ID: 1113445235 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:110361031-110361053 |
Sequence | TAGAAATAGCTGATGATAAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 331 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 31, 4: 299} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1113445234_1113445235 | 1 | Left | 1113445234 | 13:110361007-110361029 | CCTGAACATTCACTGATAAAGTG | 0: 1 1: 0 2: 1 3: 10 4: 142 |
||
Right | 1113445235 | 13:110361031-110361053 | TAGAAATAGCTGATGATAAAAGG | 0: 1 1: 0 2: 0 3: 31 4: 299 |
||||
1113445233_1113445235 | 2 | Left | 1113445233 | 13:110361006-110361028 | CCCTGAACATTCACTGATAAAGT | 0: 1 1: 0 2: 1 3: 18 4: 221 |
||
Right | 1113445235 | 13:110361031-110361053 | TAGAAATAGCTGATGATAAAAGG | 0: 1 1: 0 2: 0 3: 31 4: 299 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1113445235 | Original CRISPR | TAGAAATAGCTGATGATAAA AGG | Intronic | ||