ID: 1113445235

View in Genome Browser
Species Human (GRCh38)
Location 13:110361031-110361053
Sequence TAGAAATAGCTGATGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113445234_1113445235 1 Left 1113445234 13:110361007-110361029 CCTGAACATTCACTGATAAAGTG 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1113445235 13:110361031-110361053 TAGAAATAGCTGATGATAAAAGG 0: 1
1: 0
2: 0
3: 31
4: 299
1113445233_1113445235 2 Left 1113445233 13:110361006-110361028 CCCTGAACATTCACTGATAAAGT 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1113445235 13:110361031-110361053 TAGAAATAGCTGATGATAAAAGG 0: 1
1: 0
2: 0
3: 31
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113445235 Original CRISPR TAGAAATAGCTGATGATAAA AGG Intronic