ID: 1113444664

View in Genome Browser
Species Human (GRCh38)
Location 13:110356187-110356209
Sequence GTGAGTCAGTGGGAAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113444664_1113444672 17 Left 1113444664 13:110356187-110356209 CCCTCCATTTCCCACTGACTCAC 0: 1
1: 0
2: 6
3: 47
4: 428
Right 1113444672 13:110356227-110356249 TCTCTGATGAAACACTCAATGGG 0: 1
1: 0
2: 0
3: 7
4: 143
1113444664_1113444673 18 Left 1113444664 13:110356187-110356209 CCCTCCATTTCCCACTGACTCAC 0: 1
1: 0
2: 6
3: 47
4: 428
Right 1113444673 13:110356228-110356250 CTCTGATGAAACACTCAATGGGG 0: 1
1: 0
2: 3
3: 21
4: 137
1113444664_1113444671 16 Left 1113444664 13:110356187-110356209 CCCTCCATTTCCCACTGACTCAC 0: 1
1: 0
2: 6
3: 47
4: 428
Right 1113444671 13:110356226-110356248 TTCTCTGATGAAACACTCAATGG 0: 1
1: 0
2: 3
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113444664 Original CRISPR GTGAGTCAGTGGGAAATGGA GGG (reversed) Intronic
900738642 1:4316828-4316850 GTGAGCCAGTGGGCAGTGGGAGG + Intergenic
901624869 1:10618138-10618160 TTGAGGCAGTGGGAACAGGAGGG + Intronic
901785404 1:11621455-11621477 GTCAGTCTGTAGGAAAGGGAAGG - Intergenic
902202695 1:14845484-14845506 ATGAGTAAGTGGGGGATGGATGG + Intronic
904052233 1:27646623-27646645 GGGTGTCAGTGGGTGATGGAGGG + Intergenic
904055859 1:27669413-27669435 CTGATTCAGTTGGAACTGGAAGG - Intronic
904257836 1:29267640-29267662 GTGACTGAGTGGGAGATGGCAGG + Intronic
904581433 1:31546987-31547009 GTGAGTCAGAGGGAAGTGTAAGG + Intergenic
904701960 1:32362988-32363010 GTGGGTCAGTGGGGAACAGAGGG + Intronic
905303146 1:36999170-36999192 GTGAGTCAGTTACACATGGAGGG + Intronic
905894139 1:41534323-41534345 GGGGATCAGTGGGAATTGGAGGG - Intronic
905925077 1:41743855-41743877 CAGAGTAATTGGGAAATGGAAGG + Intronic
906193617 1:43914932-43914954 GGGAGACAGTAGGAAACGGACGG - Intronic
906309073 1:44740110-44740132 GTGAGTGCGTGTGAAAAGGAGGG - Intronic
906592420 1:47038822-47038844 GTGGGTAAGTGGGAATGGGATGG + Intronic
906605069 1:47163108-47163130 GTGAGTCTTTGGGAAACAGAAGG - Intergenic
906816017 1:48880118-48880140 GAGAGTCAGGGGGAAATGGTGGG - Intronic
907245453 1:53105705-53105727 GTGAGTCTCTGGGCAGTGGAGGG - Intronic
907470732 1:54671805-54671827 GTGAGTGTGGGGGAGATGGATGG + Intronic
907640006 1:56179010-56179032 GTGAGTAAATGGAAAATGCATGG + Intergenic
907660282 1:56385625-56385647 GAGAGTGACAGGGAAATGGAAGG + Intergenic
907743675 1:57191436-57191458 ATGAGACAGTGGTAAAGGGAAGG - Intronic
908037908 1:60075395-60075417 CTGACACAGTGAGAAATGGAAGG - Intergenic
909475604 1:76077595-76077617 GTGAGAAAGTGGGAAATGTATGG + Intronic
910858370 1:91719100-91719122 GTGAGTCTTTGGGAATTGGAAGG - Intronic
911366521 1:96945585-96945607 TTGAGTCAGTGGGGTGTGGAAGG - Intergenic
912147677 1:106813786-106813808 GGGAGTAAATGGGAATTGGATGG + Intergenic
913002215 1:114592207-114592229 GTGTATCAGTGGAAAAAGGATGG - Intronic
913105936 1:115613958-115613980 GTGAGTGAGTGGGGAGTGGTAGG - Intergenic
914218712 1:145658018-145658040 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914471294 1:147980882-147980904 CTGAGGGAGTGGGAATTGGAGGG - Intronic
915527456 1:156484854-156484876 GTGAGTCCTTGGGGACTGGAAGG + Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
916671640 1:167027395-167027417 GGGAGTCAGGGGGAAAGGGTGGG + Intergenic
917739256 1:177946989-177947011 TTGAGGCAGTGGAAAATGTATGG - Intronic
917746299 1:178011241-178011263 GAGAGGCAGTGGGAAATGAGGGG + Intergenic
921285414 1:213604865-213604887 GTGAGTCAGTGGGTGAGGGTGGG + Intergenic
921518622 1:216130311-216130333 GTGACTCAGGGGGAAAGGGTGGG - Intronic
921600148 1:217098051-217098073 GAGAGTCACTGGCAAATGTAGGG + Intronic
922011275 1:221590852-221590874 TTGAGTCAGTGGGCAAGGGAAGG + Intergenic
922240920 1:223755200-223755222 GGGAGACAGTGGGAGATGGTGGG - Intronic
922856259 1:228777312-228777334 GTGAGAACGAGGGAAATGGAGGG + Intergenic
923212962 1:231822437-231822459 GTGAGTAAGAGGGGAATGGGAGG + Intronic
923307067 1:232698080-232698102 GTGAGGCAGCAGGAAATGGATGG + Intergenic
924435336 1:244035222-244035244 GTGAGTCAGTGGGTGAGGGCAGG - Intergenic
924946987 1:248853180-248853202 CTGAGTCAGTGAGGAATGGATGG - Intronic
1063957959 10:11283496-11283518 GTGAGTGGGTGGATAATGGATGG + Intronic
1064342829 10:14501917-14501939 GTGAGACAATGGGAAAAGGTGGG + Intergenic
1065421778 10:25552734-25552756 GTGAGTCAGGGGAATATGAATGG - Intronic
1067356664 10:45534710-45534732 GTGAGGCAGTAGGAAAAGGTAGG + Intronic
1070720865 10:78756213-78756235 GTGAGTGGGTGGGAGATGGGAGG - Intergenic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1071023697 10:81087293-81087315 GGGACTCAGGGGGAAATGGTGGG - Intergenic
1071040017 10:81296389-81296411 GTGAGGCTATGGGAAATGGAAGG - Intergenic
1071712088 10:88059964-88059986 GCTAGACAGTGGGAAATGGAAGG + Intergenic
1071803434 10:89090211-89090233 ATGAGGCAGAGAGAAATGGAAGG - Intergenic
1073183677 10:101602312-101602334 GTGAGCCTGAGGGAGATGGAAGG - Intronic
1075176878 10:120172551-120172573 GTGAGTCAGTGCAGAATGGCAGG - Intergenic
1075325637 10:121530048-121530070 GGGTGTCTGTGGGAAATAGATGG - Intronic
1076235545 10:128861289-128861311 AGGAGTCAGTGGGGACTGGATGG + Intergenic
1076248737 10:128967806-128967828 GGGAGTCAGCGGGCAATGGGAGG + Intergenic
1077357811 11:2126851-2126873 GTGAGTGAGTGGTAAGTGGGTGG + Intergenic
1077601227 11:3576309-3576331 GTGCATAAGTGGGAAATGGTGGG - Intergenic
1078055244 11:8003835-8003857 GAGAGTAAGTGAGAAATGGTGGG - Intergenic
1078401246 11:11029268-11029290 GTGACTCAGAGGAAAGTGGAGGG + Intergenic
1079408359 11:20164091-20164113 GGGAGTGAGTGTGAAAGGGATGG - Intergenic
1080660804 11:34294463-34294485 GAGAATCAGTGGGAAAATGATGG + Intronic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1080867690 11:36210117-36210139 ATGAGTTATTGGGGAATGGATGG - Intronic
1081456850 11:43232050-43232072 GTAAGGCAGTGGGAACAGGAAGG - Intergenic
1081522492 11:43896572-43896594 TTGAGTCAGTGGGCTAGGGAAGG - Intronic
1081687460 11:45052986-45053008 GTGATTCAGTGGGACACGTATGG - Intergenic
1081692216 11:45086308-45086330 GTGAGACTGTAGGAAATGGTGGG - Intergenic
1083662870 11:64259919-64259941 GTGACTCAGTGGGGAATTCAAGG - Intronic
1084257143 11:67950883-67950905 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1084815634 11:71644385-71644407 GTGCATAAGTGGGAAATGGTGGG + Intergenic
1085540719 11:77266985-77267007 GTGAGTGAGTGGTAAGTGAATGG - Intronic
1085925281 11:81011286-81011308 ATGAGTCATTGGGAAATAGAAGG + Intergenic
1086844146 11:91727422-91727444 GTGAGCCAGTGGAAAAGGAAAGG + Intergenic
1086965295 11:93020902-93020924 GTGAGTCATTGTGAACTGGCTGG + Intergenic
1087222216 11:95558749-95558771 GTAAGAGAGTGAGAAATGGATGG + Intergenic
1088214661 11:107494578-107494600 GTGAGGCAGTGAGAAATAGTAGG - Intergenic
1088286113 11:108189934-108189956 ATGAGTCAATGTGAAATGTAGGG + Intronic
1088348760 11:108861073-108861095 TTGAGTCAGTGGGCTAGGGAAGG + Intronic
1090260624 11:125316172-125316194 GTGAGTCAGTAGCAACTGGCTGG - Intronic
1090261921 11:125327450-125327472 GAAAGTCAGAGAGAAATGGAAGG - Intronic
1091197905 11:133747457-133747479 GAGAGTAAGTGAGAAATGGGAGG - Intergenic
1092279785 12:7090426-7090448 GTGAGTCAGTGGGAGACTCAGGG - Intronic
1092427376 12:8385669-8385691 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1092878977 12:12873124-12873146 GTGAGTCAGTGTGAGCTGTATGG - Intergenic
1092889285 12:12953611-12953633 GTGAGCCAGTGGGAAAACCAAGG - Intergenic
1093556670 12:20483992-20484014 ATGAGTCAGTTGGATATGGGAGG - Intronic
1093724641 12:22489787-22489809 GTGAGACACAGGGAAATGAAAGG + Intronic
1093818650 12:23583479-23583501 ATGAGCCAGTAGGAAATGTATGG + Intronic
1094271596 12:28623353-28623375 GGGAGTCAGGGGGAAAGGGTGGG + Intergenic
1096581005 12:52585214-52585236 GTGAGACAGTGGGAGAATGAAGG + Intergenic
1097753258 12:63381282-63381304 GAGAGTCAGTGGTAACTTGATGG - Intergenic
1097970887 12:65631954-65631976 GTGAAACAGTGGAAACTGGAAGG + Intergenic
1098300741 12:69051870-69051892 GAGACTCAGTGGGAAAAGGGTGG + Intergenic
1098302484 12:69068550-69068572 GTGACTCAGTGTTAAATGGATGG + Intergenic
1098407548 12:70142045-70142067 GTGAGCCAAAGGGAAAAGGAAGG - Intergenic
1098545966 12:71711457-71711479 GTGACTCTGTGGGAGAAGGAGGG - Intergenic
1098749397 12:74275876-74275898 TTGAGTCAGTGGGCTAGGGAAGG + Intergenic
1098952862 12:76659773-76659795 GTGACTCAGGGGGAAAGGGTGGG + Intergenic
1100409061 12:94296503-94296525 GTAAGGGAGTGGTAAATGGAGGG - Intronic
1100788316 12:98102413-98102435 GGGACTCTGTGGGAAATGGTGGG + Intergenic
1101638603 12:106568398-106568420 GTGAGTCACACGGAAATAGAGGG - Intronic
1101673079 12:106894957-106894979 GTGAGTGAGTGGCAAGTGAATGG - Intergenic
1101934711 12:109047979-109048001 GTGAGTGAATGGGAATGGGAAGG - Intronic
1102417438 12:112776428-112776450 GTGAGTCTCTGGGAACTGGCTGG + Intronic
1102420545 12:112799850-112799872 GTGATTCAGTGGGACTAGGATGG + Intronic
1103045775 12:117733386-117733408 AAGAGTGAGTGGGAAATGAATGG - Intronic
1103228142 12:119305502-119305524 GTGAGTCAGTGTGAACTAGATGG + Intergenic
1103607241 12:122096523-122096545 GTGGGACAGTGGGACAAGGAGGG - Intronic
1104389696 12:128381364-128381386 GAGAGGCTGTGGGAAATGAATGG - Intronic
1104859897 12:131918421-131918443 GGGAGTCTGTGGGGGATGGATGG + Intronic
1106136092 13:26974863-26974885 GGGACTCAGAGGGAAAAGGAGGG - Intergenic
1106386244 13:29288768-29288790 GTGAATCAGTAGGTAGTGGAGGG - Intronic
1108461518 13:50671953-50671975 GTCAGTCAAATGGAAATGGAAGG + Intronic
1109178864 13:59189111-59189133 GAGAGGAGGTGGGAAATGGAGGG + Intergenic
1110742518 13:79014611-79014633 TTGAGTCAGTGGGCCAGGGAAGG + Intergenic
1111481726 13:88836896-88836918 ATGACTTAGTGAGAAATGGAAGG + Intergenic
1111798772 13:92957411-92957433 GTGAGTCGTTGGTAAATGCATGG + Intergenic
1112362119 13:98727797-98727819 GTGAGTGAGGGGGAAGGGGATGG - Intronic
1113305826 13:109077392-109077414 GTGAGTTTGAGGGAAAGGGAAGG - Intronic
1113444664 13:110356187-110356209 GTGAGTCAGTGGGAAATGGAGGG - Intronic
1113873319 13:113578309-113578331 GTGACACAGTGGGACTTGGAAGG - Intergenic
1114438966 14:22730879-22730901 GTGAGCCAAAGGGAAAAGGAAGG + Intergenic
1115050931 14:29062089-29062111 GTCAGTCAATGGGAGATGGAAGG - Intergenic
1116642119 14:47477389-47477411 GTAATTCATTGTGAAATGGAAGG + Intronic
1116782425 14:49250918-49250940 GTGTGCCAGTGGGGAATGGGAGG - Intergenic
1117002069 14:51380907-51380929 AAAAGTCAGTGGGAGATGGAAGG - Intergenic
1117725858 14:58672854-58672876 GTGAGTGAGAAGGGAATGGAAGG - Intergenic
1118880544 14:69822193-69822215 TTGAGTCAGTGGGCTAGGGAAGG - Intergenic
1118895458 14:69941992-69942014 GTGAGTCTTTGCCAAATGGATGG + Intronic
1119060201 14:71465999-71466021 TTGAGTCAGTGGGCTACGGAAGG - Intronic
1119744451 14:77034019-77034041 GTGGGCCAGTGGGAACTGGCTGG - Intergenic
1121547430 14:94772125-94772147 CCTAGTCAGTGGGAGATGGAAGG - Intergenic
1122461284 14:101897670-101897692 GTGAGTCAGTGGGCTAGGAAAGG - Intronic
1122879870 14:104685917-104685939 GTGGGTGAGTGGCAAATGGGTGG + Intergenic
1125362026 15:38874476-38874498 TGGAATCAGTGGGAGATGGAAGG + Intergenic
1125558806 15:40610276-40610298 GTGAGAAAGTCAGAAATGGAAGG + Exonic
1125911644 15:43445092-43445114 GTGAGTTAGAGGGAAATGCAGGG - Intronic
1126653008 15:50945057-50945079 GTGAAACAATGGAAAATGGATGG + Intronic
1127310518 15:57747929-57747951 GTGAGATAGAGGGAAATGTATGG - Intronic
1127586920 15:60387318-60387340 GTGAGTGTGGGGGAAGTGGAAGG - Intronic
1127881392 15:63161565-63161587 GGGAGCCAGTGCCAAATGGAAGG - Intergenic
1128475809 15:67996023-67996045 GTGGGCCTGTGGGAAATGCATGG + Intergenic
1128509653 15:68305595-68305617 GTGAGTCAGTGGCCAAAGGAGGG - Intronic
1129161245 15:73749073-73749095 GTGGGTGAGTGTGAAAGGGAAGG + Intronic
1129193833 15:73952808-73952830 GGGTGTGAGTGGGAGATGGAGGG + Intergenic
1129281821 15:74491292-74491314 TTAATTCAGTGGGATATGGATGG + Intergenic
1131454463 15:92572247-92572269 CTGAGTCAGTGGGAATGTGATGG + Intergenic
1133523722 16:6583316-6583338 GTCTGACAGTGGGAAATGGGTGG + Intronic
1134847387 16:17451413-17451435 GTGAGTCAGGGAGAAGGGGAGGG - Intronic
1135488560 16:22887227-22887249 TGAAGACAGTGGGAAATGGAAGG - Intronic
1136232325 16:28894035-28894057 GTGAGTAGGAGGGAAATGGTGGG + Intronic
1136401016 16:30018735-30018757 GTGAGTCACTGGCATATAGATGG + Intronic
1136450368 16:30351298-30351320 GTGCGTGCGTGGTAAATGGATGG - Exonic
1137365965 16:47859674-47859696 TTGAGTCAGTGGGCTAGGGAAGG + Intergenic
1137838948 16:51622030-51622052 GTGATTCATTGGGAGAGGGAAGG + Intergenic
1138138514 16:54545841-54545863 AAGTGTCAGTGGGAAATGAAAGG - Intergenic
1138368287 16:56501510-56501532 GTGACTGAGTAGGAAATGGGTGG - Intronic
1138741594 16:59317248-59317270 GTGACTCAGGGGGAAAGGGTGGG + Intergenic
1138879665 16:60995814-60995836 GTGACTCAGTGGGAGTGGGATGG - Intergenic
1139822384 16:69730790-69730812 TTGAGTCAGTGGGACTGGGAAGG + Intergenic
1140282076 16:73564202-73564224 CTGAGTTTGTGGGAAATAGACGG + Intergenic
1140506336 16:75475731-75475753 GGGAGTCAGGGGAGAATGGATGG + Exonic
1140896503 16:79329273-79329295 GTGAGTGACTGAGAAATGGATGG + Intergenic
1141300481 16:82810869-82810891 GTGAGTCAGGGGGAAATGGGGGG + Intronic
1142152274 16:88517842-88517864 GTGGGTGAGTGGGTAAAGGAGGG + Intronic
1142614803 17:1127983-1128005 GAGATTCAGAGGGAAAGGGAGGG - Intronic
1143530999 17:7503362-7503384 CTGAGAGAGGGGGAAATGGAGGG - Intronic
1144708437 17:17384987-17385009 GTGCTAAAGTGGGAAATGGACGG - Intergenic
1145103806 17:20098356-20098378 GGGAGGCAGTGGGAATTGGTTGG - Intronic
1145752733 17:27367035-27367057 GTGGGTCACTGTGACATGGAAGG - Intergenic
1146492883 17:33294550-33294572 GTGGGTGAGTGGGAAATGAGGGG - Intronic
1146946235 17:36875620-36875642 GTGAGTCAGAGGGGAAGGGGAGG + Intergenic
1147791681 17:43017818-43017840 GTGAGTTAGTGGGCCAGGGATGG - Intronic
1148996994 17:51719385-51719407 TTGAGTCATTGGGGAATTGAAGG + Intronic
1152584221 17:81181905-81181927 GTGAGTCACTGGGCACTGGCCGG + Intergenic
1152814110 17:82397438-82397460 GTGAGGCAGTGGGGGGTGGATGG + Intronic
1152887650 17:82861749-82861771 GTGAGTCGGTGGGCATAGGATGG + Intronic
1154068777 18:11133509-11133531 TTGAGTCAGTGGGCTAGGGAAGG + Intronic
1156930157 18:42632098-42632120 TTAAGTCTGTGAGAAATGGAGGG + Intergenic
1157573218 18:48726859-48726881 GTGAGTCACTGGGAATGAGAGGG - Intronic
1158816445 18:61103323-61103345 CTGGGTCATTAGGAAATGGAAGG + Intergenic
1159238813 18:65713482-65713504 ATGAGTGAATGGGTAATGGATGG - Intergenic
1159716908 18:71835391-71835413 TTGAGTCAGTGGGCTAGGGATGG + Intergenic
1159850068 18:73516650-73516672 GTGAGTCAGTGGGCTGGGGAAGG + Intergenic
1160975452 19:1790349-1790371 GTGAGGGAGTGGGCAGTGGAGGG - Intronic
1162021404 19:7870030-7870052 GTGAGGCAGGGGGAGAGGGAGGG + Exonic
1162021600 19:7870660-7870682 GTGAGGCAGGGGGAGAGGGAGGG + Exonic
1162199434 19:9009982-9010004 GTGAGTGAGTCGGTGATGGAAGG + Intergenic
1162399087 19:10433824-10433846 GTGAGTCAGGTGGAAAAGCACGG + Intronic
1163626896 19:18395438-18395460 GTGTGTCATGGGGAAATGGGGGG + Intronic
1163785119 19:19270999-19271021 GTGAGTCAGTGGGAAGCTGTGGG - Intronic
1164898119 19:31895234-31895256 GAGATTCAGAGGTAAATGGATGG + Intergenic
1165573415 19:36794302-36794324 GGGAGTTGGGGGGAAATGGAGGG - Intergenic
1165699089 19:37923573-37923595 GTGAGTGAGTGGTGAGTGGATGG + Intronic
1165906579 19:39197995-39198017 GTGAGGCGGTGGAAGATGGAGGG + Intronic
1165951259 19:39474983-39475005 GTGAGTGAGTTCCAAATGGAGGG + Intronic
1166253982 19:41589482-41589504 GTGAGTCATTGAGACATTGAAGG - Intronic
1167210004 19:48128310-48128332 GGGAGTTGGTGGGAAGTGGACGG - Intronic
1167651884 19:50735909-50735931 GTGGGTCAGGGGGAATTGGTGGG - Intergenic
1168445458 19:56408115-56408137 TTAAATCAGTGGGAAAGGGATGG + Intronic
1168514151 19:56996645-56996667 GTGAGTCTTTGGGAGATGTATGG - Intergenic
925981023 2:9177553-9177575 CTGAAGCAATGGGAAATGGATGG + Intergenic
926397552 2:12459470-12459492 TTGAGCCATTGGTAAATGGATGG - Intergenic
926608224 2:14918816-14918838 GTGATCCAGTGGGAAATGCAGGG + Intergenic
928950132 2:36806889-36806911 GTCAGTCAGCTGAAAATGGATGG - Intronic
928950489 2:36809038-36809060 GTGGGCCAGTGGGACAAGGAAGG + Intronic
929216779 2:39422648-39422670 GTGATCCAATGGGAAAAGGACGG + Intronic
929521331 2:42654332-42654354 GTCAGTCACTGGGGAATGGTTGG + Intronic
929860326 2:45671566-45671588 GGGAGGCAGAGGGGAATGGAAGG - Intronic
929889891 2:45910307-45910329 AGGAGTAACTGGGAAATGGAAGG + Intronic
929901240 2:46005513-46005535 GTTAGTGAGTGGGAAGTGGGAGG + Intronic
930416747 2:51098701-51098723 CTGAGTCAGTAGGAAAGGGCAGG - Intergenic
930819349 2:55629847-55629869 GGGAGTGAGTGGCAAGTGGAGGG - Intergenic
931333320 2:61311875-61311897 CTGAGACAGTGGCAAATTGAAGG - Exonic
931824921 2:65990496-65990518 GGGAGGCAGGGGGATATGGATGG - Intergenic
931985508 2:67738116-67738138 GTGGGTCAGTGGGAATGGGGTGG - Intergenic
932348123 2:71008902-71008924 GTGTGTCAGTGTGTGATGGAGGG - Intergenic
932516098 2:72351078-72351100 GTGAGTCAGAGGGGAAGGGCAGG + Intronic
932705438 2:74020934-74020956 ATGAGTGAGTGGGAAGGGGAGGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934744243 2:96748453-96748475 GTTACCCAGTGGGAAAGGGAAGG + Intergenic
934861858 2:97770652-97770674 GTAAGTCAGTGGAACAGGGATGG + Intronic
935483939 2:103629515-103629537 GTAACCCAGCGGGAAATGGAGGG + Intergenic
935672856 2:105570581-105570603 GGGACTCAGTGGGAAAGGCATGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936523023 2:113223881-113223903 GTGAAAAAGTGGTAAATGGATGG + Intronic
936780885 2:116030764-116030786 GGGAGGCAGGGGGAAAAGGAAGG - Intergenic
937533368 2:122856878-122856900 ATGAGTCAGTAGGGTATGGATGG - Intergenic
937963450 2:127482137-127482159 GTGATTCAGTAGTAAATGTATGG - Intronic
938111017 2:128565042-128565064 GTGACTCAGCTGGAAATGGGAGG + Intergenic
939032144 2:137089648-137089670 GGGACTCAGTGGGAAAGGGTGGG + Intronic
939735869 2:145844014-145844036 ATGATTCAGTTGGAATTGGAAGG - Intergenic
940541459 2:155025299-155025321 CTTACTCAGTGGGAAAAGGAAGG - Intergenic
940552221 2:155174156-155174178 GGGACTCAGTGGGAAAAGGTGGG - Intergenic
941636764 2:167943333-167943355 TTGAGTCAGTGGGCTAGGGAAGG - Intergenic
942222652 2:173786304-173786326 ACGAGTCAGTGGGAACAGGATGG + Intergenic
942770075 2:179506314-179506336 GTGAGACAGTGGCAACTGTAAGG + Intronic
942929406 2:181471692-181471714 GTGTGTAAGTGGGAAATTGGTGG - Intronic
943244500 2:185429072-185429094 GTGAGTCAGTGGGCTGGGGAAGG + Intergenic
943561090 2:189463312-189463334 GTGAGTTAGTGGAAAATCTAGGG - Intronic
943581246 2:189685745-189685767 GTGAGTCAGGGGCCAAAGGAGGG + Intronic
944516076 2:200512929-200512951 GAGAGTGAATGGGAGATGGAAGG + Intronic
944700291 2:202239885-202239907 GTGAGTATGTTGGAAATGTAGGG - Intergenic
946616249 2:221514049-221514071 CTGAGTCCGTGGGAAAGGGTGGG - Intronic
946643870 2:221813318-221813340 GTGAGCCAGTGCAAAAGGGATGG + Intergenic
947824649 2:233097101-233097123 GTGAATCAATGGGAAAAGGATGG - Intronic
948486167 2:238282641-238282663 GTCAGTCAGTGGGAAACTGCTGG - Intronic
948625465 2:239265564-239265586 GAGAGTCAGGGGCAAAGGGAGGG - Intronic
1169303366 20:4466078-4466100 GTGAGGCAGTGAGACAGGGATGG - Intergenic
1169457799 20:5767744-5767766 ATGAGTCAGAGAGTAATGGAGGG + Intronic
1170156139 20:13271358-13271380 ATGAAGCAGTGGGAAATGGGAGG + Intronic
1170399087 20:15960565-15960587 GTGAGGAAGTGGGACAGGGAAGG + Intronic
1170615425 20:17945281-17945303 TTGAGTCAGTGGGTAAGGGCTGG - Intronic
1170714596 20:18820745-18820767 GTGGGGCAGTGGGACAGGGAGGG + Intronic
1170949239 20:20921134-20921156 TTGGGCCAGTGGGATATGGATGG + Intergenic
1170990626 20:21298779-21298801 GTGAGTGAGTGAGAAATGCCAGG - Intergenic
1171132157 20:22663760-22663782 GTGAAGCAGTGGGTAATGGGTGG + Intergenic
1171304770 20:24095822-24095844 CAGAGCCAGTGGGAAAGGGAGGG - Intergenic
1171528218 20:25832786-25832808 GGGAGTTGGGGGGAAATGGAGGG - Intronic
1171548608 20:26023092-26023114 GGGAGTTGGGGGGAAATGGAGGG + Intergenic
1172185740 20:33030011-33030033 TTGAGTCAGTGATAGATGGATGG + Intergenic
1172423924 20:34842254-34842276 GTGAGACAGAGGGGAAGGGAAGG + Intergenic
1172975778 20:38904751-38904773 GAGAGTCAGTGGGACAAAGAAGG - Intronic
1173186259 20:40842817-40842839 GTGAGTGAGTGAGTAAAGGAAGG - Intergenic
1173615736 20:44401741-44401763 GTGAGGCAGTGAGGACTGGAAGG - Intronic
1175050098 20:56147304-56147326 GTGAGTCTGTTGGAAGTGGGAGG - Intergenic
1175719867 20:61279505-61279527 GGGTGACTGTGGGAAATGGAAGG - Intronic
1175875896 20:62229368-62229390 GTGAGTGTGTGGGGAATGGGGGG - Intergenic
1176265166 20:64205440-64205462 ATGAGTCTGTGGGGAAGGGAGGG + Intronic
1177003080 21:15637176-15637198 TTGAGTCAGTGGGCTGTGGAAGG - Intergenic
1177658115 21:24046148-24046170 ATGAGTCAGTGGGAACTGGCTGG - Intergenic
1178984356 21:37290235-37290257 GAGAGTCAGGAGGAAATGGTTGG + Intergenic
1179637880 21:42725174-42725196 GGGATCCAGTGGGGAATGGAAGG - Intronic
1181990377 22:26832491-26832513 GTGGGTCGGAGGGAAATGGGTGG - Intergenic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1183015617 22:34984066-34984088 GGGTGTCAGTGGGAAGGGGAGGG - Intergenic
1183040332 22:35173010-35173032 GTGAGGTAGTGGGAGAGGGATGG + Intergenic
1183387330 22:37522434-37522456 GTGGGGCAGTGGGAAGTGGGAGG - Intergenic
1183445038 22:37848030-37848052 GTGCCTCAGTGGGAAAAGCAAGG + Intronic
1184299786 22:43550881-43550903 GTGCATGAGTTGGAAATGGATGG - Intronic
1184390832 22:44202210-44202232 GTGAGTCTCTGGGAGATGGAGGG + Intronic
949826223 3:8168543-8168565 GTGATTCAGAGGGACATGGCTGG - Intergenic
950577335 3:13840122-13840144 TTGAGTCAGAGGGAATTGCAAGG - Intronic
950750415 3:15123837-15123859 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
952729227 3:36621299-36621321 GTGAGTCAGTACCAAATGGCTGG + Intergenic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953463176 3:43097494-43097516 GTGAGCAAGGGGGAAAGGGAGGG + Intronic
953685462 3:45074734-45074756 GGGAGCCATTGGGACATGGATGG + Intergenic
954553329 3:51499854-51499876 GACGGTGAGTGGGAAATGGAGGG - Exonic
954621398 3:51997951-51997973 GTTAGGCAGTGGGAAAATGAAGG - Intergenic
955931017 3:64056971-64056993 GTGACTAAGAGGGAAATGGCTGG - Intergenic
956306677 3:67834049-67834071 TTGAGTCAGTGGGCTAGGGAAGG + Intergenic
956843503 3:73161074-73161096 CTGGGTCTATGGGAAATGGAGGG + Intergenic
957072082 3:75575363-75575385 GTGCATAAGTGGGAAATGGTGGG - Intergenic
957683738 3:83473292-83473314 TTGAGTCAGTGGGCTAGGGAAGG + Intergenic
958795333 3:98701187-98701209 GGGGGTGGGTGGGAAATGGAGGG - Intergenic
961163481 3:124748927-124748949 GACAGTCAGTGGGAAGTGGACGG + Intergenic
961282058 3:125771722-125771744 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
961511830 3:127408156-127408178 GTGGGGCAGTGAGAAATGGTTGG + Intergenic
962567565 3:136678408-136678430 CCAAGTCAGTGGGAAATAGATGG + Intronic
963630612 3:147725688-147725710 TTGAGTCAGTGGGATGGGGAAGG + Intergenic
967271361 3:187736209-187736231 GTGAGTGAGTGGGGACTGGAGGG + Intronic
967979234 3:195055572-195055594 GAGAGGCAGTGGGTCATGGAGGG - Intergenic
968544765 4:1193248-1193270 GAGACTCAGTGGGCACTGGAGGG + Intronic
969015674 4:4102685-4102707 GTGCATAAGTGGGAAATGGTGGG - Intergenic
969332206 4:6481412-6481434 TTAAATCAGTGGGAAAAGGATGG - Intronic
969364646 4:6687148-6687170 GGGAGTCAGGGGGATGTGGATGG - Intergenic
969599339 4:8166766-8166788 GTGAATGGGTGGGAGATGGATGG - Intergenic
969738290 4:9005677-9005699 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
969797470 4:9537216-9537238 GTGAGTAAGTGGGAAATGGCGGG + Intergenic
971821214 4:31557606-31557628 GTGACTCAGCAGAAAATGGATGG - Intergenic
971995033 4:33954794-33954816 GTGAGGCAGTGGGTCAAGGATGG + Intergenic
972831677 4:42820998-42821020 TTGAGTCAGTGGGCTGTGGAAGG - Intergenic
972874553 4:43342675-43342697 GTGAGTCAGTGGTGAAAGGCAGG + Intergenic
973070736 4:45855686-45855708 GTGAGTTAGTGTGATTTGGAGGG + Intergenic
973585579 4:52387529-52387551 TTGAGTCAGTGGGACAAGAAGGG - Intergenic
974795036 4:66738048-66738070 GTGAAGAAGTGGGACATGGAAGG + Intergenic
975178826 4:71319803-71319825 CTGAGTCAGAGGGAGAAGGAGGG + Intronic
978740566 4:112132994-112133016 GGTAGAAAGTGGGAAATGGATGG + Intergenic
979921204 4:126498718-126498740 GTGGGTCAGGGGGAAGGGGAGGG + Intergenic
979981335 4:127258913-127258935 GTGAGTAAGGGGATAATGGAAGG - Intergenic
980139942 4:128902619-128902641 GTGAGTGAGTGGAGAATGAATGG + Intronic
982979172 4:162109129-162109151 GGGAATCAGTGGGAAAAGGAAGG + Intronic
982983489 4:162172222-162172244 GGGATTCAGGGGGAAATGGTGGG - Intergenic
985271162 4:188196566-188196588 GTGAGTGGGTAGGAACTGGAGGG - Intergenic
986055731 5:4135312-4135334 GTCAGAGGGTGGGAAATGGAAGG + Intergenic
986362699 5:6996513-6996535 GGGACTCAGGGGGAAATGGTAGG - Intergenic
987320552 5:16765205-16765227 CTGAGTCAGTGGGCTAGGGAAGG + Intronic
987372126 5:17202979-17203001 GTGAAGCAGTGGGAATTGGAGGG + Intronic
987528867 5:19089103-19089125 GTGAGTCACTGGGATATAGAAGG + Intergenic
988664964 5:33316362-33316384 GTGATTGAGTGGGAAGAGGATGG + Intergenic
988780249 5:34514387-34514409 GTGAGGCACTGGGAAATAAAAGG - Intergenic
989144010 5:38230057-38230079 GTGGGAGAGTGGGAAAGGGAGGG - Intergenic
989486783 5:41999835-41999857 TTGAGTCAGTGGGATGGGGAAGG - Intergenic
989724287 5:44569592-44569614 GTGAGGCAGTGGGAGATGAGAGG + Intergenic
990059609 5:51630896-51630918 GTGAGTCAGGGGGAAGGGGAGGG + Intergenic
990970860 5:61504346-61504368 GCCAGCCAGTGGGAAATGCATGG + Intronic
991138912 5:63216124-63216146 TTAAGTCAGAGGGAAATAGATGG - Intergenic
991420653 5:66437944-66437966 GTGAGTCAGTGAGTAATGGCAGG + Intergenic
992746474 5:79825826-79825848 GTGGGTTAGAGGGAAAGGGAAGG + Intergenic
993377140 5:87161841-87161863 TTGAATCATTGGGAAAAGGATGG + Intergenic
993733435 5:91448451-91448473 GGGACTCAGAGGGAAAGGGAGGG + Intergenic
994061870 5:95487019-95487041 GTGAGTCAGTGGGCTGAGGAAGG + Intronic
995154443 5:108894026-108894048 GTGATTCATTTGGAGATGGAAGG - Intronic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
996537431 5:124593134-124593156 CTGAGTCTGTGGGAAATAGCTGG + Intergenic
996600869 5:125262042-125262064 GCTAATCAGTGGGAAATAGAGGG + Intergenic
996753161 5:126909636-126909658 GTGAGGCATTGGGAAGTGCAAGG - Intronic
996825102 5:127674088-127674110 TTGAGTCAGTGGGCTAGGGAAGG + Intergenic
998515581 5:142750847-142750869 CTGAGTCACTGGGGAAGGGATGG - Intergenic
998704573 5:144743940-144743962 GTGGGTGAGGGGGAAAGGGAAGG - Intergenic
998959739 5:147472158-147472180 GTGAGGCAGTGTGTAATGGATGG - Intronic
999758867 5:154684903-154684925 GTTAGGGAGTGGGATATGGAAGG + Intergenic
1000042362 5:157494238-157494260 GTGAGTGGGTGGTAGATGGATGG + Intronic
1000329828 5:160197781-160197803 GAGAGGCAGTGGGAGCTGGAAGG + Intronic
1000394320 5:160757672-160757694 GAGAGTCAGTGTGGTATGGATGG + Intronic
1001269716 5:170302183-170302205 GTGGGTCAGATGGAAAGGGAGGG - Intergenic
1001571497 5:172733276-172733298 GTGAGTCACTGAGAAATGCCCGG + Intergenic
1001926713 5:175642403-175642425 GCAAGTCAGTGGGGAAAGGAGGG + Intergenic
1001956235 5:175849953-175849975 CTGATTCAGTGGGAAACAGATGG - Intronic
1003299119 6:4860919-4860941 TTGAGTCAGTGGGCTAGGGAAGG - Intronic
1003471071 6:6433578-6433600 GGGAGTTACTGAGAAATGGAAGG + Intergenic
1003776704 6:9374498-9374520 GCAAGTCAGTGAGAAATGGATGG + Intergenic
1005582446 6:27247865-27247887 GGGAGGCTGTGGGACATGGAGGG - Exonic
1006199484 6:32275023-32275045 GGGACTCAGTGGGAAAGGGTGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1007331461 6:41113238-41113260 TTGAGTCAGTGGGCTAGGGAAGG - Intergenic
1007684569 6:43657749-43657771 CTGAGGCACAGGGAAATGGAGGG - Intronic
1008373052 6:50758401-50758423 GTGGGACATTGGGAAATGGAAGG - Intronic
1009356462 6:62753013-62753035 ATGAGTCAGGGAGAAATGCATGG + Intergenic
1009908509 6:69897232-69897254 TTGATTCAGTGGGAAATGGATGG - Intronic
1010083225 6:71887232-71887254 GGGAGTGAGTGGTGAATGGACGG - Intronic
1011913093 6:92466682-92466704 GGGAGCCAGGGGGAAAGGGAGGG + Intergenic
1012187936 6:96244582-96244604 GAAAGTCAGTGGGGAAAGGATGG + Intergenic
1012986491 6:105881779-105881801 GTGAGTTAGTGGCAAAAGCAGGG - Intergenic
1013508953 6:110827220-110827242 GCCATTCAGTGGGAATTGGAGGG + Intronic
1015979740 6:138826867-138826889 GTGAGACAGTGGGGGATGGGTGG - Intronic
1016948793 6:149560544-149560566 GTGAGTGAGGGGGAAAGGGAAGG + Intergenic
1017173823 6:151483156-151483178 TTGAGTCAGTGGGCTAGGGAAGG - Intergenic
1017225907 6:152021125-152021147 TTGAGTCAGTGGGCTGTGGAAGG + Intronic
1018298623 6:162376753-162376775 GAGAGTGAGAGGGAAAGGGAGGG + Intronic
1018630554 6:165818226-165818248 GGGAGTCAGTGGGGAAAGGCGGG - Intronic
1018930817 6:168239331-168239353 GAGAGTCACTGGGAAAGGAAGGG + Intergenic
1019202304 6:170327937-170327959 GTGAGCGAGTGGGAAGTGAATGG + Intronic
1019486962 7:1293743-1293765 CTGAGTGAGTGGGGAAGGGAGGG + Intergenic
1019635142 7:2071511-2071533 GTCAGTCATTGGCACATGGAAGG - Intronic
1020575810 7:9925918-9925940 CAGAGACTGTGGGAAATGGAAGG - Intergenic
1022656749 7:32326309-32326331 GGGAGTCACTGGCATATGGATGG + Intergenic
1022828718 7:34043423-34043445 GCTAGCCAATGGGAAATGGATGG - Intronic
1025155646 7:56603729-56603751 GTGAGTATGTTGGAAATGTAGGG - Intergenic
1025297432 7:57787121-57787143 GGGAGTTGGGGGGAAATGGAGGG + Intergenic
1026171759 7:67960103-67960125 GTGAGTCAGGGGAATATGCAGGG + Intergenic
1026833054 7:73621884-73621906 GGGAGATAGAGGGAAATGGAGGG - Intronic
1027585554 7:80054230-80054252 GGGAGACTGTGGGAAATGGTAGG - Intergenic
1028487700 7:91378058-91378080 GTGATGCAGTGGGAACTGAAAGG + Intergenic
1028839519 7:95412840-95412862 TTGAATCAGTGGGAGAAGGATGG - Intronic
1029074340 7:97924318-97924340 GTGCATAAGTGGGAAATGGTGGG - Intergenic
1029956606 7:104646906-104646928 GTGAGTACTTGGGACATGGAAGG - Intronic
1030122707 7:106125766-106125788 GTGAAGCAGTGGAAAATGGATGG + Intergenic
1030276997 7:107732402-107732424 TTGAGTCAGTGGGCTGTGGAAGG + Intergenic
1030831887 7:114234090-114234112 GTGAGACAGTGGGCAAGAGAGGG - Intronic
1031765010 7:125767071-125767093 GTGAGACAGTAGAAGATGGAGGG + Intergenic
1031834779 7:126669167-126669189 GGGAGTCAGGGGCAAAAGGAAGG + Intronic
1032449332 7:132016083-132016105 GGGACTCAGAGGGAAATGGTAGG + Intergenic
1032763391 7:134966262-134966284 ATGAGAAAGTGGGAAAGGGAAGG - Intronic
1033616323 7:143018124-143018146 GTGAGTCAGTGAGAAATGATAGG + Intergenic
1036206070 8:6806419-6806441 GCGAGTCTGGTGGAAATGGAGGG + Intergenic
1036243365 8:7096972-7096994 GTGTGTAAGTGGGAAATGGTGGG + Intergenic
1036257447 8:7217097-7217119 GTGAGTAAGTGGGAAATGGTAGG - Intergenic
1036309493 8:7675693-7675715 GTGAGTAAGTGGGAAATGGTAGG - Intergenic
1036360044 8:8070426-8070448 GTGAGTAAGTGGGAAATGGTAGG + Intergenic
1036489410 8:9211189-9211211 GTGAGGCAGAGGGAGATGAATGG + Intergenic
1036829363 8:12010220-12010242 GTGCATAAGTGGGAAATGGTGGG - Intergenic
1036890920 8:12596542-12596564 GTGCGTAAGTGGGAAATGGTAGG - Intergenic
1036898465 8:12654458-12654480 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1036956516 8:13193526-13193548 CTGAGTTAGTAGGAAATGGTGGG - Intronic
1038027481 8:23605045-23605067 GGGACTCAGGGGGAAATGGTAGG + Intergenic
1038526563 8:28279183-28279205 TTGAGTCAGTGGGCTAAGGAAGG + Intergenic
1038838093 8:31151044-31151066 GTGAGGCAGTGGGAGGTAGAGGG + Intronic
1040292725 8:46133642-46133664 GGGACTCAGTGGGAAGTCGAGGG - Intergenic
1040337405 8:46423067-46423089 GGGACTCAGTGGGACATTGAGGG + Intergenic
1042000755 8:64121538-64121560 TTGAGTCAGTGGGTTAAGGAGGG - Intergenic
1042788809 8:72580656-72580678 TAGATTTAGTGGGAAATGGAAGG - Intronic
1042943900 8:74136001-74136023 GTGAGACACTGGGATATGGCTGG - Intergenic
1045187619 8:99854973-99854995 GGGACTCAGTGGGAAAAGTAAGG + Intronic
1045289853 8:100823722-100823744 GTGTCTCAGTGGAAAATAGATGG - Intergenic
1045576430 8:103426074-103426096 GTGAAGCAGTGGAAAATGGATGG + Exonic
1047320436 8:123775316-123775338 GTGAGCCAGTGGGAATGGGATGG + Intronic
1049134626 8:140884916-140884938 ATGAGTCAGTAGGGAATGGTTGG - Intronic
1052442341 9:28512964-28512986 TTGAGTCAGTGGGCTGTGGAAGG - Intronic
1053157463 9:35791317-35791339 GTGTGTGAGATGGAAATGGAAGG + Intergenic
1053603984 9:39638375-39638397 GGAAGTCAGTGGCATATGGATGG + Intergenic
1053796179 9:41728914-41728936 GGGAGTTGGGGGGAAATGGAGGG - Intergenic
1053861796 9:42394423-42394445 GGAAGTCAGTGGCATATGGATGG + Intergenic
1054149002 9:61585957-61585979 GGGAGTTGGGGGGAAATGGAGGG + Intergenic
1054184584 9:61940984-61941006 GGGAGTTGGGGGGAAATGGAGGG - Intergenic
1054249556 9:62704039-62704061 GGAAGTCAGTGGCATATGGATGG - Intergenic
1054468768 9:65517067-65517089 GGGAGTTGGGGGGAAATGGAGGG + Intergenic
1054563667 9:66738571-66738593 GGAAGTCAGTGGCATATGGATGG - Intergenic
1054653923 9:67647513-67647535 GGGAGTTGGGGGGAAATGGAGGG + Intergenic
1054716197 9:68559894-68559916 GTGAGCCAGTGGCCAATGGGTGG - Intergenic
1056217666 9:84420199-84420221 GTGAGGCAGTGGTAAAGGGGTGG + Intergenic
1056663393 9:88561114-88561136 TTGAGTCAGTGGGCTAGGGAAGG + Intronic
1057810697 9:98254936-98254958 CTGAGTCAGAGGGAGATGAAAGG - Intronic
1058122930 9:101158512-101158534 GTGGGACAGTGAGAAAGGGAAGG + Intronic
1059196198 9:112373459-112373481 TTGAGTCAGTGGGCTAGGGAAGG - Intergenic
1060495817 9:124117997-124118019 GGGAGTCAGTGGGATCAGGAGGG + Intergenic
1186303386 X:8226695-8226717 GGGATTCAGGGGGAAATGGTGGG - Intergenic
1186962348 X:14750195-14750217 TTTAGGCAGGGGGAAATGGAGGG + Intergenic
1188406101 X:29811519-29811541 TTGAGTCAGTGGGCTAGGGAAGG - Intronic
1189289920 X:39877808-39877830 GTGAAAGAGTGGGAAAGGGAGGG - Intergenic
1189473662 X:41333342-41333364 GGGAGTCGGGGGGAAATGGAGGG - Intronic
1192231374 X:69267450-69267472 GTGAGGCAGTGAGGGATGGAGGG + Intergenic
1192283645 X:69710527-69710549 GAGAGTCATTGGTAAATTGATGG + Intronic
1195363558 X:104107054-104107076 ATGAGACTGTGGGATATGGATGG - Intronic
1195431480 X:104794457-104794479 GTGAGTTAGTGGTAGATGTAGGG - Intronic
1195578998 X:106480556-106480578 GGGAGCAAGTGGGAGATGGATGG - Intergenic
1196218341 X:113081851-113081873 GGGACTCAGTGGGAAAGGGTGGG - Intergenic
1196268108 X:113676912-113676934 GGGACTCAGAGGGAAAGGGAAGG - Intergenic
1196471602 X:116035214-116035236 GAGACTCAGGGGGAAATGGTGGG + Intergenic
1197380376 X:125731151-125731173 GTGAGTCACTGGGCTGTGGAAGG - Intergenic
1198329171 X:135605866-135605888 GAGAGCCAGGAGGAAATGGACGG - Intergenic
1198337374 X:135679713-135679735 GAGAGCCAGGAGGAAATGGATGG + Intergenic
1198361820 X:135903101-135903123 GAGAGCCAGGAGGAAATGGATGG - Intronic
1198691909 X:139293693-139293715 GTGAGCCTCTGGCAAATGGAGGG + Intergenic
1199084667 X:143615119-143615141 TTGAGTCAGAGGGACATGGCAGG + Intergenic
1199685549 X:150262036-150262058 GTCTTTCAGTGGGAAAGGGATGG + Intergenic
1199936107 X:152575153-152575175 GTGAGCCAGTGGGAGATAGGAGG - Intergenic
1200916203 Y:8573382-8573404 GGGTGTCAGTGGAAGATGGATGG - Intergenic
1201342604 Y:12950956-12950978 TTGAGACAGTGAGAAATGGCTGG + Intergenic