ID: 1113440581

View in Genome Browser
Species Human (GRCh38)
Location 13:110325036-110325058
Sequence CTTCACATGCACAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113440577_1113440581 -2 Left 1113440577 13:110325015-110325037 CCTTAGCATGGCAAAAGCAGCCT 0: 1
1: 0
2: 0
3: 19
4: 169
Right 1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 180
1113440576_1113440581 -1 Left 1113440576 13:110325014-110325036 CCCTTAGCATGGCAAAAGCAGCC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 180
1113440574_1113440581 16 Left 1113440574 13:110324997-110325019 CCTGAGAGCACGTTCGACCCTTA 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG 0: 1
1: 0
2: 1
3: 25
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113440581 Original CRISPR CTTCACATGCACAAGGAGGA TGG Intronic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902637605 1:17744844-17744866 CAGCACATGCTCAAGGAGGCAGG - Intergenic
902995534 1:20222096-20222118 CTTCACATACAAAAGAAGGAAGG + Intergenic
905220273 1:36441361-36441383 CACCACAGGCACAAAGAGGAAGG + Intronic
905929378 1:41776529-41776551 CTTCACCTGCATAAGGACAAAGG - Intronic
907268852 1:53278689-53278711 CTGCACATGCACAAGTTGGGTGG - Intronic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
908151560 1:61307689-61307711 CTTCCCCAGCACAAGGAGGTTGG + Intronic
909889789 1:80990453-80990475 CTTCCCATGCACAGTGAGGGAGG - Intergenic
911883846 1:103272521-103272543 CATCACATGAAAAAGGAGAAAGG - Intergenic
912052564 1:105548455-105548477 CTTTACATTCACAAGGTGCATGG + Intergenic
912326422 1:108767622-108767644 CTGCACATGCGCAAGGTGGGCGG + Intronic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
916425270 1:164674268-164674290 TTACACATGGACAAAGAGGAAGG + Intronic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
922760535 1:228127274-228127296 CTGCACCTGCACCAAGAGGATGG + Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1063427617 10:5962205-5962227 AGTCACCTGCACAGGGAGGAAGG - Intronic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1066463667 10:35634490-35634512 CTGCCCATGAACAAGGAGCAGGG - Intergenic
1068715062 10:60178904-60178926 CTTCAAATGCAAAAGGGGGGTGG + Intronic
1069058629 10:63870739-63870761 ATTCTCATGAAGAAGGAGGATGG - Intergenic
1072569573 10:96646783-96646805 CTTCACAATCACATGGAGGCAGG - Intronic
1073213313 10:101822037-101822059 CTTCAGATGGACAAATAGGAAGG + Intergenic
1077950883 11:6955419-6955441 CTTTACATGAACAAGGATGCGGG - Intronic
1078841055 11:15075811-15075833 CTCAACATGCACAAGGATGTGGG - Intronic
1080195747 11:29606712-29606734 CTACCCAGGCACAAGGAGGAGGG - Intergenic
1080424979 11:32146966-32146988 CTTCAGGTGAACCAGGAGGAAGG + Intergenic
1081480130 11:43478499-43478521 CTTCACATTAACATGGATGAGGG + Intronic
1086916036 11:92531303-92531325 CTCCACATGAACAAGGACAAAGG + Intronic
1090870473 11:130741549-130741571 CTTAATATGCTCAAGAAGGAGGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091765398 12:3117033-3117055 CTTCACCTTTACAAGCAGGATGG + Intronic
1092797939 12:12132058-12132080 CTTCAAATGAACAAGGAGAAGGG + Intronic
1093790660 12:23245652-23245674 TTTCACATGCTCACAGAGGAAGG + Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096507278 12:52102172-52102194 CTCCACATGCAGAAGAATGAAGG + Intergenic
1097753857 12:63387490-63387512 CTTCTCAGGCAAAAAGAGGAGGG + Intergenic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099627929 12:85099657-85099679 CATCAAAGGCACAAGGAGTAGGG + Intronic
1100046487 12:90387519-90387541 TATCACATGGCCAAGGAGGAAGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1105370903 13:19801107-19801129 CTTCATATGCACAAGGCAGAAGG - Intergenic
1106110175 13:26770353-26770375 CTTCACTTGCACAGGGAGACAGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1111986164 13:95068977-95068999 CTTCACACTCACAAGGATGCTGG + Intronic
1112788107 13:102973846-102973868 TCTAACATGCACAAGGAAGAAGG - Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1120027246 14:79600396-79600418 CTTCAGATGCACAAGGTTCAAGG + Intronic
1121664891 14:95665004-95665026 CTCCAAATGCACCAAGAGGATGG + Intergenic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1126644718 15:50863504-50863526 TTTCCCATGCACAAGCAAGAAGG + Intergenic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1130714155 15:86315101-86315123 CTTGCAATGAACAAGGAGGATGG - Intronic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132329385 15:101001136-101001158 CTTTACATGCACAAGGATGCTGG + Intronic
1133346753 16:5076213-5076235 CTGGACATGCACACGGAGGCTGG - Intronic
1133396786 16:5453843-5453865 GTTCTCATGCAGAAGGAGAAAGG + Intergenic
1133713256 16:8421946-8421968 TTACAAATGCTCAAGGAGGAAGG - Intergenic
1134818866 16:17229315-17229337 GGTCACATGCACAAGGAGGATGG - Intronic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1141010093 16:80388971-80388993 CTTCAGATGCTAAAGGGGGAGGG + Intergenic
1142009802 16:87708073-87708095 CTTCTGATACGCAAGGAGGAAGG + Exonic
1142262487 16:89049513-89049535 CCTCACAGGCCCAGGGAGGAGGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143863587 17:9908383-9908405 CTCTCCAGGCACAAGGAGGAAGG + Intergenic
1144732024 17:17533274-17533296 ATTCACATGCAAAAGAATGAAGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1148031817 17:44627323-44627345 CTTCACTTGCTGAGGGAGGAAGG + Intergenic
1151618227 17:75228741-75228763 CTTCATATGAACATGGAGAAGGG + Intronic
1152784846 17:82242234-82242256 CTGCACAGGCACAAGGAGATAGG - Intronic
1155073527 18:22336277-22336299 CTTCAGGTGCAAAGGGAGGAGGG + Intergenic
1156171503 18:34492339-34492361 CTTCACATACACCAGGTGAAAGG + Intergenic
1158951756 18:62501619-62501641 ATTCACATGCAAAAGAATGAAGG + Intergenic
1159295243 18:66477855-66477877 CTTCACATGCAAAAGAATGAGGG + Intergenic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1160232992 18:77062666-77062688 CTTCACAGAGACGAGGAGGAAGG + Intronic
1160764673 19:802177-802199 CGGCACCTGCTCAAGGAGGATGG - Intronic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163825431 19:19521222-19521244 CTTCACATGCGCTAGGATGGTGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925721967 2:6838280-6838302 CATCACATGTACAAGGAGGCAGG + Intergenic
926355778 2:12039347-12039369 TTTCACAGGCACACGTAGGAGGG + Intergenic
926893232 2:17657156-17657178 CTCAACATGCACAAGGGTGAAGG - Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
932652665 2:73576018-73576040 ATTCACATGCAGAAGAATGAAGG - Intronic
933766625 2:85713550-85713572 ATACACATGCACAAGCAAGAAGG + Intergenic
934024744 2:87992233-87992255 CTCCACAGGCACAGGCAGGAAGG - Intergenic
936625826 2:114148490-114148512 CTTCACATGAACAAGTGAGAAGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
940612457 2:156007406-156007428 CTGCACTTGCACATGGAGGGTGG - Intergenic
940870625 2:158857185-158857207 TTCCACATGCAGAAGAAGGAAGG + Intronic
940887346 2:159001154-159001176 CTTCACATGCACCAGGAAAAGGG - Exonic
941672265 2:168307706-168307728 CATCACCTTCACAAGAAGGAAGG - Intergenic
942339122 2:174924473-174924495 TTTCACATGCACATGGAGAGGGG - Intronic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
944162311 2:196677276-196677298 ATTAACCTGCCCAAGGAGGATGG - Exonic
944227339 2:197360780-197360802 CTTCTCATGCACAAGGAGCCAGG + Intergenic
945332969 2:208560848-208560870 TTTCACATGAACATGGAAGAGGG - Intronic
946594551 2:221291934-221291956 CTTCCCATACATAATGAGGATGG - Intergenic
946855403 2:223945172-223945194 CTGCTCATCCCCAAGGAGGACGG - Exonic
948004036 2:234592525-234592547 ATACACGTGCACAAGGTGGAGGG + Intergenic
1169586214 20:7088704-7088726 CTTCACATGCAAAAGAATTAAGG + Intergenic
1170425463 20:16231012-16231034 ATTCACATGCCCTAGAAGGAGGG - Intergenic
1171458329 20:25284168-25284190 CTTCACATGCACATCGAACATGG - Exonic
1172652350 20:36512814-36512836 CTTGACATGCGCAAGGCTGAGGG + Intronic
1174333334 20:49838683-49838705 CTTCACTTTCCCATGGAGGAAGG - Intronic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177860003 21:26441183-26441205 ACACACATGCACTAGGAGGATGG - Intergenic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1182488541 22:30654423-30654445 CTTCAGATGCACAACCTGGAGGG + Intronic
1182821477 22:33220526-33220548 CTTCAAATGAAAAAGGAGGGAGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949612594 3:5717994-5718016 CTACACAGGCAAAGGGAGGAGGG + Intergenic
951469215 3:23037330-23037352 CATCACATACACAAGGTTGATGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954855607 3:53641405-53641427 GTTCATATCCTCAAGGAGGATGG - Intronic
955317680 3:57952396-57952418 CTACAGATACACAAGGAAGATGG - Intergenic
957056472 3:75446850-75446872 CTCCACATCTACAAGAAGGAGGG - Intergenic
960390770 3:117075233-117075255 AGTCACAGTCACAAGGAGGAGGG + Intronic
960498879 3:118410911-118410933 ATTCACATGCAAAAGAATGAGGG - Intergenic
960993545 3:123326689-123326711 CTCCACAGGCACCAGGAAGAGGG - Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
961148849 3:124618832-124618854 CATCACAAGCACAACAAGGAGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964373658 3:156028425-156028447 CTTCTCATCCACATGGATGATGG - Intergenic
965916790 3:173858163-173858185 CTTCACATGCACAGTGAGTCTGG + Intronic
968438847 4:611297-611319 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438857 4:611365-611387 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438869 4:611433-611455 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438881 4:611501-611523 CTTCACCTGCACACAGAGGCTGG + Intergenic
971810325 4:31416917-31416939 CTTCACATTCTCAAGGATGAAGG - Intergenic
972110323 4:35550060-35550082 CTTCACCCTCACAAGGTGGAAGG + Intergenic
973865338 4:55107389-55107411 CTTCACACACACAAGAAGGAGGG + Intronic
975321064 4:73011124-73011146 CTGCACCTGCACAAGGAACATGG + Intergenic
978712570 4:111802696-111802718 CTTCACATTCACAGGGCGGCAGG + Intergenic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
982657156 4:158164041-158164063 CTTCCCAAGCTCAAGGAGGTGGG - Intronic
985987243 5:3526192-3526214 CTTCTCTTGAACATGGAGGAGGG + Intergenic
993134662 5:83943973-83943995 CTCCACATTCACAAGGGGCAAGG + Intronic
993525696 5:88963228-88963250 TTTCACATGCAAAAAGAGTATGG + Intergenic
996399536 5:123046549-123046571 CTTCAGATGCCCAGGGAGGGAGG - Intergenic
997328529 5:133042340-133042362 AGTCACATGCACAAGAAGGAAGG - Intergenic
998642342 5:144025273-144025295 TTGCACATGCACAGGGATGAGGG + Intergenic
999230210 5:150057366-150057388 CTAGACCTGGACAAGGAGGATGG - Exonic
1001673407 5:173492754-173492776 GTTCACATGCACACAGAGGAAGG - Intergenic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1011888357 6:92126116-92126138 CAGCAAATGCACAAGGAGAAGGG - Intergenic
1013653743 6:112224117-112224139 TTTCACATCCACAGGGATGAGGG + Intronic
1017048141 6:150366199-150366221 CTGCACATGCTCATGGAGGCAGG - Intergenic
1017360767 6:153566867-153566889 CTTCACAAAAACAAAGAGGAGGG + Intergenic
1017868276 6:158463991-158464013 CTTCTCATGGACTGGGAGGAGGG - Intronic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018359595 6:163054298-163054320 CTCCGCATGCACACAGAGGAAGG + Intronic
1022039350 7:26565417-26565439 CTTGACCTGCACACTGAGGATGG + Intergenic
1023572402 7:41585774-41585796 CTCTACTTGCTCAAGGAGGATGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1026396307 7:69957932-69957954 CTACACTTGCAGAAGGATGAAGG - Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1030865565 7:114698414-114698436 CCTCACGTGCACAAGAATGAGGG - Intergenic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1032360781 7:131252798-131252820 CTTGGCATGCACAAGGGGGATGG + Intronic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1037635902 8:20700881-20700903 CTTCCCAGCCACATGGAGGATGG - Intergenic
1042711335 8:71720637-71720659 CTTCAAATGCCCAAAGAGAAGGG - Intergenic
1042847992 8:73187376-73187398 CCTCGCGTGTACAAGGAGGAAGG - Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049632649 8:143666925-143666947 ATGTACATGCACACGGAGGAGGG - Intergenic
1049719351 8:144108457-144108479 CTGCACCTGCACAAGGAAGACGG + Exonic
1049864025 8:144921921-144921943 ATACACATGAGCAAGGAGGAAGG - Intergenic
1050313087 9:4372912-4372934 CTTCTCAGGAACAAGGAGAACGG + Intergenic
1050356317 9:4786303-4786325 CCTCACATGATCATGGAGGAAGG - Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051027204 9:12626931-12626953 TTGCACATGCAAAAGGAAGAAGG - Intergenic
1055689975 9:78819535-78819557 CTTCACATCCACGGAGAGGAAGG + Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056526101 9:87444361-87444383 TTTTTCATGCACATGGAGGAGGG - Intergenic
1057024581 9:91725394-91725416 CCACACATGCACAAGTGGGAAGG - Intronic
1058035904 9:100252531-100252553 CTGCACAAGTACAAGGATGAAGG + Intronic
1061183047 9:129036453-129036475 CTTCAACCGCACTAGGAGGAGGG + Intergenic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1061730777 9:132612164-132612186 CGCCACATGCCCAAGGTGGAGGG + Exonic
1186267346 X:7846319-7846341 CTTCTCAGGCAAAAGGAGAAAGG + Intergenic
1186376542 X:9009024-9009046 CTTCTCAGGCAAAAGGAGAAAGG + Intergenic
1186809020 X:13168719-13168741 CTTCACATGTACAGAGAAGAAGG + Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1187670824 X:21664594-21664616 CTTCACATGCACAGGCAAGGTGG - Intergenic
1191638518 X:63404344-63404366 CTGCATATGCACTGGGAGGATGG - Intergenic
1194418463 X:93642548-93642570 CTTTACATTCACTAGGATGACGG + Intergenic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200163563 X:154021006-154021028 CTTCACATGCACATGCTAGAAGG - Intergenic
1201380555 Y:13372887-13372909 CTTCACAATCACCAGGATGAAGG + Intronic
1201577730 Y:15478619-15478641 CTTCACCTCCCCCAGGAGGAGGG - Intergenic