ID: 1113441725

View in Genome Browser
Species Human (GRCh38)
Location 13:110334288-110334310
Sequence CTGCTGTGCTTGATAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113441725_1113441730 28 Left 1113441725 13:110334288-110334310 CCTTTGTTTATCAAGCACAGCAG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1113441730 13:110334339-110334361 CACCACCACCATCTGCATGTTGG 0: 1
1: 0
2: 0
3: 26
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113441725 Original CRISPR CTGCTGTGCTTGATAAACAA AGG (reversed) Intronic
905177058 1:36143397-36143419 CTGGTGTGTTTGAGAAACAGCGG + Intronic
907965587 1:59325451-59325473 CTGCTGAGGTTGGTAAAAAAGGG - Intronic
908419952 1:63950046-63950068 CTGAGGTGCTTGTTAAACACAGG + Intronic
908497314 1:64707530-64707552 CTGCAGAGGTTAATAAACAAAGG + Intergenic
908824092 1:68116819-68116841 CTGCTGGCCAAGATAAACAATGG - Intronic
909889435 1:80985288-80985310 GTGCTGTGCTTGGGAAACAAAGG - Intergenic
910098201 1:83548310-83548332 CAACTGTGTTTGATAAAGAAGGG - Intergenic
910503234 1:87918705-87918727 CTGCTGTGCTTGAGACAGCATGG - Intergenic
911809658 1:102259678-102259700 CTTTTTTGCTTGATAAAGAAAGG - Intergenic
916567920 1:165997698-165997720 GCACTGTGCTTGATAAACAGTGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918010943 1:180585932-180585954 ATACTGTGCTTGTTTAACAAAGG + Intergenic
918563656 1:185899819-185899841 GTTCTGTGCTAGATACACAAAGG - Intronic
919797241 1:201328328-201328350 CTCCTGTGTTTGAGAAACAATGG + Intronic
921383277 1:214546266-214546288 CTGCAGGGCTTCTTAAACAAAGG - Intronic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
921650167 1:217668766-217668788 CTGCTGAGTTTGATAATCAATGG - Intronic
1063728351 10:8666010-8666032 GTGCTGTGCTTCATAATAAATGG - Intergenic
1064127583 10:12676995-12677017 CTGCTGAGCTTGAAAAGCTAAGG + Intronic
1064304327 10:14151822-14151844 CTGCTGCCCTTTAAAAACAAAGG - Intronic
1066100981 10:32118339-32118361 GAGCTATGCTTGGTAAACAAAGG + Intergenic
1066521042 10:36219560-36219582 CTGCTGTTCTTGAAACATAAGGG + Intergenic
1070321354 10:75357116-75357138 CTCCTGTGCTTAAAAAAAAAAGG - Intergenic
1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG + Intronic
1074316497 10:112366205-112366227 CAGCTGTGCTTCCTAAAGAAAGG + Intergenic
1074467049 10:113692522-113692544 CTGGTCTGCCTGAGAAACAAAGG + Intronic
1074976058 10:118582650-118582672 CTGCTGTCCTTGCTATGCAAAGG - Intergenic
1084278267 11:68067918-68067940 CTGCTGAGCCTGGCAAACAAGGG + Intronic
1084718239 11:70887620-70887642 CTTCTGTGTTTGGGAAACAAAGG + Intronic
1085660793 11:78364945-78364967 ATGCTATGCTTGAAATACAAGGG + Intronic
1087010981 11:93513833-93513855 CTGCTGTGCTTGGTTCAGAAAGG - Intronic
1087156392 11:94909084-94909106 CTGCTTTCATTAATAAACAATGG + Intergenic
1088315693 11:108504325-108504347 CTCCTGTCCTTGATAGAAAAAGG + Intergenic
1091969642 12:4775450-4775472 CTGCTGTCCTTTACAATCAAAGG - Intronic
1098544567 12:71697339-71697361 CTGCTGTACATGATAGAAAATGG + Exonic
1100005252 12:89887891-89887913 CTTCTGTACTTGAGAACCAAAGG + Intergenic
1101548904 12:105743183-105743205 CTGCTGTGCTCGATATAAAATGG - Intergenic
1101950369 12:109169874-109169896 CTTCTGTGTTTGATAAACATAGG + Intronic
1102193039 12:111003484-111003506 CTGTTGTACTTAATATACAATGG - Intergenic
1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG + Intronic
1105036291 12:132924780-132924802 CTGCTGTGATGGAATAACAAGGG - Exonic
1106802136 13:33267143-33267165 GTGCTGTCCTTGAAAAACCAGGG - Intronic
1106819280 13:33445169-33445191 CTGCTGCTCCTGAAAAACAAAGG + Intergenic
1110012507 13:70355509-70355531 GTGCTGAGCTTGAGAAACATTGG - Intergenic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1111619936 13:90712231-90712253 CTTCTTTGCTTAAAAAACAAGGG - Intergenic
1112806159 13:103165845-103165867 TGGCTGTGTTTGTTAAACAAAGG + Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1113500344 13:110768771-110768793 CTGTTCTGCATGATACACAATGG + Intergenic
1115404609 14:33000421-33000443 CTGATGTGCTGGATAAACCAGGG + Intronic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1117499556 14:56338494-56338516 CTGCAGAGCTTATTAAACAAAGG + Intergenic
1117678947 14:58183711-58183733 CTGGTCTTCTTTATAAACAAGGG + Intronic
1119884305 14:78127500-78127522 GTGCTGTGCTTGATCACAAAGGG + Intergenic
1120251957 14:82069139-82069161 CTGCTGTGGTTGCTAAAGTAGGG - Intergenic
1120277384 14:82394230-82394252 ATGCGGCTCTTGATAAACAATGG - Intergenic
1127475110 15:59325740-59325762 CTGCTGTGCTTGGTGAGCACAGG + Intronic
1129159812 15:73740943-73740965 CTGCTGTGTTTGAGAGACAGGGG - Intronic
1130398796 15:83529925-83529947 CTGCTGTGCTGCTGAAACAAGGG - Intronic
1131346384 15:91652899-91652921 CTGCTGTGCTTCAGAAAGAGAGG + Intergenic
1139270169 16:65674569-65674591 CTGCTGAGCCTGATAAATTAGGG - Intergenic
1141261552 16:82458951-82458973 CTTCTGTGGTTTATAACCAAGGG + Intergenic
1144350618 17:14392028-14392050 AAGCTGTACTTCATAAACAAGGG + Intergenic
1148350893 17:46941308-46941330 CTGATGTGCTTCCAAAACAATGG - Intronic
1149669822 17:58397224-58397246 TTGCTGTGTTTCATAAAAAATGG - Intronic
1153315170 18:3714334-3714356 TGGCTGTGTTTGAGAAACAATGG - Intronic
1154105450 18:11518862-11518884 CTGCTGTGCTTAATAGCGAAGGG + Intergenic
1156364588 18:36414189-36414211 CTCCTGTGCTTGATACATGACGG - Intronic
1161868169 19:6849880-6849902 CTGCTGTGATGAACAAACAAGGG + Intronic
1161913719 19:7213493-7213515 CTGTTTGGCTTGATAAATAAAGG - Intronic
1166143607 19:40819490-40819512 CTGCTGTGAATGGTAAACACAGG + Intronic
1166183944 19:41127289-41127311 CTGCTGTGAATGGTAAACACAGG - Intronic
927290809 2:21403117-21403139 CTGCTGAGCTTGCTAAGGAAAGG + Intergenic
927834139 2:26378348-26378370 ATGCTGTGCTTGAAAGACAGAGG - Intronic
929731510 2:44498684-44498706 CTGTTCTGTTTGCTAAACAAAGG + Intronic
930257151 2:49105472-49105494 CTTTTGTGCTTAAAAAACAAAGG + Intronic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
933289361 2:80420703-80420725 CTGCAGTGCTGGATTAACCAAGG - Intronic
933587769 2:84198609-84198631 CTGATGTACTTGATAAACCAAGG + Intergenic
937866386 2:126754408-126754430 CTGATGTGTTTGGCAAACAAGGG - Intergenic
940365041 2:152838866-152838888 CTGCAGTGCTTGAAAAACAGTGG + Intergenic
941175252 2:162190267-162190289 CTGTTGTACTTGATTAATAAAGG + Intronic
944627643 2:201588634-201588656 CTGATGTGCTTCAAAAACAATGG + Intronic
945882008 2:215334605-215334627 CTGCTGTAGATGATAAACTATGG - Intronic
946314451 2:218900568-218900590 ATGCTGTCCTTTATAACCAAAGG + Intergenic
1169030791 20:2405343-2405365 CTGCTGTGGTAGATTAAAAATGG - Intronic
1170306858 20:14947894-14947916 TTGTTGTACTTGATAAACACTGG - Intronic
1170388761 20:15849831-15849853 CATGTGTGCTGGATAAACAATGG + Intronic
1172774868 20:37401490-37401512 CTGCTGTGCTGGTTAAAGCAAGG + Intronic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1173793491 20:45842868-45842890 AAGCTTTGCTTGATAAACCAAGG - Intronic
1174241845 20:49142518-49142540 CTGCTGTGGTTGAGAACCACTGG - Intronic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1178609750 21:34070741-34070763 CTTCTGTGCTTGTTAAAAAAAGG + Intergenic
1179421041 21:41237035-41237057 ATGCTGTTCATGATAAAGAATGG + Intronic
1180410641 22:12603342-12603364 CTGGTCTCCGTGATAAACAAAGG + Intergenic
1180503387 22:15962087-15962109 TTGGTGTGCTTCATAACCAATGG + Intergenic
1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG + Intergenic
1203335187 22_KI270739v1_random:60425-60447 TTGGTGTGCTTCATAACCAATGG - Intergenic
953145226 3:40268832-40268854 ATGCTTTGCCTGATAAACACAGG + Intergenic
956813918 3:72890376-72890398 TTGTTGTGCATGAGAAACAATGG - Intronic
957515401 3:81244312-81244334 CTGCTCTTCTGGATAAATAAAGG - Intergenic
961058366 3:123807991-123808013 CAGCTGTGGATGAGAAACAATGG + Intronic
961695614 3:128702111-128702133 CTGCTTTGCTTTTTAAACATGGG + Intergenic
963593522 3:147295050-147295072 ATGTTCTGCTTGATAAATAATGG - Intergenic
964218321 3:154314377-154314399 CTGCTGTCTTTGATAAAGGAAGG - Intronic
964641508 3:158914278-158914300 TTTCTGTGGCTGATAAACAAGGG - Intergenic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
967946001 3:194804795-194804817 CTGCTCTGCTGGTCAAACAAAGG + Intergenic
970692830 4:18639679-18639701 CTGCTGTTCTTGGTATCCAAAGG + Intergenic
971020584 4:22531150-22531172 ATAGTGTTCTTGATAAACAAAGG - Intergenic
971592246 4:28482938-28482960 CCCATGTGCTTGATAAACAGGGG - Intergenic
972716201 4:41648733-41648755 CTGTTGTACTGGAAAAACAACGG - Intronic
977252650 4:94706031-94706053 CTACAGTGCTTAATAAATAAAGG - Intergenic
984218678 4:176946348-176946370 CTGTTGTGCCTGATTGACAATGG + Intergenic
984361283 4:178736413-178736435 CTGCTGTGCATGATAGTCAATGG + Intergenic
984757718 4:183339528-183339550 CTGCTGTGCTTGGAGAACAGAGG - Intergenic
984982755 4:185298962-185298984 CTGCTGTACCTAATACACAATGG - Intronic
986992193 5:13567523-13567545 CTGCTATTCTTGCTAAACAATGG + Intergenic
992135638 5:73741252-73741274 CTGCTGTGTTATAGAAACAAAGG + Intronic
993335814 5:86657230-86657252 CTGCTAAGCTTTATAAAAAATGG - Intergenic
994674701 5:102805629-102805651 TTGCTGTCCTTGAGAATCAAAGG + Intronic
997970630 5:138398622-138398644 CTGCTGTGCTACAAAAACAAAGG - Intronic
1000115183 5:158147506-158147528 CTGCTTAACTTAATAAACAAGGG - Intergenic
1000276232 5:159737565-159737587 CTGCTGAGCTTCATAGAGAAGGG + Intergenic
1000753133 5:165121985-165122007 CTGCTTTCCTTTAAAAACAAAGG - Intergenic
1001735435 5:173994688-173994710 CTGCTGTGCTTGCGAAGCCAAGG + Intronic
1003050924 6:2780747-2780769 CTGCTGCACTTCAGAAACAATGG - Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1004474417 6:15957963-15957985 CAGCTCTGCTTGATACACCAAGG + Intergenic
1010287331 6:74094330-74094352 CTTATGTGCCTGATAAAAAATGG - Intergenic
1011131526 6:84056797-84056819 CTTCTGTGCTTCTTAAACTAAGG - Intronic
1011720598 6:90152146-90152168 CTGCTGTCCATGACAAAGAAAGG + Intronic
1012575520 6:100792439-100792461 CTGAAGTGCTTGATATCCAAAGG + Intronic
1013228845 6:108142863-108142885 CTGCTCTGCTGGATAAAAGATGG + Intronic
1015608256 6:134984157-134984179 CTTGTATTCTTGATAAACAATGG + Intronic
1020448268 7:8292758-8292780 TTGCTGTGCTTGCTAAACGTAGG - Intergenic
1020725927 7:11814545-11814567 CTGCAGTGCTTGATCAACCAAGG + Intronic
1021894665 7:25222634-25222656 CTGCTCTGATTAATAAACATGGG + Intergenic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023452202 7:40298977-40298999 CTTTTGTGCTTGAATAACAATGG + Intronic
1028373682 7:90121847-90121869 CAGCAGGGCTTGATAAGCAAAGG - Intergenic
1029832658 7:103277836-103277858 CAGCAGGGCTTGATAAGCAAAGG + Intergenic
1031270536 7:119643876-119643898 ATGCTGTTCTTGATACTCAATGG + Intergenic
1032101662 7:128984251-128984273 GTGCTGTCCCTGAAAAACAAAGG + Exonic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1034850756 7:154491306-154491328 CTGCTGTGCGTTAGCAACAATGG + Intronic
1036012378 8:4741144-4741166 CTAGTGTGCTTGAAAAAGAAGGG - Intronic
1036162314 8:6400979-6401001 CTGAGGTGACTGATAAACAATGG + Intergenic
1038513542 8:28163072-28163094 CTGCTGTCCTAGATAAGGAATGG - Intronic
1042952024 8:74210333-74210355 GGGCTGTGCTAGAAAAACAAAGG + Intergenic
1043521653 8:81052824-81052846 CTGTTGTTCTTGGAAAACAAAGG + Intronic
1044442079 8:92234728-92234750 CTGATGTTCATGATACACAAAGG - Intergenic
1045039528 8:98208856-98208878 CTTGTGTGATTGATAAAAAATGG - Intronic
1048163240 8:132039705-132039727 CTGTTGTGGTTGAGAAATAAGGG - Intronic
1049843552 8:144788979-144789001 CTGCTGGGATTGCTGAACAAAGG - Intergenic
1049880463 8:145058623-145058645 CTGCTGAGCAGGATCAACAATGG - Intergenic
1050572461 9:6955398-6955420 CTGCACTGCATGAAAAACAAAGG - Intronic
1051595675 9:18822352-18822374 CTGCTGTGGTTGTAAAACCAAGG - Intronic
1052103397 9:24479880-24479902 CTGCTGTGCTGAGTAAACAGAGG - Intergenic
1054949034 9:70828397-70828419 CTGCTGTGCCTGTTAAAGTATGG - Intronic
1203449435 Un_GL000219v1:98675-98697 CTGGTCTCCGTGATAAACAAAGG - Intergenic
1186739599 X:12503647-12503669 CTGCTGTGGTTGATAAGAAAGGG - Intronic
1186952222 X:14639316-14639338 CTGCTGTGCTGGGTACACAATGG - Intronic
1188006450 X:25018978-25019000 CTGGTCTGCTTGGAAAACAATGG + Intergenic
1188176334 X:26995344-26995366 CTGCTGTGCTTGTTCCACAGTGG - Intergenic
1190973843 X:55379868-55379890 CTGCTGTGCTGGAAAGACCAAGG - Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1195377797 X:104244573-104244595 CTGTTGTGCTTCACAAACAAGGG - Intergenic
1198661161 X:138969084-138969106 CTCCTGTGCGTGACATACAAAGG - Intronic
1199314654 X:146363061-146363083 CTCCTGTGCCTGAAAAAAAAGGG - Intergenic
1199526521 X:148798400-148798422 ATGCAGTACATGATAAACAATGG - Intronic