ID: 1113445042

View in Genome Browser
Species Human (GRCh38)
Location 13:110359430-110359452
Sequence TGGACTCATGTATCTACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113445038_1113445042 -7 Left 1113445038 13:110359414-110359436 CCTTGCCTTTATTCCCTGGACTC 0: 1
1: 0
2: 1
3: 23
4: 377
Right 1113445042 13:110359430-110359452 TGGACTCATGTATCTACCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 67
1113445037_1113445042 -4 Left 1113445037 13:110359411-110359433 CCTCCTTGCCTTTATTCCCTGGA 0: 1
1: 0
2: 0
3: 24
4: 264
Right 1113445042 13:110359430-110359452 TGGACTCATGTATCTACCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113445042 Original CRISPR TGGACTCATGTATCTACCCT AGG Intronic
900905331 1:5552957-5552979 TGGCCCCATGTACCTGCCCTGGG - Intergenic
909793752 1:79706192-79706214 TGGACTCTTGAACCTACCCAGGG + Intergenic
911491701 1:98577604-98577626 GGGACACATGTAGCTACACTTGG - Intergenic
916119353 1:161513721-161513743 TGGCCTCATGTACCCACCCTTGG - Intronic
916129115 1:161595379-161595401 TGGCCTCATGTACCCACCCTTGG - Intronic
921304259 1:213780241-213780263 TGGACTTATATACCTACCCGGGG - Intergenic
922532373 1:226354149-226354171 TGAACTCATGTTTCTGCCCAGGG - Intergenic
923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG + Intronic
923959379 1:239059361-239059383 TGGACTCAGGGATCTCCCCACGG + Intergenic
1063790318 10:9437498-9437520 TGGACACATTTATCTCTCCTTGG - Intergenic
1079428063 11:20363041-20363063 GGGACACAGGTATCTACACTGGG - Intergenic
1081320749 11:41689108-41689130 TGATCCCATGTATCTACCCTGGG - Intergenic
1095661086 12:44737580-44737602 TGGACTTATGTATTTACCATGGG - Intronic
1105544655 13:21342677-21342699 TGGGCTCATCTATCTGCCCAGGG - Intergenic
1110794091 13:79617603-79617625 TGGGATCATGTGTCTATCCTTGG + Intergenic
1113445042 13:110359430-110359452 TGGACTCATGTATCTACCCTAGG + Intronic
1114625080 14:24123632-24123654 TGGCCTCAGGCATCTACTCTAGG - Exonic
1122016285 14:98799539-98799561 TTGACACATGTATCTGTCCTGGG - Intergenic
1143580478 17:7822691-7822713 TGGACAAATATATCTGCCCTTGG - Intronic
1152943899 17:83188252-83188274 TGGGCTCATGGCTCCACCCTTGG - Intergenic
1160029114 18:75243201-75243223 TGGACTTTTGTATCACCCCTGGG + Intronic
925245923 2:2382851-2382873 TGGACTCTTGGATCTACACCAGG + Intergenic
941294314 2:163717042-163717064 TGTAATAATGTAGCTACCCTTGG + Intronic
943656368 2:190513016-190513038 TGGTCTCATGGTCCTACCCTAGG + Intronic
945170620 2:206990967-206990989 TGGACTCTTGTACCTAGCCCAGG - Intergenic
1170065614 20:12306834-12306856 TGGGCTCATGTAACTTCCTTTGG + Intergenic
1177389823 21:20453638-20453660 GGGAATCATGTATCTGCTCTAGG - Intergenic
1177843968 21:26267550-26267572 TTGATTTATGTATCTACTCTGGG + Intergenic
957955488 3:87180856-87180878 TGCACTGATATTTCTACCCTTGG + Intergenic
959440706 3:106371578-106371600 TGGATCAATATATCTACCCTGGG + Intergenic
966229028 3:177630550-177630572 TGACCTCAAGTATCCACCCTCGG - Intergenic
966329577 3:178795460-178795482 AGGACTCATGTGGTTACCCTGGG - Intronic
969101967 4:4776156-4776178 TGGATGCATGAATCCACCCTAGG + Intergenic
969334070 4:6496529-6496551 TGGAATCATGGATATTCCCTAGG + Intronic
970772753 4:19635191-19635213 TGGAATCATGTATTTATACTGGG - Intergenic
973336862 4:48965468-48965490 AGGACTGGTGTATCTACCCAAGG + Intergenic
976953479 4:90864413-90864435 TGGATTCATGTTGTTACCCTAGG + Intronic
979279215 4:118846300-118846322 TGAACTTATGTATGTACCCTTGG + Intergenic
992429060 5:76689952-76689974 TGGGCTCATTTATCTACAGTGGG + Intronic
994051888 5:95371256-95371278 TGGACTCTTGGATCTACACCAGG + Intergenic
999207828 5:149862820-149862842 TGGACATATGTCCCTACCCTGGG - Intronic
999380989 5:151121350-151121372 TGAACTAATGTACCTAACCTGGG + Intronic
1003316266 6:5014894-5014916 AGTACTCATGCATCTCCCCTAGG + Intergenic
1003406962 6:5833879-5833901 TGGGCTCATCTATCTTCCCAGGG + Intergenic
1008343414 6:50395433-50395455 TGGACTTATATATCTGGCCTTGG - Intergenic
1008677546 6:53836213-53836235 TGGACTCATGCATCTACATTTGG - Intronic
1010926696 6:81753182-81753204 TGGACTCATGAGTCCACACTTGG - Intergenic
1010967310 6:82226042-82226064 TGGAGTCATTTATCTGTCCTGGG + Intronic
1016021602 6:139241760-139241782 TGAATTCATTTATCTACCATTGG + Exonic
1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG + Intronic
1023648439 7:42343692-42343714 TTGACTCATCTATATCCCCTAGG - Intergenic
1023699317 7:42876775-42876797 TTGACTCATCTATCAACACTGGG - Intergenic
1030574455 7:111268533-111268555 TTAACTCATATCTCTACCCTGGG - Intronic
1032627435 7:133606956-133606978 TGTACTCATTTATAGACCCTAGG + Intronic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1033604018 7:142912223-142912245 TGGACTCAAGGATCAATCCTAGG + Intronic
1034596095 7:152193636-152193658 TGTACTCATTGATCTGCCCTCGG - Intronic
1037670921 8:21014764-21014786 TGGACTCATATATGTATCTTTGG - Intergenic
1039995154 8:42525911-42525933 TATACTCATGAATATACCCTGGG - Intronic
1043818127 8:84828967-84828989 TGGACTAATATAACTAACCTAGG - Intronic
1043983017 8:86662352-86662374 TTCACTTATTTATCTACCCTAGG - Intronic
1046263192 8:111797917-111797939 GGGACTTGTGTATCTACCTTTGG - Intergenic
1052579433 9:30335300-30335322 TGGACTCATATATCTTCTTTGGG + Intergenic
1057822470 9:98343074-98343096 TGGAATCATGGAACTACACTTGG - Intronic
1057995725 9:99820515-99820537 AGGAATCTTGTATCTCCCCTCGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1189649198 X:43171051-43171073 TGGACCAATGGCTCTACCCTTGG + Intergenic
1189992160 X:46605795-46605817 AGGACTGAAGTATCTACTCTGGG - Exonic
1194197351 X:90911418-90911440 TTTACTCATGTATTTACCTTTGG - Intergenic
1195499673 X:105580491-105580513 TTGACTCACTTATCAACCCTAGG + Intronic
1195589447 X:106607441-106607463 TGAACTCCAGTGTCTACCCTGGG - Intergenic
1196605292 X:117650829-117650851 TGGACTCAAGTATGTTCCTTTGG - Intergenic
1196892327 X:120303186-120303208 TGGATTGTTTTATCTACCCTAGG - Intronic
1200544368 Y:4501375-4501397 TTTACTCATGTATTTACCTTTGG + Intergenic
1200591176 Y:5078351-5078373 TGGAATAATGTATATTCCCTTGG + Intronic