ID: 1113445233

View in Genome Browser
Species Human (GRCh38)
Location 13:110361006-110361028
Sequence ACTTTATCAGTGAATGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113445233_1113445235 2 Left 1113445233 13:110361006-110361028 CCCTGAACATTCACTGATAAAGT 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1113445235 13:110361031-110361053 TAGAAATAGCTGATGATAAAAGG 0: 1
1: 0
2: 0
3: 31
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113445233 Original CRISPR ACTTTATCAGTGAATGTTCA GGG (reversed) Intronic