ID: 1113445233 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:110361006-110361028 |
Sequence | ACTTTATCAGTGAATGTTCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 241 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 221} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1113445233_1113445235 | 2 | Left | 1113445233 | 13:110361006-110361028 | CCCTGAACATTCACTGATAAAGT | 0: 1 1: 0 2: 1 3: 18 4: 221 |
||
Right | 1113445235 | 13:110361031-110361053 | TAGAAATAGCTGATGATAAAAGG | 0: 1 1: 0 2: 0 3: 31 4: 299 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1113445233 | Original CRISPR | ACTTTATCAGTGAATGTTCA GGG (reversed) | Intronic | ||