ID: 1113443497

View in Genome Browser
Species Human (GRCh38)
Location 13:110347641-110347663
Sequence CCAGGGCATGCAGTGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113443497_1113443502 3 Left 1113443497 13:110347641-110347663 CCACCACACACTGCATGCCCTGG 0: 1
1: 0
2: 2
3: 44
4: 372
Right 1113443502 13:110347667-110347689 TCAAATTCCTGAATTTTTTCTGG 0: 1
1: 0
2: 3
3: 53
4: 428
1113443497_1113443504 23 Left 1113443497 13:110347641-110347663 CCACCACACACTGCATGCCCTGG 0: 1
1: 0
2: 2
3: 44
4: 372
Right 1113443504 13:110347687-110347709 TGGAGCCAGTCCTGCCCGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113443497 Original CRISPR CCAGGGCATGCAGTGTGTGG TGG (reversed) Intronic
900105437 1:978974-978996 CCAGGGCCTGCAGTGGGAGCGGG + Exonic
901460041 1:9385933-9385955 CCAGGGAGTGCAGGGTGTGCTGG + Intergenic
902045244 1:13519117-13519139 CCAGGCCATGCAGGATCTGGTGG - Intergenic
902081951 1:13827290-13827312 TCAGGGAATGAAGAGTGTGGAGG + Intergenic
903229160 1:21911447-21911469 CCAGAGCAGGCAGGGAGTGGGGG + Intronic
903993996 1:27293724-27293746 CCAAGCCATGCAGTGTGTGAGGG - Intronic
904035426 1:27556234-27556256 CCTGGGGAGGCAGTGGGTGGGGG - Intronic
904259508 1:29280256-29280278 GCAGGGCTTGGAGTGTCTGGAGG + Intronic
904274174 1:29369580-29369602 CCTGGGTATGGAGTGAGTGGAGG - Intergenic
904410280 1:30320842-30320864 CAGGGGCATGGAGTGGGTGGGGG + Intergenic
904713147 1:32446929-32446951 CCAGTGCATTCAGTCTGTAGAGG - Intergenic
904963188 1:34350768-34350790 GCAGAGAATGCAGTGTCTGGTGG + Intergenic
905108161 1:35576283-35576305 ACAGGGCAGGAAGTGGGTGGGGG + Intronic
905264288 1:36740326-36740348 CCAGGGCACCCAATGTGTTGAGG + Intergenic
906466642 1:46087104-46087126 CCAGGGCCCGTCGTGTGTGGGGG + Intronic
907300140 1:53481887-53481909 CCAGGAGATGCTGTCTGTGGGGG + Intergenic
907408100 1:54266089-54266111 CGCTGGCAAGCAGTGTGTGGAGG - Intronic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
907870240 1:58436513-58436535 CCATGGCATGGAGTGAGAGGTGG - Intronic
909491701 1:76233516-76233538 CCAGTGCATGCCCTTTGTGGTGG - Intronic
909853770 1:80502652-80502674 CCAGGGCCTGTCGTGGGTGGGGG + Intergenic
911097377 1:94065609-94065631 CCAGGGCATGGAGGCTGAGGTGG - Intronic
911443768 1:97964546-97964568 TCAGTAGATGCAGTGTGTGGAGG - Intergenic
912046089 1:105459707-105459729 CCAGTACATGCAGTATATGGTGG + Intergenic
913156220 1:116101766-116101788 CCAGGGCCTGCAGGGGGTGGGGG - Intergenic
913195875 1:116455456-116455478 CCATGGGAGGCAGTGTGGGGTGG - Intergenic
913218069 1:116637107-116637129 CCAGCGCATGCAGAGAGTGATGG + Intronic
915090414 1:153420223-153420245 CCAGGCCAGGCAGTGTGTTATGG + Exonic
915304388 1:154969406-154969428 CCAGGGCACGCATTGACTGGAGG + Exonic
916395788 1:164386024-164386046 CCAGGGCCTGCAGGGGGTGGGGG - Intergenic
916473779 1:165148924-165148946 CCAGGTTAAGGAGTGTGTGGTGG + Intergenic
918218266 1:182412555-182412577 GCAGAGCTTGCAGTGAGTGGAGG + Intergenic
918250619 1:182699939-182699961 CCAGGGCAGGCACTGTGTGAGGG - Intergenic
920040441 1:203091873-203091895 CCAGGGAATGGAGGGGGTGGTGG - Intronic
920601964 1:207335757-207335779 CTAGGGCATCCCGTGTGTGATGG + Intronic
921173130 1:212566572-212566594 CCAGGGCATAGAGGGGGTGGAGG + Intronic
921222946 1:212986672-212986694 CCAGGGCATGCAGAGGCTGGAGG + Intronic
922370430 1:224905055-224905077 CCAGGTGCTGCAGTGTGTGATGG + Intronic
922536879 1:226387576-226387598 CCAGTGTATGCTGTGTGTGATGG - Intronic
922569600 1:226626162-226626184 ACATGGCATGCAGTGTGAAGAGG - Intergenic
922719184 1:227891656-227891678 CCAGGGCAGGCAGGGAGTCGGGG + Intergenic
922762325 1:228140731-228140753 CCAAGGCTTGCAGGGTGAGGTGG - Intronic
922910387 1:229210897-229210919 CCAGGCTGTGCCGTGTGTGGAGG - Intergenic
923843135 1:237696389-237696411 CTAGGGCCTCCAGTGTTTGGAGG - Intronic
924414107 1:243840340-243840362 CCAGGGCCTGCTGGGGGTGGGGG + Intronic
1062816679 10:506099-506121 CAATGCCATGCAGTGTGAGGTGG - Intronic
1063383989 10:5604491-5604513 CCCGGGCAGGGAGTGCGTGGGGG - Intergenic
1064155061 10:12897076-12897098 CCAGGCCCTGCAGTGTCTGGGGG + Exonic
1064236116 10:13577385-13577407 CCGGGGCCTGCAGGGGGTGGAGG - Intergenic
1065019464 10:21492454-21492476 ACAGTGCATGCATTCTGTGGAGG - Intergenic
1065866720 10:29921020-29921042 CCAAATCATGCAGTTTGTGGAGG + Intergenic
1067288425 10:44924216-44924238 CCAGGCACTGCAGGGTGTGGGGG - Intronic
1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG + Intronic
1069987303 10:72293190-72293212 GAAGGGCTTGCAGGGTGTGGGGG - Intergenic
1070453064 10:76581302-76581324 CCAGGACATGCAGAGTTTGGTGG + Intergenic
1070697173 10:78572014-78572036 CCTGGGCAGGGAGTGGGTGGTGG + Intergenic
1072303014 10:94079994-94080016 CCAGGGTATGAACTGTGTGCAGG + Intronic
1072601752 10:96937637-96937659 CCAGTGAAGGCAGAGTGTGGTGG - Intronic
1072959179 10:99913962-99913984 CCAGAGCTGGCTGTGTGTGGAGG + Intronic
1073461252 10:103667185-103667207 CCAGGGGAGGCAGTGTGGGCTGG - Intronic
1073777088 10:106798441-106798463 CCAGGGCCTGTCGTGGGTGGGGG - Intronic
1074279869 10:112040842-112040864 CCAGGGCAGGCAGTTGGTAGGGG + Intergenic
1075347851 10:121697387-121697409 CCAAGGCATCCAGTGTGATGAGG + Intergenic
1075638933 10:124050520-124050542 CTATGGCATCCAGTGGGTGGGGG - Intronic
1075678942 10:124318709-124318731 CCAGGTGAGACAGTGTGTGGCGG + Intergenic
1076008795 10:126969741-126969763 CCAGGGAAGGGAGTGTGTGGTGG + Intronic
1076351229 10:129816332-129816354 CCTGGCCATGCAGTGGGTGTGGG - Intergenic
1076704234 10:132292697-132292719 CCAGGGCCTGCTTTGGGTGGGGG - Intronic
1076759571 10:132595236-132595258 CCAGGGCATGCAGTTTCTGCAGG + Intronic
1076997609 11:306366-306388 CCAGGACATTCTGTGTGTGGGGG + Intergenic
1077154572 11:1085640-1085662 CCAGGGCAGGCAGGGAGGGGTGG - Intergenic
1077505435 11:2927989-2928011 CCAGTGCCCGCAGTGTGGGGCGG - Intergenic
1077644058 11:3907989-3908011 AAAGGGGTTGCAGTGTGTGGTGG - Intronic
1077783812 11:5360977-5360999 CCAGGGCCTGCAGTGGGGTGGGG + Intronic
1078185741 11:9050802-9050824 TCAGGGTGTGCTGTGTGTGGTGG - Intronic
1078915219 11:15772412-15772434 CCAGGGAAGGCAGTGTGGTGAGG - Intergenic
1079324977 11:19484086-19484108 CAAGGTCATGCAGGGCGTGGAGG - Intronic
1079350030 11:19684657-19684679 ACTGGGCTTGCAGTGTGGGGGGG - Intronic
1079545600 11:21628802-21628824 AGAGGACATGAAGTGTGTGGGGG + Intergenic
1079578361 11:22030921-22030943 CTGGGGCCTGCAGGGTGTGGGGG + Intergenic
1080890997 11:36409210-36409232 GGAGGGCATGGAGTGAGTGGTGG - Intronic
1081632083 11:44696019-44696041 CCAGGGCCTACAGTGAGTGATGG + Intergenic
1081730512 11:45368832-45368854 CCAGGCCAAGCAGTGTGTGTGGG + Intergenic
1082269999 11:50160155-50160177 GCAGGGCTGGGAGTGTGTGGTGG + Intergenic
1083718025 11:64590430-64590452 CAAGGGCTCGCAGTGCGTGGTGG + Intergenic
1083933795 11:65860069-65860091 ACAGGGCAAAGAGTGTGTGGTGG - Intronic
1084477126 11:69395439-69395461 CCAGAGAATGCAGTGGCTGGTGG + Intergenic
1084551255 11:69843477-69843499 CCAGGTCATGGAGTGGGTGGTGG + Intergenic
1085051236 11:73381348-73381370 CCAGTGCATGCACTGTGAGGAGG + Intronic
1085405881 11:76261900-76261922 TCAGGGTCTGCAGTGTGTGGGGG + Intergenic
1085510698 11:77086705-77086727 CCAGGGGATGGAGTGGGAGGAGG - Intronic
1085750903 11:79160377-79160399 GCAAGGCATGCAGTGCCTGGGGG + Intronic
1087794829 11:102444530-102444552 CCAGGGCCTGTCGTGGGTGGGGG + Intronic
1089288306 11:117421632-117421654 GAAGAGCAGGCAGTGTGTGGGGG + Intergenic
1089405682 11:118195539-118195561 TCGGGGCGTGCAGTGAGTGGGGG - Intronic
1090963115 11:131574451-131574473 CCAGGTTATGCAGTGTGTGAGGG + Intronic
1091593324 12:1858377-1858399 CCAGGGCATGCAGGATCTGTGGG - Intronic
1092153754 12:6268814-6268836 CCAGGGAAGGCAGTGCCTGGAGG - Intergenic
1093798295 12:23340186-23340208 CCAGGTCAAGCATTGTGTGAAGG - Intergenic
1094058667 12:26290960-26290982 CAAGGGCATGCCCTATGTGGGGG + Intronic
1094852512 12:34388592-34388614 CCAGCGCATGCACAGTGGGGAGG + Intergenic
1095986035 12:48000437-48000459 CCAGGTGATGGAGTGGGTGGAGG + Intronic
1096666766 12:53171346-53171368 CCAGGGGCGGCAGTGTGCGGAGG + Exonic
1098364400 12:69687343-69687365 CCAGGGCAGGCCAGGTGTGGTGG + Intronic
1100379704 12:94049993-94050015 ACAGGGCAGGAAGTGGGTGGAGG + Intergenic
1101066007 12:101021314-101021336 CCAGCTCCTGCAGTGCGTGGTGG - Intronic
1101461656 12:104903140-104903162 ACAGGGAATGCAGTGAGAGGTGG - Intronic
1101594509 12:106152112-106152134 CAAGGGCATCCAGTGAGAGGAGG + Intergenic
1101838746 12:108312902-108312924 CCAGGGCAGGGAGTCTGTAGAGG + Intronic
1102867734 12:116387358-116387380 TCAGGGCCTGCAGTGTGCAGTGG - Intergenic
1103008758 12:117441684-117441706 CCAGGGCATCCAATGTGTTGGGG - Intronic
1105518215 13:21109406-21109428 CCATGGCATGCAGGGTGTGCAGG + Intergenic
1106059515 13:26274497-26274519 GCAGAGCTTGCAGTGAGTGGAGG - Intronic
1106239743 13:27901547-27901569 CCAGGGGATAAAATGTGTGGGGG + Intergenic
1107001917 13:35557481-35557503 CCAGAGCATGCAGACTCTGGTGG + Intronic
1107751175 13:43568971-43568993 CCAGGGCTTGCAGCATGTGTAGG + Intronic
1110139117 13:72105576-72105598 CCAGGGCATGCAGGATGTGGGGG - Intergenic
1111896747 13:94151597-94151619 CCATGACTTGCAGTGTTTGGTGG - Intronic
1113443497 13:110347641-110347663 CCAGGGCATGCAGTGTGTGGTGG - Intronic
1113646986 13:112005092-112005114 CCAGGCTGTGCAGTGAGTGGAGG - Intergenic
1114674479 14:24431216-24431238 CCAAGGAATGCACTGTGGGGTGG + Intronic
1115332260 14:32211206-32211228 CCAGGGGAAGAAGTGAGTGGAGG - Intergenic
1118361740 14:65062900-65062922 CCATGAAGTGCAGTGTGTGGAGG - Intronic
1118757246 14:68853940-68853962 CCAGGGCCTGGTGTGGGTGGAGG - Intergenic
1119655550 14:76414209-76414231 TCAGGGCATGCAGTATGCAGGGG - Intronic
1121121254 14:91377130-91377152 TCAGGGCAGGCAGTCTGAGGTGG - Intronic
1121585624 14:95061130-95061152 GCAGGGCATGCTGTCTCTGGAGG + Intergenic
1122160895 14:99783145-99783167 CCAGGGCCTGTTGTGGGTGGGGG - Intronic
1122348425 14:101074289-101074311 CCAGAGCCAGCAGTGTGTGGGGG - Intergenic
1123018390 14:105386309-105386331 CCAGGCTCTGCAGTGTGTAGGGG - Intronic
1123792617 15:23737410-23737432 ATTGGGCATGCAGTGAGTGGGGG - Intergenic
1123907806 15:24937771-24937793 CCAGGGGATGGGGTGTGGGGAGG - Intronic
1125719437 15:41838320-41838342 CCAGGGCATGGTTTGTGGGGGGG - Intronic
1126172912 15:45709023-45709045 CCAGGCCATGTGGTGCGTGGTGG - Intergenic
1126891968 15:53216069-53216091 CCAGAGCCTGCTGTGTGTGTGGG - Intergenic
1128160023 15:65417424-65417446 CCATGGTTTGCTGTGTGTGGAGG - Intronic
1128234787 15:66059992-66060014 ACAGGTCAGGCAGTGGGTGGGGG + Intronic
1128245743 15:66131511-66131533 CCAGCCCAAGCAGTGTGTGGAGG + Intronic
1128555689 15:68630225-68630247 CCAGGGGATGCTGTGTGGGGTGG + Intronic
1128604529 15:69027044-69027066 TCAGGGCATGCAGGCTGTGTGGG - Intronic
1128708767 15:69856695-69856717 CCAGGGCCTGCAGTCATTGGTGG + Intergenic
1129169725 15:73800211-73800233 CAAGGGCAGGCAGTGTGAGCTGG - Intergenic
1129268651 15:74408219-74408241 CCAGGGCATGCCGAGTGTTGGGG + Intergenic
1129291079 15:74568147-74568169 CCTGGGCAAGCATTGTGTGAGGG + Intronic
1130679156 15:85981269-85981291 CCAAGGCAGACAGTGTGTGTGGG + Intergenic
1132285464 15:100659053-100659075 CCAGGCCCTGCAGTGACTGGTGG + Intergenic
1132571503 16:646403-646425 CCAGGGCTGGCAGGGTCTGGTGG - Intronic
1132958006 16:2606625-2606647 CCTGGGCTTGCAGAGTGTGGGGG + Intergenic
1132970482 16:2685873-2685895 CCTGGGCTTGCAGAGTGTGGGGG + Intronic
1133378990 16:5314181-5314203 CCAGGTCATGCAGTGGGTATTGG + Intergenic
1133967686 16:10543454-10543476 CCGGAGTATGCAGTGAGTGGAGG + Intronic
1134598601 16:15515450-15515472 CCAAGGAAAGAAGTGTGTGGAGG + Intronic
1134669963 16:16047584-16047606 CGAGGGCATGTAGTGGGTCGAGG + Intronic
1135187782 16:20330004-20330026 CTGGAGCATGCAATGTGTGGTGG - Intergenic
1135510503 16:23078713-23078735 CCAGGGCAAGCAGGATGTGAGGG + Intronic
1136052395 16:27661261-27661283 TCAGGGCATGCAGGGAATGGTGG + Intronic
1136341274 16:29645184-29645206 CAAGGGCACACAGTGAGTGGTGG + Intergenic
1136559683 16:31031826-31031848 CCAGCTCAGGCAGGGTGTGGTGG - Intergenic
1139326360 16:66155487-66155509 ACAGGGCATGCAGTCTGGGAAGG - Intergenic
1139890940 16:70252988-70253010 CCAGGGCAAGGAGTGGGTGATGG - Intronic
1140177659 16:72679950-72679972 CCAGGGGCTGCAGGGTGAGGAGG + Intergenic
1142235347 16:88919837-88919859 CCAGGAGTTGCAGTGTGGGGCGG - Intronic
1142322298 16:89391321-89391343 CCAGGGCTTGCGGTGGGTGCTGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142522458 17:514725-514747 ACAGGGCACGCAGAGCGTGGGGG - Exonic
1142969970 17:3604702-3604724 CAGAGGCAGGCAGTGTGTGGCGG + Intergenic
1143001542 17:3798145-3798167 CCCCGGAATGCAGTGTGTGGGGG - Intronic
1143745629 17:8992055-8992077 CCAGAGCCTGCAGTGTCTTGTGG - Intergenic
1144713027 17:17414830-17414852 CCAGGTCCTGCAGACTGTGGAGG + Intergenic
1145256221 17:21323903-21323925 CCAGGGCAAGGAGTGTCTCGGGG - Intergenic
1146280032 17:31538774-31538796 CCAGGGCCTGCACTGGGAGGTGG - Intergenic
1146841575 17:36159978-36160000 CCCTGGCATCCAGTGGGTGGAGG - Intergenic
1146853886 17:36247939-36247961 CCCTGGCATCCAGTGGGTGGAGG - Intronic
1146869793 17:36371831-36371853 CCCTGGCATCCAGTGGGTGGAGG - Intronic
1146877148 17:36422911-36422933 CCCTGGCATCCAGTGGGTGGAGG - Intronic
1146930282 17:36771967-36771989 CCAGGGCGGGGAGTGGGTGGTGG + Intergenic
1147069085 17:37937786-37937808 CCCTGGCATCCAGTGGGTGGAGG - Intergenic
1147072672 17:37972455-37972477 CCCTGGCATCCAGTGGGTGGAGG - Intergenic
1147084194 17:38051993-38052015 CCCTGGCATCCAGTGGGTGGAGG - Intronic
1147096556 17:38141283-38141305 CCCTGGCATCCAGTGGGTGGAGG - Intergenic
1147100142 17:38175959-38175981 CCCTGGCATCCAGTGGGTGGAGG - Intergenic
1148689704 17:49520186-49520208 CCAGGGCAGGAAGACTGTGGAGG - Intergenic
1149456754 17:56794476-56794498 TGGGGGCATGCAGGGTGTGGGGG + Intronic
1149930818 17:60753475-60753497 GCAGAGCTTGCAGTGAGTGGAGG - Intronic
1150083088 17:62258995-62259017 CCCTGGCATCCAGTGGGTGGAGG - Intergenic
1150223670 17:63511102-63511124 CCAGGCAATGGAGTGTGCGGGGG + Intronic
1150229912 17:63544152-63544174 CCAGGGCAGGTAGGGGGTGGGGG + Intronic
1150835932 17:68564529-68564551 CCAAGGCATGCAAATTGTGGTGG - Intronic
1151849374 17:76681348-76681370 CCAGGGCTGGCAGTGTGTCTTGG - Intronic
1152111236 17:78358798-78358820 CCTGCGCATCCAGTGTGAGGGGG - Exonic
1153229726 18:2924326-2924348 GAGGGGCAGGCAGTGTGTGGTGG - Intronic
1154364618 18:13695701-13695723 CCAGGGCCTGCGGTGGGTGGGGG + Intronic
1155633732 18:27925706-27925728 CCAGGGCCTGCCGGGGGTGGGGG - Intergenic
1156575935 18:38315118-38315140 CCAGGTCCTGCTGTGTGTGCTGG + Intergenic
1156810051 18:41237928-41237950 CCAGGGCCTGTTGTGGGTGGGGG + Intergenic
1157286937 18:46383202-46383224 CCAGGGGAGGCAGTGGGTGTTGG + Intronic
1157444277 18:47733140-47733162 CTAGGGTATGGAGTGTATGGGGG + Intergenic
1157859102 18:51124957-51124979 GCAGGGCTTGCAGGGTTTGGTGG + Intergenic
1159697874 18:71583610-71583632 CCAAGACATGCAGTCTCTGGGGG + Intergenic
1160809544 19:1007482-1007504 TCTGGGCATGGAGTGGGTGGAGG + Intronic
1161036862 19:2089879-2089901 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161072158 19:2267952-2267974 TCAAGGCATGGAGTGGGTGGAGG + Intronic
1161078968 19:2300955-2300977 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161138586 19:2635117-2635139 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161142292 19:2654867-2654889 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161143850 19:2665284-2665306 TCCGGGCATGCAGTGGCTGGAGG - Intronic
1161197699 19:2996218-2996240 CCCTGGCATGGAGTGGGTGGGGG + Intergenic
1161202030 19:3020370-3020392 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161265800 19:3363794-3363816 CCCTGGCATGGAGTGGGTGGAGG + Intronic
1161286003 19:3468560-3468582 GCAGGGCATACAGTGGGGGGTGG + Intronic
1161328647 19:3675819-3675841 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161405939 19:4091097-4091119 CCCTGGCATGGAGTGGGTGGAGG - Intronic
1161564968 19:4996919-4996941 TCCTGGCATGCAGTGGGTGGAGG - Intronic
1162035037 19:7934049-7934071 CTAGGGCATGCAGCCTGGGGCGG - Intronic
1163794210 19:19327096-19327118 CCTGGGGAGGCTGTGTGTGGTGG - Intronic
1165485010 19:36090229-36090251 ACTGAGCTTGCAGTGTGTGGGGG + Intronic
1165710159 19:38005307-38005329 CCAGAGCAAGCAGGGTCTGGGGG - Intronic
1166398113 19:42457347-42457369 CCGGGGCATCCAGAGTGAGGAGG + Intergenic
1166530995 19:43543499-43543521 TCAGGGCCTGCAGGGTGGGGTGG + Exonic
1167575174 19:50314502-50314524 GGAAGGCATGCAGTGTGTGGGGG + Intronic
1168110233 19:54188260-54188282 CCAGAGAATGCAAAGTGTGGGGG + Exonic
925171800 2:1754663-1754685 CCAGGGAACGCACTGGGTGGGGG - Intergenic
925474798 2:4201224-4201246 CCAGGGTATGCAGTTTCTGTGGG + Intergenic
928759951 2:34570429-34570451 TCAGTCCATGCAGCGTGTGGGGG - Intergenic
931042173 2:58312972-58312994 CCAGGGCTTGCAGTCTGTCATGG + Intergenic
931974069 2:67623479-67623501 CCAGGGCCTGCTGTGGGTGACGG - Intergenic
932322359 2:70831630-70831652 CCAGGGCATGAAGGGAGTGGGGG - Intronic
932404301 2:71503453-71503475 CCAGAGTTTGCAGTGTCTGGAGG + Intronic
933188369 2:79304044-79304066 GCAGTCCATGCAGGGTGTGGGGG + Intronic
934763222 2:96867574-96867596 CCTGGGCAGGCAGTCTGGGGTGG + Intronic
935085302 2:99838852-99838874 ACAGGGCATGGAGAGTGTGATGG - Intronic
935848560 2:107193848-107193870 GCAAGGCATACAGTGTGTGTGGG + Intergenic
936514408 2:113172875-113172897 CTGGGGCACGCAGAGTGTGGTGG + Intronic
937289430 2:120773350-120773372 CCAAGCCCTGCAGTGTGAGGGGG + Intronic
938090247 2:128426517-128426539 TCAGGGGATGGAGTGTGGGGAGG - Intergenic
938900759 2:135796911-135796933 CCAGGGTGTGCATTGTGAGGTGG + Intronic
939164053 2:138621247-138621269 CTAGGGTATGCAGGGTGGGGTGG + Intergenic
940066513 2:149636042-149636064 CCAGGGCCTGTTGGGTGTGGGGG - Intergenic
943291554 2:186078629-186078651 CCAGGGCCTGTTGTGGGTGGGGG + Intergenic
943946167 2:194068607-194068629 CCAGGGCATGTCGTGTGGTGGGG - Intergenic
945480318 2:210337679-210337701 CCAAGGCATGCCTTGTTTGGCGG + Intergenic
946333285 2:219022204-219022226 CCGGAGCATGTAGTGGGTGGTGG + Exonic
946456047 2:219826939-219826961 TCAGGCCCTGCAGTGTTTGGGGG - Intergenic
947998390 2:234547518-234547540 TGAGGGCGTGCTGTGTGTGGTGG + Intergenic
948873849 2:240817290-240817312 CCTGGGCATGGAGTGGGTGATGG + Intronic
948995052 2:241573808-241573830 CAAGGGAAGGCTGTGTGTGGGGG - Exonic
1169200438 20:3706656-3706678 CCAGGACGTGCAGGGTGTGAAGG - Exonic
1169755427 20:9038190-9038212 CAAGGGCAGGCTGGGTGTGGTGG - Intergenic
1173559221 20:43990591-43990613 CCACAGAATGCAGTGTTTGGGGG + Intronic
1174115268 20:48222659-48222681 ACAGGGCATGCAGTGTCAGATGG + Intergenic
1174420026 20:50393497-50393519 CCAGGACAGGCAGTGTATGGAGG - Intergenic
1175202995 20:57290817-57290839 CCGGGCCATGCAGTGTGCAGTGG - Intergenic
1175527483 20:59645482-59645504 CCAGGGAGGGCAGTGTGGGGCGG - Intronic
1175540302 20:59743927-59743949 CCAGGGCTGGCAGGGTGTGAGGG - Intronic
1175687279 20:61040806-61040828 CCTGGGCATGGAGGGAGTGGGGG - Intergenic
1178078154 21:29032112-29032134 CCAGGGGCTGCAGAGAGTGGTGG - Intronic
1178926328 21:36778345-36778367 GCAGGGGTTGCAGTGAGTGGAGG - Intronic
1179560362 21:42212075-42212097 CCAGAAAATGCAGTGTCTGGAGG - Intronic
1180118373 21:45726690-45726712 CCACGGCATTCAGGATGTGGAGG + Intronic
1180853599 22:19033425-19033447 CCATGCCATGCTGGGTGTGGGGG - Intergenic
1180999736 22:19982420-19982442 CCAGGCCATGCAGCTTGGGGAGG - Intronic
1181678696 22:24475716-24475738 GCAGGGGAGGCTGTGTGTGGAGG - Intergenic
1182115779 22:27755503-27755525 CCTGGGCATGGAGTGTGAGGTGG - Intronic
1182423634 22:30260483-30260505 CCAGGGCAGGCCGAGCGTGGGGG + Intergenic
1183335577 22:37244124-37244146 GCAGGCCATCAAGTGTGTGGTGG - Exonic
1184093752 22:42305677-42305699 CCAGGGAAGGCAGTCTGGGGAGG - Intronic
1184265765 22:43345031-43345053 ACAGGGCAAGCAGTGTGAGGTGG + Intergenic
1184324011 22:43768239-43768261 CCAGGGCAGGAAGTATGAGGAGG - Intronic
1184347626 22:43923488-43923510 CCAGGACATGCAGTGTCTGCTGG + Intergenic
1184754670 22:46509110-46509132 CCAGGGCCTGCACTGAGTGAGGG + Intronic
1185276937 22:49953893-49953915 CCAGGGCCTGCGGTGGGTAGGGG - Intergenic
949964472 3:9343931-9343953 GTAGGGCAGGCTGTGTGTGGTGG - Intronic
950090139 3:10289356-10289378 CCAGGGCCTGGACTGTGGGGTGG - Intronic
950105963 3:10388647-10388669 CCAGGGCAGGTAGTAGGTGGTGG - Intronic
951535795 3:23739475-23739497 CCACGGCAGGCAATGCGTGGAGG + Intergenic
952385756 3:32840593-32840615 ACAGGGCATGCAGTGGGGGTAGG + Intronic
952823069 3:37501837-37501859 CCTAGGCATGCAGTCTGAGGGGG + Intronic
953578048 3:44128901-44128923 GGAGGGCATGCAGGGGGTGGGGG - Intergenic
953911797 3:46896914-46896936 TCAGGGCAGGCATTGAGTGGTGG + Intronic
954649741 3:52153923-52153945 CCCGGGCCTGCAGTGTGAGCGGG - Intronic
955104033 3:55878758-55878780 CCAGTGCATGCAGACTTTGGGGG - Intronic
956666429 3:71646218-71646240 CCAGGGTCTGCAGGGAGTGGAGG - Intergenic
960503310 3:118463976-118463998 ACAGGGCATTCACTGTGTGTCGG + Intergenic
960735298 3:120772865-120772887 CCAAGGCCTGCAGTGAGTGGGGG - Intronic
960988632 3:123296283-123296305 ACAGGGCCAGCAGTGGGTGGGGG - Intronic
963043288 3:141084479-141084501 CCAGGGCAGGCAGGGGGAGGGGG - Intronic
963068385 3:141281770-141281792 CCAACCCATGCAGTGTGAGGTGG + Intronic
963466496 3:145688718-145688740 CCAGGGGATGCACTGTCTGTGGG - Intergenic
965271630 3:166623411-166623433 CCAGGGCCTGCTGGGGGTGGGGG + Intergenic
967015786 3:185480493-185480515 TCTGGGCAAGCTGTGTGTGGAGG + Exonic
968277424 3:197451207-197451229 CCAGGGCATTCGGTATGTGAAGG + Intergenic
968768294 4:2486560-2486582 CCAGGGCATGGAGAATGAGGGGG + Intronic
968829379 4:2924723-2924745 GCAGGGCCTGGTGTGTGTGGCGG - Intronic
969479207 4:7438322-7438344 CCAGGTCATGCATCGTGTGGGGG + Intronic
969857331 4:10010794-10010816 ACAGGGAATGCAGTGGTTGGGGG - Intronic
970671076 4:18397405-18397427 CAGGGTCATGCAGTTTGTGGTGG + Intergenic
973563481 4:52161073-52161095 CCAGGACATGCAGTGTTTTCAGG - Intergenic
974235381 4:59174117-59174139 AAAGGACATGCAGTGAGTGGTGG - Intergenic
975599418 4:76083828-76083850 CAAGGGAATATAGTGTGTGGGGG + Intronic
976314224 4:83642440-83642462 ACATGGGATGGAGTGTGTGGTGG + Intergenic
977040959 4:92017671-92017693 CCAGGGCATTAAGGGTGAGGAGG + Intergenic
978002007 4:103567688-103567710 TCACAGCATGCAGTGTGTTGTGG - Intergenic
981104725 4:140867402-140867424 CCAAGGCATCCAGTCTTTGGTGG - Exonic
981593567 4:146392839-146392861 CAAGGTCATGCAGTGTCTTGTGG - Intronic
981847077 4:149181817-149181839 CCAGGGCCTTCAGGGTGTGGGGG + Intergenic
982071700 4:151701241-151701263 CCATGGCAGCCTGTGTGTGGCGG + Intronic
983030483 4:162795398-162795420 CCAGGGGCTGGAGTGTGGGGAGG + Intergenic
984800303 4:183709705-183709727 GCAGAGCTTGCAGTGAGTGGAGG + Intronic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
985490998 5:179445-179467 CCAGGTCCTTCAGTATGTGGGGG - Intronic
985784104 5:1885301-1885323 CCAGGGCAGCCAGTACGTGGGGG + Intronic
992917825 5:81477620-81477642 CCAGGACATGGCGGGTGTGGGGG - Intronic
993816015 5:92546515-92546537 CCAGGCCTTGCAGTGGGTGGAGG + Intergenic
994113742 5:96038525-96038547 CCAGGGCCTGCGGGGGGTGGGGG - Intergenic
995537656 5:113153357-113153379 CCAGTTCATGGAGTCTGTGGGGG - Intronic
996397804 5:123031326-123031348 CCTGGGCATACAGTGTTTGGGGG - Intronic
997221770 5:132173334-132173356 CTAGGTCATCCAGTATGTGGTGG + Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
998543034 5:143001160-143001182 CCAGTGCATGGGGTGTGTGAGGG + Intronic
999248140 5:150166577-150166599 CCAGGGCCTGGAGGGGGTGGGGG - Intergenic
1000114777 5:158143442-158143464 TCAGGGCATGCAGTGGGGTGGGG - Intergenic
1001143515 5:169164609-169164631 CCAGGGCCTGGAGGGTCTGGCGG - Intronic
1001758005 5:174185696-174185718 CCAGGGTGTGGGGTGTGTGGGGG + Intronic
1002790976 6:437139-437161 TCTGGGCACGCATTGTGTGGTGG + Intergenic
1002799265 6:505593-505615 CCTGGGAATGCAGAGTGGGGTGG - Intronic
1003350953 6:5317491-5317513 CCAGGCCAGGCTGCGTGTGGTGG + Intronic
1003466312 6:6383245-6383267 CCAGGCAGTGGAGTGTGTGGGGG + Intergenic
1003509042 6:6763986-6764008 TGAGAACATGCAGTGTGTGGTGG + Intergenic
1004007989 6:11654433-11654455 TCAGAGCAAGCAGAGTGTGGAGG + Intergenic
1005133080 6:22534732-22534754 TCAGTGCAACCAGTGTGTGGGGG + Intergenic
1007362286 6:41367643-41367665 ACAGGGCATTCAGCGTTTGGTGG + Intergenic
1007398099 6:41588647-41588669 CCAGGGCGTGCTCTGTGTTGAGG - Exonic
1007543652 6:42673472-42673494 CCAGTGCAGGCCGGGTGTGGTGG - Intronic
1007789013 6:44298235-44298257 ACAGGGCATGGACTGTGTGAAGG - Intronic
1010666903 6:78641668-78641690 CCAGGGCCTGCAGGGTGTGTGGG - Intergenic
1012878962 6:104762537-104762559 CCAGGGCCTGCTGAGGGTGGGGG + Intronic
1014358616 6:120445513-120445535 CTAGGGGATGCAGGGGGTGGAGG + Intergenic
1016140161 6:140598527-140598549 CCAGGGCCTGCTGGGCGTGGGGG + Intergenic
1016328219 6:142926987-142927009 CCAGGGCAGGCAGCGCGCGGCGG + Intronic
1016459175 6:144263986-144264008 CCAGGGCATGCGCTCTGAGGTGG + Intergenic
1017499150 6:155007141-155007163 GTAGGGCATTCAGTGTGTGGAGG + Intronic
1018039451 6:159909155-159909177 CCAGGACGTGCAGTGTCTGGAGG - Exonic
1018342237 6:162863106-162863128 CCTGTGGATGCAGTGTGTGCAGG - Intronic
1019527434 7:1487078-1487100 CCAGGGCATGGACTGCGAGGAGG + Exonic
1019659592 7:2216670-2216692 CCAGGGTAGGCTGTGTGTGTAGG + Intronic
1019926714 7:4197831-4197853 CCACCGCAAGCAGTGGGTGGGGG - Intronic
1020238538 7:6374738-6374760 GCAGGCCATCAAGTGTGTGGTGG + Exonic
1023114411 7:36847601-36847623 CCAGGGCCTGTAGTGGGGGGTGG + Intergenic
1024098723 7:46007096-46007118 CCTGGGCATGCTGTGTTTGCAGG + Intergenic
1024698404 7:51880607-51880629 CCAGGGCCTGCAGTGGGTGGGGG - Intergenic
1024981858 7:55163898-55163920 CCAGGGCATCCTGTGTGGGCAGG + Intronic
1025729718 7:64099064-64099086 GCAGAGGTTGCAGTGTGTGGAGG + Intronic
1027918355 7:84357289-84357311 CCAGGGCCTGTTGTGGGTGGAGG - Intronic
1028033490 7:85949545-85949567 CCAGGGCATCCTGGCTGTGGTGG - Intergenic
1028632882 7:92955209-92955231 CCAGGGCTCCCAGTATGTGGTGG + Intergenic
1029084260 7:97998889-97998911 CCAGGTCAGGCAGGGTGCGGTGG + Intergenic
1030789507 7:113706468-113706490 CCAGGGCATTCAGAGTGAGTAGG - Intergenic
1031381655 7:121093573-121093595 CCTGTGGATGCAGTCTGTGGAGG - Intronic
1033137780 7:138798893-138798915 GCAGGGCATAGAGAGTGTGGTGG - Intronic
1033598809 7:142874759-142874781 CCTGGGCATTGAGTGTGGGGAGG - Intronic
1034151770 7:148922464-148922486 ACAGGCAGTGCAGTGTGTGGTGG - Intergenic
1034537925 7:151737587-151737609 CAAGGGGATGGAGTGTGGGGTGG + Intronic
1035516809 8:240708-240730 CAAGGACATGCAGTGGGTAGGGG - Intronic
1035734139 8:1875247-1875269 CCAGGGCGTGTAGGGGGTGGAGG + Intronic
1035860962 8:3027257-3027279 CCAGGGAATGCAGTGTGCTGGGG - Intronic
1037603802 8:20420901-20420923 GCAGGGCATGAAGAGTGGGGAGG - Intergenic
1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG + Intergenic
1043871559 8:85438800-85438822 TAAGGCCATGCAGTGTGCGGGGG + Intronic
1044963519 8:97554181-97554203 CCATGGCATGTAGTGGGTAGAGG - Intergenic
1047996538 8:130342111-130342133 CCAGGGCATTCACGGTGAGGTGG + Intronic
1048001816 8:130385176-130385198 CCAAGGCAGGCCGGGTGTGGTGG + Intronic
1048449987 8:134524593-134524615 CCAGGGCATCCAGTGGGTAGAGG + Intronic
1048528716 8:135227983-135228005 CCAGGAAATGCAGTGGGTGGAGG - Intergenic
1048892363 8:138959399-138959421 CCAGGACATGAGGAGTGTGGAGG + Intergenic
1049512710 8:143037825-143037847 CCAGGAGTTGCAGTGTGTGAAGG - Intergenic
1049539829 8:143203329-143203351 CCTGGGAATGCACTGAGTGGTGG - Intergenic
1049720146 8:144111883-144111905 CCAGGGCATGCAGTCTGGAAGGG + Exonic
1049790450 8:144469923-144469945 CCAAGGCAGGCGGTGGGTGGTGG + Intronic
1049797131 8:144501954-144501976 CCAGGGCACGCACCGTGGGGAGG - Exonic
1050687021 9:8183207-8183229 CCAGGGCATAGAGTGTTTGAGGG - Intergenic
1050789799 9:9453146-9453168 GCAGGCAATGCATTGTGTGGGGG - Intronic
1051966760 9:22837004-22837026 CCATGCCATGCAGTGGCTGGTGG + Intergenic
1051996408 9:23223093-23223115 CCAGGGCCTGGAGTAGGTGGTGG - Intergenic
1052165919 9:25327628-25327650 CCAGGGCCTGTAGTGGGTAGTGG - Intergenic
1053754857 9:41295609-41295631 CCAGGGCCTGCTGTGTGGTGGGG - Intergenic
1054260381 9:62859906-62859928 CCAGGGCCTGCTGTGTGGTGGGG - Intergenic
1055199755 9:73646191-73646213 CCAGTGCATGCCCTGTGAGGGGG - Intergenic
1055562259 9:77532782-77532804 CCAGCACATGCATTTTGTGGGGG - Intronic
1055941158 9:81651327-81651349 CCAGGTCCTGCAGTGGGGGGCGG + Intronic
1056968260 9:91181769-91181791 GCAGGGCTTGCTGTGTGTTGGGG - Intergenic
1057196832 9:93120128-93120150 CCATGGCCTGCAGTGTGGGCTGG - Intergenic
1058588105 9:106532129-106532151 CATGGGGATGCAGGGTGTGGGGG - Intergenic
1061074392 9:128332354-128332376 CCAGGTGATGCAGAGGGTGGTGG - Intronic
1061350594 9:130061654-130061676 CCAGGGCAGGCCGGGCGTGGTGG + Intronic
1062131134 9:134893841-134893863 ATAGGGCATGCAGTGTTTTGGGG - Intergenic
1062521604 9:136960172-136960194 TGAGGGCGTGTAGTGTGTGGTGG + Intergenic
1062635937 9:137491832-137491854 ACAGGTCATGCAATGTGTCGGGG + Intronic
1202798767 9_KI270719v1_random:153016-153038 CCAGGGCCTGCTGTGTGGTGGGG + Intergenic
1185521001 X:739681-739703 CCAGCAGCTGCAGTGTGTGGAGG + Intergenic
1185848752 X:3465283-3465305 CCAGGTCATGCAGGGTGTCTGGG + Intergenic
1186130563 X:6461236-6461258 CCAGTGGATGCATTTTGTGGGGG - Intergenic
1188878972 X:35468658-35468680 TCAGGGAAGGCAGTGTGGGGAGG + Intergenic
1189439788 X:41024982-41025004 CCAGCTCCTGCAGTGTGTAGTGG + Intergenic
1189942044 X:46134633-46134655 CCAGGGCCTGTAGGGGGTGGGGG + Intergenic
1190488512 X:50956565-50956587 ACAGTGCATGCAGGGTGTGGGGG + Intergenic
1190578199 X:51863119-51863141 CAAGGTCAGCCAGTGTGTGGGGG - Intronic
1190693308 X:52930585-52930607 CCAGGGCCTGTGGTGGGTGGGGG + Intronic
1192432360 X:71121036-71121058 CCAGGGCCTGCAGGAAGTGGGGG + Exonic
1193811167 X:86053689-86053711 CCAGGGCCTGTCGTGGGTGGGGG - Intergenic
1194742294 X:97588371-97588393 CTAGTGCAGGCAGTGTGGGGTGG - Intronic
1195324442 X:103747018-103747040 CAAGATGATGCAGTGTGTGGGGG - Intergenic
1195329592 X:103786228-103786250 CCAGGGTAAGCAAGGTGTGGCGG + Intronic
1196019065 X:110970584-110970606 CCAGGGCCTGCTGTGGGTGGGGG + Intronic
1198229822 X:134678236-134678258 CCAGAGCACGCAGGGTGTTGTGG - Intronic
1199590356 X:149462173-149462195 CCAGTGCATGGGGTGTCTGGAGG - Intergenic
1199843649 X:151675307-151675329 CCAGGGCAGGCAGTGAGGGCTGG - Intronic
1199980645 X:152918656-152918678 CCTGAGCATGCAGTGGGGGGTGG - Intronic
1200125441 X:153811767-153811789 ACAGGGCATGCTGTGCTTGGTGG + Intronic
1200279016 X:154761339-154761361 CCTGGGCATGCAGTGGGCTGAGG - Intergenic