
1101969704 12:109304536-109304558 CTGCCCCTTCATCAGCAGCAGGG + Intronic
1102473583 12:113174591-113174613 CACCTCCTTCAGCTGGAGTTTGG - Intronic
1104047156 12:125171559-125171581 CTGTGTCCTCATCTGGAGCTTGG + Intergenic
1105232926 13:18516445-18516467 CTGCCCCCTTATCTGGATCTAGG - Intergenic
1105943270 13:25170081-25170103 CTGCTCCTTCTCCGGGTGCTTGG + Exonic
1106066959 13:26362548-26362570 CTTCTCTTTCCTCTGGAGCTGGG - Intronic
1107784501 13:43941507-43941529 TTGCTCTTTCTTCTGGAGCAGGG + Intergenic
1110587229 13:77207968-77207990 ATACTCATTCATCTGGGGCTGGG - Intronic
1113174853 13:107551429-107551451 CTGCTCCTTAATTTTGAGCTAGG + Intronic
1113440086 13:110322173-110322195 CTGCTCCTTCATCTGGAGCTGGG - Intronic
1114469251 14:22947907-22947929 CTGCTCCTTCTGCTGGCTCTTGG + Exonic
1117392923 14:55279744-55279766 CTGGGCCTACCTCTGGAGCTGGG + Intronic
1117507188 14:56415593-56415615 TTTCTCCCTCTTCTGGAGCTGGG - Intergenic
1119196094 14:72717754-72717776 CTGCTCCTTCTGCTGGCCCTGGG - Intronic
1119386483 14:74260666-74260688 CTGCTCCATCTTGTCGAGCTTGG - Exonic
1119548348 14:75489848-75489870 CTGTTCCTTCATCTGCAGCATGG + Intergenic
1119683710 14:76613212-76613234 TGTCTCCTTCCTCTGGAGCTGGG + Intergenic
1120018391 14:79500350-79500372 CTTCTCCTTCATCTTGAGCGAGG + Intronic
1120924672 14:89785682-89785704 CTGCCCCTTGATCTTGATCTTGG + Intergenic
1120999715 14:90442867-90442889 CTGCTGCTCCATCTGAGGCTGGG - Intergenic
1122259198 14:100502467-100502489 CAGCTCCCTCTCCTGGAGCTGGG + Intronic
1122460122 14:101887744-101887766 TTTCTCCTTCCTCTGAAGCTGGG - Intronic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1125265413 15:37873816-37873838 ATGCTCCTTCATATGGATTTAGG + Intergenic
1126116803 15:45215496-45215518 CTTCTCCTTCGACTGGAGCTCGG - Intergenic
1126751180 15:51878110-51878132 CTGCTCCCTGATCTGCAGCCTGG + Intronic
1128074760 15:64819124-64819146 CAGCTCCTTCAACTAAAGCTGGG - Exonic
1128823179 15:70681028-70681050 CTGCTCCCTCATCAGGGGCTGGG + Intronic
1129506176 15:76083343-76083365 CTGCTCCTTGGTCTCGAGCAAGG + Intronic
1130881782 15:88061649-88061671 CTGCTTCTTCATCTGGTGCCTGG + Intronic
1132029157 15:98426568-98426590 CTGCACCTGCATCTGGTCCTTGG + Intergenic
1133090786 16:3402234-3402256 CTGCTCCTTGGTGTGCAGCTCGG - Exonic
1135956690 16:26962109-26962131 CTGCCCCTTCCTCTTAAGCTGGG - Intergenic
1136948427 16:34684986-34685008 CTGCCCCTTTGTCTGGATCTAGG - Intergenic
1138061563 16:53896774-53896796 ATTTTCCTTCCTCTGGAGCTGGG + Intronic
1138175355 16:54893109-54893131 CTGCTGCTGCAGCTGGAGATGGG - Intergenic
1138706615 16:58921574-58921596 CTGTTTCTTCATCTGTAACTTGG - Intergenic
1139338980 16:66254896-66254918 CTGCTTCTCCATCTGTAACTTGG + Intergenic
1141393670 16:83685717-83685739 CTGCTCCTTCTTCTCGACTTGGG - Intronic
1143280703 17:5752178-5752200 CTGCTGCTTCATCTGTGGCCAGG - Intergenic
1144949222 17:18985047-18985069 CGGCTCCTTCCTCCTGAGCTTGG - Intronic
1145993095 17:29090915-29090937 CTGCTCCTCCAGCTGGAGAGAGG + Exonic
1146356798 17:32141379-32141401 CTGTTCCTTCTTCTGTAGCATGG - Exonic
1146473941 17:33146651-33146673 CAGCTCATGCCTCTGGAGCTCGG + Intronic
1146656213 17:34636703-34636725 CTGCTTCCTCATCTGGAGGGAGG + Intronic
1147663453 17:42129946-42129968 CTGTTCCTTCTTCTGGAAGTGGG + Intronic
1147978859 17:44262640-44262662 CGGCTCCTCCATCTGGGACTCGG + Exonic
1148324747 17:46776771-46776793 CCGCTCCTTCCTCTGGTGTTTGG + Intronic
1149297358 17:55272914-55272936 CTGTTCATTCATCAGGGGCTAGG + Intronic
1151707323 17:75776331-75776353 CTTCTGATTCATCTGGGGCTGGG - Intergenic
1151868733 17:76822209-76822231 TTGCCACTTGATCTGGAGCTGGG + Intergenic
1151961056 17:77405845-77405867 CTGCCCCTCCATGTGGGGCTGGG + Intronic
1152088228 17:78232735-78232757 CAGCTCCCTCCTCCGGAGCTGGG + Intronic
1152391630 17:80007210-80007232 CTGAGCCTTCATCAGGAGCAGGG + Intronic
1152542062 17:80981500-80981522 CTGCTCCTTCCCCTGGCGCGGGG + Intergenic
1153240291 18:3025270-3025292 ATGCTCCTTGTTCTGCAGCTTGG + Intergenic
1156338531 18:36189888-36189910 CTGTTCTTTCATCTGCAGATGGG - Intronic
1157312115 18:46560321-46560343 CTTCTTCTTCCTCTGCAGCTTGG + Intronic
1158490159 18:57902764-57902786 CTCCTGCTTCTCCTGGAGCTGGG - Intergenic
1158599809 18:58847457-58847479 CTGATCCCGCACCTGGAGCTGGG + Intergenic
1159045136 18:63362492-63362514 GTGCTCCTTCAACTAGACCTTGG + Intronic
1159875760 18:73809214-73809236 CCGCTTCTTCATCTGTAGATTGG - Intergenic
1160049619 18:75420761-75420783 CTGCTCCATCATCTCCAACTTGG - Intronic
1160379323 18:78439586-78439608 CTGTTCCTTCTTGTAGAGCTGGG - Intergenic
1160518530 18:79491303-79491325 CTGCTCCTTCTCCAGGTGCTGGG - Intronic
1161144594 19:2670263-2670285 GTGCTCCTTCCTCTGGAGCCAGG - Intronic
1162297017 19:9820232-9820254 ATGCTCCTTGTTCTGCAGCTTGG - Intronic
1162762648 19:12897586-12897608 CTGGTCCCTCATTGGGAGCTTGG + Intronic
1163105145 19:15119087-15119109 CTCCTCCTTCGTGTGAAGCTGGG + Intronic
1163547824 19:17950015-17950037 CTGTCCCTTTATTTGGAGCTAGG + Intergenic
1163882400 19:19937165-19937187 CTGATCACTCATCTGGAGCAGGG - Intergenic
1164599266 19:29549827-29549849 CTCCTCCTTCAGCTGGGGCATGG + Intronic
1165015705 19:32878524-32878546 CAGCTCCTAGATCTGCAGCTGGG - Intergenic
1165365159 19:35360735-35360757 CCACTCCTTCATCTGAAACTGGG - Intergenic
1165366977 19:35373203-35373225 CCACTCCTTCATCTGAAACTGGG - Intergenic
1166120477 19:40683368-40683390 CAGCTCCCTCATCTGCAGGTGGG + Intronic
1166215537 19:41332145-41332167 CTGCCCCTACATTTGGAGCCTGG - Exonic
1167571571 19:50292256-50292278 TAGCTCCTTCATCTGGGCCTGGG - Exonic
925724815 2:6862683-6862705 CCGCTCCTTCACATGGAGCCAGG + Intronic
926006271 2:9375718-9375740 CTTCTCCTCCACCTGGAGATGGG - Intronic
926370110 2:12170878-12170900 CTGTTCCTACATCTAGAGCTTGG + Intergenic
927680674 2:25137093-25137115 CTGCTCCTACACCTGGATTTGGG + Intronic
927976610 2:27343248-27343270 CTGCTCTTTCATCTTAAGCTTGG + Intronic
929491484 2:42400433-42400455 CTGTTCCTACATCTGGACCTTGG + Intronic
930324371 2:49896450-49896472 CTTCTCCTTCATCTTTAGCTTGG - Intergenic
931690579 2:64831679-64831701 CTGCTCCTCCTTCTGGGGCCAGG - Intergenic
932825401 2:74934425-74934447 CTCCTCCTTCATCTGGGGTGAGG + Intergenic
933918121 2:87017078-87017100 CTGTTCTTTCTTCTGGATCTGGG + Intronic
934004873 2:87752836-87752858 CTGTTCTTTCTTCTGGATCTGGG - Intronic
934330399 2:92060702-92060724 CTGCCCCCTTATCTGGATCTAGG + Intergenic
935767832 2:106386867-106386889 CTGTTCTTTCTTCTGGATCTGGG - Intergenic
935883904 2:107594999-107595021 AGGCTCATTCATCTGGATCTAGG + Intergenic
935990190 2:108712464-108712486 CTGCTCCTTGTTCTGCAGCTTGG + Intergenic
938068787 2:128296121-128296143 TGGCTCCTTCATCTGGGACTTGG + Intronic
938070112 2:128303971-128303993 CTCCTCTCTCTTCTGGAGCTGGG + Intronic
938991411 2:136633625-136633647 CAGTTCCTTCATCTGGAAATAGG + Intergenic
941372773 2:164687483-164687505 ATGCTCCTTGTTCTGCAGCTTGG + Intronic
942319045 2:174719858-174719880 CTTCTCCTTCGGCTGGAGCTCGG - Intergenic
942612126 2:177753421-177753443 TTTCTCCTTCATGTGGACCTGGG - Intronic
944128395 2:196319236-196319258 CTTCACCTTCCTCTGGGGCTGGG + Exonic
944729931 2:202505632-202505654 CTCCTCCTTTGGCTGGAGCTTGG + Intronic
945837176 2:214847219-214847241 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
947274796 2:228378350-228378372 CTGCATTGTCATCTGGAGCTTGG - Intergenic
947362539 2:229360923-229360945 CTGCTCTCTCTTCTGGTGCTGGG - Intronic
947412763 2:229858933-229858955 CTGCTACTTCTTCTGGGGCTGGG + Exonic
1169062388 20:2670811-2670833 ATGATCCTTCATCTAGGGCTGGG + Intergenic
1169341300 20:4798373-4798395 CTGCTCATTCAGCTTGAGTTTGG - Intronic
1173325314 20:42027499-42027521 CAGCTCCTTCATCTGGTAGTTGG - Intergenic
1174308293 20:49630894-49630916 CTGCCCCTTGTTCTGGAGCACGG - Intergenic
1175787173 20:61718976-61718998 GTGCTCTTTCATCTGGTGCAGGG - Exonic
1177941741 21:27420584-27420606 ATGCTCCTTGTTCTGCAGCTTGG + Intergenic
1178465222 21:32841699-32841721 ATGCTCCTTGTTCTGCAGCTTGG + Intergenic
1179992640 21:44956572-44956594 GTGCTGCTTCATCTCGGGCTCGG - Intronic
1180524868 22:16248054-16248076 CTGCTCCCTTGTCTGGATCTAGG - Intergenic
1183469021 22:37996093-37996115 CTCTTCCTTCTTCTGGAGCAGGG + Intronic
1183959425 22:41402390-41402412 CAGCTCTGTCATCAGGAGCTAGG + Intergenic
1184341744 22:43889974-43889996 CAGCTCCCTCATCTGGACGTGGG - Intronic
1184746962 22:46461786-46461808 CGGCTTCTTCATCTGAAGCAGGG + Intronic
1184901322 22:47448283-47448305 CTCCTCCTGCACCTGGGGCTCGG + Intergenic
1185241226 22:49748770-49748792 TTCCTCCTTCCTCTGGGGCTGGG - Intergenic
1203323489 22_KI270737v1_random:92793-92815 CTGCCCCTTTGTCTGGATCTAGG + Intergenic
949221167 3:1635798-1635820 CTCCTCCCTCATCTGAAGCTTGG - Intergenic
950193422 3:10993074-10993096 CTGCTCCTTCATGTGGCTCAGGG - Intronic
950658353 3:14451314-14451336 ATGCTCCTCCATCTGCAGATGGG - Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
951797586 3:26557971-26557993 CTGTTCATTCACCTGCAGCTTGG - Intergenic
951822865 3:26832997-26833019 CTGCATTTTCATCTGGAGTTCGG - Intergenic
952214946 3:31268959-31268981 CTTCTCCTTCCTCTGCAACTTGG - Intergenic
953042824 3:39269863-39269885 CTGCTCTTTCCTCTGTAGCATGG - Intronic
953759425 3:45674908-45674930 GTGCTCCTTCATCTTGGGTTGGG - Intronic
953978296 3:47399215-47399237 CTGCTCCTGGAACTGGTGCTGGG + Intronic
954038639 3:47867685-47867707 CTGCTCCCTCCTCAAGAGCTGGG + Intronic
954392967 3:50276961-50276983 CTGGTCGTTGCTCTGGAGCTCGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954685985 3:52370542-52370564 CTTCTCCCTGATCTGGAGCGTGG + Exonic
956199264 3:66689570-66689592 TTGCTCCTTCCTCTGCAGTTTGG + Intergenic
956727326 3:72167186-72167208 CTGTGCCTTCATCTGCAGATTGG - Intergenic
960514101 3:118583890-118583912 TTTCTCCTTCACCTGGAACTAGG + Intergenic
960620881 3:119635720-119635742 ATGCTCCTTGTTCTGCAGCTTGG + Intergenic
960941777 3:122939663-122939685 TTGCTTCTTCATCTGTAACTTGG - Intronic
961123903 3:124398780-124398802 CAGCTCCTCCATCTGCACCTGGG - Exonic
961332378 3:126150211-126150233 CTGCTCCTTCCTCTGCAACTGGG - Intronic
962168472 3:133076005-133076027 CTCCTCCTTCTTTTGGACCTTGG - Intronic
962422096 3:135237876-135237898 CTGCTGCTGCATGAGGAGCTTGG - Intronic
963919499 3:150892208-150892230 CTGCTCCCTCATCTGAAGATGGG + Intronic
965712474 3:171569391-171569413 CTCCTACTTCATCTGGTGCAGGG + Intergenic
966533961 3:181010249-181010271 CTGCGCTCTCATCTGAAGCTTGG - Intergenic
967174983 3:186854570-186854592 GTGCTCCTGCATCTGGAGGTGGG + Exonic
967217310 3:187221272-187221294 CTGTTCCTTCACCTGTAGCATGG - Intronic
967979871 3:195059332-195059354 CTGCCCCCTCAGCTGGAGCTGGG - Intergenic
970604723 4:17668232-17668254 TTGCTTCTTTATCTGGTGCTGGG - Intronic
972562625 4:40242092-40242114 CTTTTCCTTCGTCTGGAGCTGGG + Intronic
972927657 4:44031367-44031389 CTGCATTCTCATCTGGAGCTTGG - Intergenic
974284777 4:59850102-59850124 CTGCCCATGGATCTGGAGCTAGG + Intergenic
974435176 4:61847356-61847378 CTGCTGCTTGATCTGTAACTTGG - Intronic
976077078 4:81312048-81312070 CTCTCCCTTCATCTGGAGCAGGG - Intergenic
976224539 4:82785131-82785153 CTACAGCATCATCTGGAGCTGGG - Intronic
977465615 4:97380495-97380517 CTGCTACTGCTTCTGAAGCTGGG - Intronic
977715486 4:100178152-100178174 CTGCTTCTTCTTCTGGAGATAGG - Intergenic
978781871 4:112564938-112564960 TTTCTCCTTCGGCTGGAGCTTGG - Intronic
979862279 4:125708161-125708183 CTGCTGCTTTTTCTGGAGATTGG + Intergenic
979920220 4:126487671-126487693 CTGCTTCTGCATCTGGTGGTGGG + Intergenic
980079998 4:128334099-128334121 CTGCTTCTTCATCTAAAGCATGG - Intergenic
980986343 4:139698582-139698604 CTTCTCCTTCGGCTGGAGCTCGG + Intronic
981636233 4:146883282-146883304 TTGCAACTACATCTGGAGCTTGG - Intronic
984717798 4:182942112-182942134 CTGATCCATCTGCTGGAGCTGGG + Intergenic
984811582 4:183799992-183800014 CTGCTCTTTTATCTGATGCTTGG - Intergenic
985787243 5:1903480-1903502 TTGCTCTTTCTTCTAGAGCTGGG - Intergenic
992648014 5:78830341-78830363 CTGGCCCTGCATCTGGAGTTAGG - Intronic
992830941 5:80592982-80593004 CTGCTTCCTCCTGTGGAGCTGGG + Intergenic
992945407 5:81804120-81804142 ATGCACCTGCATCTTGAGCTTGG + Intergenic
993881333 5:93365261-93365283 CTGCTGCTTCATCTGGCCCATGG + Intergenic
995105809 5:108377130-108377152 CTGCTCTTTAATCTGTATCTGGG + Intronic
998384709 5:141750118-141750140 CTTCTCTTTCTTCTGCAGCTGGG + Intergenic
1001074670 5:168616770-168616792 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
1001389356 5:171366390-171366412 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
1004288871 6:14348562-14348584 CTCCTTTTTCATCTGCAGCTGGG - Intergenic
1004767332 6:18745014-18745036 CTGCATTCTCATCTGGAGCTGGG - Intergenic
1005003401 6:21264862-21264884 TGGGTCCTTCATCTGGAGCCTGG - Intergenic
1005083478 6:21980716-21980738 CTTCTCCTTCATCTTGCACTGGG + Intergenic
1005083511 6:21980878-21980900 CTTCTCCTTCATCTTGCACTGGG + Intergenic
1005083535 6:21980991-21981013 CTTCTCCTTCATCTTGCACTGGG + Intergenic
1005488306 6:26322320-26322342 CTTCTCCTTTGGCTGGAGCTCGG + Intergenic
1005578476 6:27211659-27211681 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
1005937756 6:30536817-30536839 CTGATTCCACATCTGGAGCTGGG + Intergenic
1006300653 6:33192185-33192207 CTCCTCCTACCTCTGGTGCTGGG - Exonic
1006335453 6:33418197-33418219 CTCCTCCTTCATCAGGAGGTGGG - Exonic
1007749264 6:44062211-44062233 CTGCACCTTCACCTGGAGCAGGG + Intergenic
1007927431 6:45661889-45661911 CTGTTCCTTCATCTGGTGTCTGG - Intronic
1009968338 6:70601267-70601289 TTGCTGCCTCTTCTGGAGCTGGG + Intergenic
1011897814 6:92253784-92253806 CTGCAACTTCATCTGGAGCTTGG + Intergenic
1014747116 6:125213574-125213596 GTGCTCCTGCATCAGGGGCTGGG - Intronic
1017951245 6:159137039-159137061 CTCCTCCTTCATGCGGTGCTGGG + Intergenic
1018128667 6:160707008-160707030 CTGTTCTTTCTTCTGGATCTGGG - Intronic
1018136541 6:160783691-160783713 CTGTTCTTTCCTCTGGATCTGGG - Intergenic
1018694049 6:166376434-166376456 TTGCTCTCTCTTCTGGAGCTTGG - Intronic
1019884601 7:3892981-3893003 ATGCTCCTTCTACTGCAGCTCGG - Intronic
1021051626 7:15992462-15992484 CTGCTAATTCATCTGGTCCTGGG + Intergenic
1021119162 7:16778490-16778512 CTGCAGCCTCATCTGAAGCTTGG + Intronic
1022092360 7:27115823-27115845 CTGGACCTTCATCTTGAGGTCGG - Intronic
1022831114 7:34067669-34067691 CTGCTCCAGCATCTGGAGTCGGG + Intronic
1024063038 7:45713223-45713245 CTGTTCTAGCATCTGGAGCTGGG + Intronic
1024712703 7:52035182-52035204 TTGCTCCTTCTTCTTGACCTGGG + Intergenic
1025488698 7:61084155-61084177 CTGCCCCTTTGTCTGGATCTAGG + Intergenic
1026482386 7:70790149-70790171 CTCCTCCTTCACCTTGACCTCGG - Exonic
1026827078 7:73591163-73591185 CTGATCCTTCAGATGGGGCTGGG - Intergenic
1027435892 7:78164024-78164046 CTGCTCCTTCAACTGGGTATGGG + Intronic
1028848679 7:95512058-95512080 CTTCCCCTTCATCAGGGGCTGGG - Intronic
1029058594 7:97773238-97773260 CTGCACTTGCACCTGGAGCTCGG + Intergenic
1029291671 7:99506286-99506308 CTGCTCCTTCGTGTGCAGCTCGG - Exonic
1029356671 7:100057233-100057255 CTGCTCCTTGGTGTGGATCTCGG - Exonic
1031766267 7:125781501-125781523 CTGCTCCTCTGTCAGGAGCTTGG + Intergenic
1033581380 7:142740285-142740307 CTGCTCCTTCTCCTGGGACTAGG + Intergenic
1033620948 7:143061633-143061655 CTGGTCCTTCTTCTGGAACTTGG + Intergenic
1034044409 7:147912740-147912762 CTTCTTCTTCCTCTGGGGCTTGG - Intronic
1034523554 7:151639581-151639603 TTGCTCTTTCTCCTGGAGCTGGG + Intronic
1034904060 7:154928699-154928721 CTGCCACTTCATCAGTAGCTGGG - Exonic
1036044849 8:5128120-5128142 ATGCTCCTTGTTCTGCAGCTTGG + Intergenic
1036462030 8:8961838-8961860 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
1037424836 8:18744270-18744292 CAGCTTCCTCATCTGGAACTTGG - Intronic
1037933560 8:22899093-22899115 CTGCTTCTTCATCTGGAAAATGG + Intronic
1038209486 8:25502617-25502639 CTGTTTCTTCATCCGGACCTGGG + Intronic
1038727393 8:30094117-30094139 CTGCTCCTATCTCTGGAGGTGGG + Intergenic
1039056357 8:33540273-33540295 ATGCTCCTTGTTCTGCAGCTTGG - Intergenic
1039740874 8:40381374-40381396 ATGAACCTTCATCTGGGGCTAGG - Intergenic
1040543946 8:48382302-48382324 CTGCTCCTCCCTCTGCAGCTGGG + Intergenic
1040782865 8:51131080-51131102 CTGAGCCTGCATCTGGTGCTGGG - Intergenic
1041269318 8:56095225-56095247 CTGCTCTTTTAACTTGAGCTAGG - Intergenic
1041990750 8:63988271-63988293 CTTCTACTACATCTGGGGCTCGG + Intergenic
1046738008 8:117797965-117797987 CTACTCCTTGTTCTGCAGCTAGG + Exonic
1049606589 8:143532496-143532518 CTGCTCCTTCATTTGGCTGTTGG - Intronic
1049813128 8:144585216-144585238 CTGCCATTGCATCTGGAGCTGGG - Intronic
1055775442 9:79762575-79762597 CTCCTCCTTTATCTGGGACTCGG - Intergenic
1056048413 9:82743116-82743138 CTTCTCTTTCTTCTTGAGCTGGG - Intergenic
1056382617 9:86068670-86068692 TTGCTCCTGCATCTGCAGTTTGG - Intronic
1056810508 9:89760282-89760304 CTGCTGGGTCATCTGGAGTTGGG + Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1057397274 9:94691296-94691318 CTGCTCCTGCCTCTGCAGCATGG + Intergenic
1057592806 9:96388309-96388331 CTGCTCCTGCAGCCGGCGCTGGG + Exonic
1057733117 9:97629117-97629139 CTGCTCCCTCTTGTGGAGTTTGG - Intronic
1057904788 9:98975162-98975184 GCGCTCCTTCACCTGGAGCGAGG + Intronic
1058450445 9:105091430-105091452 CTGAACCTTGATCTGGAGCCCGG - Intergenic
1058937573 9:109783121-109783143 CAGCTCCTTCATCTGTAGAATGG + Intronic
1059259134 9:112959139-112959161 CTGCTCCCTCATCTCGGGCCTGG + Intergenic
1059404505 9:114091742-114091764 CTGCTACTCCACCTGCAGCTGGG - Exonic
1059743801 9:117180906-117180928 ATGCTCCTTGTTCTGCAGCTTGG + Intronic
1059768242 9:117403857-117403879 CTGCTCATTCTCTTGGAGCTGGG - Intronic
1060414855 9:123423115-123423137 CGGCTCTAGCATCTGGAGCTTGG - Intronic
1060929492 9:127479822-127479844 CTGCTCCTGCAGCCGGAGGTAGG - Exonic
1060939187 9:127534011-127534033 CTCCTCCTTCATCTGAACATGGG - Intronic
1060951544 9:127607008-127607030 CTGCTCCTTCTTCTTGCCCTTGG + Intergenic
1061379243 9:130244171-130244193 CTGTTTCCTCATCTGGAACTGGG - Intergenic
1061768491 9:132898797-132898819 TTGCTCCTGAACCTGGAGCTAGG - Intronic
1062364169 9:136201153-136201175 CTTCACCATCACCTGGAGCTGGG + Intronic
1203489549 Un_GL000224v1:90443-90465 CTGCAACTTGATCAGGAGCTAGG - Intergenic
1203502170 Un_KI270741v1:32331-32353 CTGCAACTTGATCAGGAGCTAGG - Intergenic
1185641917 X:1593051-1593073 CTGCCCCTTCCCGTGGAGCTAGG + Intronic
1187499145 X:19824402-19824424 CTGCTGCTTGATCTAAAGCTTGG - Intronic
1187677727 X:21734491-21734513 CTGCCTCTTCATCTGGTTCTTGG + Intronic
1188314776 X:28659498-28659520 CTTCTCCTTCGGCTGGAGCTCGG + Intronic
1189714923 X:43855521-43855543 CTGCTTCTTCATCTGTCACTGGG + Intronic
1190009212 X:46768851-46768873 AGCCTCCTTCATCTGGATCTGGG + Intergenic
1195206314 X:102602834-102602856 CCCCTCCTTCAACTGGAACTAGG - Exonic
1196754263 X:119144111-119144133 TTGCTCCTTCATTAGGAGCCTGG + Intronic
1197179032 X:123514420-123514442 CTTCTCCTTCGGCTGGAGCTCGG - Intergenic
1197595935 X:128464279-128464301 CTGTTTCTTCATCTGGAAATTGG + Intergenic
1197801758 X:130356942-130356964 CTCCAGCTTCATCTGGAGATGGG - Intronic
1198458268 X:136838543-136838565 TTGCTCTTTCTTCTGGAGCCAGG - Intergenic
1198792769 X:140363485-140363507 CTGCATTCTCATCTGGAGCTTGG - Intergenic
1199144821 X:144352181-144352203 CTGCTCTTTCCTCAGGAGCCAGG - Intergenic
1200222898 X:154400553-154400575 ATGCTCCTTGTTCTGCAGCTTGG - Exonic
1202115537 Y:21466896-21466918 CAGGTCCTTCACTTGGAGCTGGG - Intergenic