ID: 1113440504

View in Genome Browser
Species Human (GRCh38)
Location 13:110324568-110324590
Sequence GAGTCAAACGTGCATCCGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113440504_1113440512 12 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440512 13:110324603-110324625 TCAGGCAGGTCTGGGGCTCCTGG 0: 1
1: 1
2: 20
3: 541
4: 7623
1113440504_1113440506 -6 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440506 13:110324585-110324607 TGACTCAGCCGATTTGGATCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1113440504_1113440513 13 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440513 13:110324604-110324626 CAGGCAGGTCTGGGGCTCCTGGG 0: 1
1: 1
2: 103
3: 1977
4: 17609
1113440504_1113440510 4 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440510 13:110324595-110324617 GATTTGGATCAGGCAGGTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 285
1113440504_1113440509 3 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440509 13:110324594-110324616 CGATTTGGATCAGGCAGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 188
1113440504_1113440507 -2 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440507 13:110324589-110324611 TCAGCCGATTTGGATCAGGCAGG 0: 1
1: 0
2: 0
3: 0
4: 41
1113440504_1113440511 5 Left 1113440504 13:110324568-110324590 CCGAACGGATGCACGTTTGACTC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113440511 13:110324596-110324618 ATTTGGATCAGGCAGGTCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113440504 Original CRISPR GAGTCAAACGTGCATCCGTT CGG (reversed) Intronic
908835241 1:68223212-68223234 GAGTAAAATGTGCATGCTTTAGG + Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
918292970 1:183127000-183127022 AAGTAAAACGTGCAACCTTTGGG - Intronic
1064505995 10:16030687-16030709 GAAGCAAAGGTGCATCTGTTGGG + Intergenic
1091855813 12:3738648-3738670 GAGTCTAACATACATCTGTTTGG + Intronic
1093916119 12:24804142-24804164 GAATCAAACCTGCATATGTTGGG + Intergenic
1113440504 13:110324568-110324590 GAGTCAAACGTGCATCCGTTCGG - Intronic
1129605310 15:77022038-77022060 GATTCAAACTTGCACCCCTTGGG - Intronic
1132544187 16:525755-525777 GAGTCACTCGTGCCTCCGTGAGG - Intergenic
1146884831 17:36464029-36464051 GAGGCAGACGTGCATCCGGGCGG + Intergenic
1150033241 17:61764171-61764193 GTGTCAATTGTGCATCTGTTGGG + Intronic
1155361626 18:25008973-25008995 GAGTCAGACCTGCATTTGTTTGG + Intergenic
925309436 2:2872042-2872064 GAGTCAGTCGGGCATCAGTTTGG + Intergenic
925872437 2:8282788-8282810 CAGTTAAACATGCATCTGTTTGG - Intergenic
925980966 2:9177141-9177163 GATTCCAACGTTCATCTGTTGGG + Intergenic
945150213 2:206783078-206783100 GAGTCAAATGCCCATCCCTTAGG + Intronic
945581300 2:211598477-211598499 GAGTAAAACTTACATCTGTTTGG + Intronic
952570356 3:34708675-34708697 GAGTCAAATGTGGATCAGTGGGG - Intergenic
953242681 3:41163539-41163561 GAGTCATACGTGCATGCAGTAGG + Intergenic
956457034 3:69431837-69431859 GAGTAAAATGTGCAACAGTTAGG - Intronic
980978420 4:139633284-139633306 CAGTGAAACGTTCATCCGTCCGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007250218 6:40490181-40490203 GAGGCAAACGTGGATTAGTTGGG - Intronic
1015983567 6:138863514-138863536 GAGCCAAATGTGCTACCGTTTGG - Intronic
1019857988 7:3628491-3628513 GAGTCAAACATGCATCCATAAGG - Intronic
1020932120 7:14410904-14410926 AAGTCAAACGAGCATAGGTTGGG - Intronic
1032281734 7:130508673-130508695 GAGGCAAACCTGCATCAGTGGGG + Intronic
1038662029 8:29505864-29505886 GAGTCAATGGTGCATCCTCTTGG - Intergenic
1042951802 8:74207647-74207669 GAGTGATACGTGCAACCCTTGGG + Intergenic
1049428578 8:142548924-142548946 GAGTCGAACCTGCATGCCTTAGG + Intergenic
1053330562 9:37202807-37202829 GAGACAAACGTGGATCCATATGG - Intronic
1201728431 Y:17180611-17180633 GGGGCAAACTTGCCTCCGTTTGG + Intergenic