ID: 1113447829

View in Genome Browser
Species Human (GRCh38)
Location 13:110384010-110384032
Sequence ACTGCTGTGCAGGCGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113447822_1113447829 27 Left 1113447822 13:110383960-110383982 CCACTGAGAGGTGAGCCATTGGC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1113447829 13:110384010-110384032 ACTGCTGTGCAGGCGGTAAATGG 0: 1
1: 0
2: 0
3: 7
4: 114
1113447823_1113447829 12 Left 1113447823 13:110383975-110383997 CCATTGGCAGATGATGTACAGAG 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1113447829 13:110384010-110384032 ACTGCTGTGCAGGCGGTAAATGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113447829 Original CRISPR ACTGCTGTGCAGGCGGTAAA TGG Intronic
900573817 1:3373224-3373246 GCTGCAGTGCCGGCGGGAAACGG + Intronic
904818523 1:33223525-33223547 AGTGCTATGAAGGAGGTAAATGG - Intergenic
916632014 1:166625964-166625986 GCTGTTCTACAGGCGGTAAAAGG - Intergenic
917236819 1:172901585-172901607 ACTGATGTGCAGGTGGCACATGG + Intergenic
922776290 1:228215592-228215614 AAGGCGGTGCAGGCGGTAGAGGG + Exonic
924694728 1:246387060-246387082 ACTGCTTTGCACACGGTAAAGGG + Intronic
1063217552 10:3938080-3938102 ACTTCTCTGCAGGCGCTAAGGGG + Intergenic
1067228817 10:44392725-44392747 ACTGGTGTGGAGGGGGTGAAGGG - Intergenic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1070172114 10:73940780-73940802 CCTGCTGGGCTGGCGGTGAAAGG + Intergenic
1070385090 10:75917143-75917165 CCTGCTGTGCAGGCCATCAATGG + Intronic
1071290390 10:84184841-84184863 ACTGCTGTGAAGGCTGAAAGGGG - Exonic
1087627972 11:100618628-100618650 AGTCATTTGCAGGCGGTAAAAGG - Intergenic
1090652127 11:128816008-128816030 ACTGCTGTACAGGAGGTTTATGG + Intergenic
1092551404 12:9505519-9505541 ACTGCTTTGCAGGGGGGAAATGG + Intergenic
1092767801 12:11869339-11869361 GCGGCTCTACAGGCGGTAAATGG - Intronic
1092814073 12:12297664-12297686 ACTGCTATGAAGGGGGAAAAAGG + Intergenic
1093091963 12:14932012-14932034 ACCACTGTGCAGGTGGGAAAGGG + Intronic
1095751326 12:45714659-45714681 ACTGCTGTGCAAGTAGTAATAGG - Intergenic
1098261762 12:68678718-68678740 ACTGCTATGCAGTCATTAAAAGG - Intergenic
1106185290 13:27404518-27404540 ACTGATGTGCATGCGTTAGATGG - Intergenic
1107801849 13:44115870-44115892 ACTGCTGGGCAAGCAGTGAATGG + Intergenic
1113447829 13:110384010-110384032 ACTGCTGTGCAGGCGGTAAATGG + Intronic
1120252470 14:82075746-82075768 GGTGCTGAGCAGGAGGTAAATGG - Intergenic
1121641890 14:95490294-95490316 ACTGCTGTGCATGCCATAATCGG - Intergenic
1126669446 15:51102866-51102888 ACTGGTGTACAGGAGGTAAAAGG - Intronic
1128994581 15:72287335-72287357 ACTGCTATTCAGGCGATGAATGG - Exonic
1133287883 16:4698887-4698909 ACTGCTGTGCCAGCGGGCAATGG + Exonic
1133525399 16:6600301-6600323 AATGCTGGGCAGGAGGGAAATGG - Intronic
1134383970 16:13754833-13754855 AGTGTTGTTCAGGAGGTAAAAGG - Intergenic
1135973626 16:27090268-27090290 ACTGCTGGGCAGGAGGTCAGGGG - Intergenic
1139261759 16:65600740-65600762 CCTGCTGTTCAGGCAGTAAGTGG - Intergenic
1140496756 16:75396077-75396099 ACTGATGTGAAGGCTGAAAAAGG + Intronic
1141815736 16:86408223-86408245 ACTTCTGTGGAGGCAGTAACAGG - Intergenic
1142660285 17:1424429-1424451 TCTGCTGTGCAAGCAGTAACAGG - Intronic
1143128401 17:4659871-4659893 ACGGGTGTGTAGGAGGTAAAAGG - Intergenic
1144025869 17:11275225-11275247 GCTGCTGTGGAGGTGGCAAATGG + Intronic
1144421935 17:15106861-15106883 AGTGGTGTGCAGGCTGCAAAAGG - Intergenic
1146404865 17:32528315-32528337 ACTGCTTTGCAGGTGGGAGAGGG + Intronic
1147819555 17:43233634-43233656 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147820650 17:43239768-43239790 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147820859 17:43241027-43241049 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147821670 17:43245521-43245543 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147822762 17:43251676-43251698 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147826122 17:43271216-43271238 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147826403 17:43272948-43272970 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147827292 17:43277825-43277847 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147828400 17:43283986-43284008 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147829510 17:43290138-43290160 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147830600 17:43296272-43296294 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1147831286 17:43299888-43299910 CCTGATGTGCGGGCGGTAGACGG - Intergenic
1148131751 17:45266507-45266529 ACTGCTGAGCAGGTGGGAATTGG + Intronic
1151509242 17:74548114-74548136 ACTGCTGTGCAGGAGCTGAGGGG - Intergenic
1152910257 17:83000913-83000935 ACTGCTGTGCAGGCAGAAAGTGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155541292 18:26871018-26871040 ACAGCTCTGCAGGCTGTATAAGG - Intergenic
1157518997 18:48332197-48332219 ACTGATGTTCAGGGGGAAAAGGG - Intronic
1158487668 18:57882013-57882035 ACAGCTATGCAGGCAGTGAAGGG - Intergenic
1166648006 19:44547204-44547226 ACTGCTGTGCAAGCCGGAAAGGG + Intergenic
928145282 2:28768655-28768677 ACTGCTGTGCTGCTGCTAAAAGG + Intronic
929868656 2:45739456-45739478 AGTCCTCTGCAGGCTGTAAAAGG - Intronic
930185762 2:48410793-48410815 ACTCCTGAGGAGGGGGTAAAAGG + Intergenic
934720774 2:96574667-96574689 ACCGATGAGCAGGCGATAAATGG + Intergenic
935062392 2:99620018-99620040 ACTGCTGAGCAGGCAATCAATGG + Intronic
943890017 2:193275227-193275249 ACTGCTTTGCAGGTAGTGAAGGG + Intergenic
946846297 2:223861676-223861698 ATTGCTGGGCAGGCAATAAAAGG + Intronic
948567146 2:238894437-238894459 GCAGCTGTGCAGGCGGCAAGGGG - Intronic
1169238217 20:3950038-3950060 ACTGCAGTGCAGTGGGGAAAGGG - Intronic
1172013321 20:31858970-31858992 ACTGATGAGCAGTCGGTAAGTGG - Intronic
1172067483 20:32232028-32232050 AATGCTGTGCAGGCCTTAAGAGG + Intronic
1174299122 20:49568877-49568899 ACTACTGGGCAGGGGGTACAAGG + Intergenic
1177102616 21:16915765-16915787 ATTGCTGGGCAGGTGGGAAAGGG - Intergenic
1177349302 21:19914108-19914130 TCTGATGTGCAGGCAGAAAAAGG + Intergenic
1180724951 22:17939923-17939945 ACTTCTGTGCCTGCGGAAAAGGG - Intronic
1182005736 22:26957980-26958002 ACTGCATTGCAGACTGTAAATGG - Intergenic
949868786 3:8569587-8569609 ACTACTGTGCATGCTATAAAAGG + Intergenic
954294960 3:49669248-49669270 GCTGCAGGGCAGGCAGTAAAAGG + Exonic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
973307019 4:48663910-48663932 AGTGCTGTGAAGGCAGTGAAGGG + Intronic
976302895 4:83531915-83531937 AATTCTGTGCAGGTGGAAAAGGG + Intergenic
977841075 4:101705643-101705665 AATGCTGTGCAGTCATTAAAAGG - Intronic
977916271 4:102597633-102597655 ACTGCTGTGCAGGATGAGAATGG + Exonic
982428509 4:155295651-155295673 ACTGCTTTGGAGGGGGTCAATGG - Intergenic
987744494 5:21952303-21952325 ACTGCTTTGGAGGCTGCAAATGG + Intronic
988697080 5:33632962-33632984 ACTGCTATGCAGTCACTAAAAGG + Intronic
991764702 5:69962425-69962447 ACTGCTTTGGAGGCTGCAAATGG + Intergenic
991782622 5:70155728-70155750 ACTGCTTTGGAGGCTGCAAATGG - Intergenic
991843934 5:70837496-70837518 ACTGCTTTGGAGGCTGCAAATGG + Intergenic
991875065 5:71156042-71156064 ACTGCTTTGGAGGCTGCAAATGG - Intergenic
997379158 5:133423024-133423046 AGTGCTGTGCAGGCTCTGAACGG + Intronic
1003898815 6:10633890-10633912 ACAGATGTGCAGTCGGGAAAGGG - Intergenic
1012263063 6:97110750-97110772 ACAGCTTTGCAGGCGGGAACCGG + Intronic
1017572428 6:155760802-155760824 ACTGCTGAACAGGTGGCAAATGG + Intergenic
1021621894 7:22557089-22557111 ACTGCTGAGCAGGGTGTAAGAGG + Intronic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1028153813 7:87406870-87406892 ACTGCTGTGCATGGGGGAAGGGG - Intronic
1028895730 7:96039715-96039737 ACTGAGGTGCAGGCAGTGAAGGG - Intronic
1031056842 7:117001154-117001176 ACTGCTGTGCTGCCGATGAAGGG + Intronic
1031961677 7:127995716-127995738 ACTGCTGTGCAGGCAGCAACTGG - Intronic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1033498950 7:141928212-141928234 ACTTCTGTGCAGGTTCTAAAAGG - Exonic
1035328991 7:158084301-158084323 TCTGCTGTGCAGGTGGCAGATGG + Intronic
1035680426 8:1483614-1483636 ACTGCTGTGCAGGAGGCTCAGGG + Intergenic
1037372693 8:18196978-18197000 ACAGCTCTGCAGGCGTTAACGGG + Intronic
1039105718 8:33987206-33987228 CCTGCTGTCAAGGGGGTAAAGGG + Intergenic
1040871761 8:52107054-52107076 ACAGCTCTGCAGGCTGTACATGG + Intergenic
1047983023 8:130203315-130203337 ACGGCTGTGCAGGGTGTACATGG + Intronic
1049560048 8:143305614-143305636 ACTGCTGCCCAGGCGGAAAAGGG - Intronic
1051449775 9:17182340-17182362 TCTGCTGTGCATGAGGCAAAAGG + Intronic
1051767425 9:20540317-20540339 AGGGCAGTGCAGGAGGTAAATGG - Intronic
1053666081 9:40318524-40318546 ACAGTTCTGCAGGCTGTAAAGGG - Intronic
1053915663 9:42943570-42943592 ACGGTTCTGCAGGCTGTAAAGGG - Intergenic
1054377236 9:64458552-64458574 ACGGTTCTGCAGGCTGTAAAGGG - Intergenic
1054518529 9:66057759-66057781 ACGGTTCTGCAGGCTGTAAAGGG + Intergenic
1055084407 9:72299458-72299480 GCTGCAGTGCAGGCTGCAAAAGG + Intergenic
1059946084 9:119409744-119409766 GCTGCTTTGCAAGCTGTAAATGG - Intergenic
1060906936 9:127315038-127315060 ACTGCTGTGAAGGCAGCATAGGG + Intronic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1193506519 X:82350235-82350257 ACTGCTGTGATGGTGGTAACAGG - Intergenic
1195004196 X:100670482-100670504 ATTGCTGTGCAGGCTGCACAGGG - Intronic
1195624372 X:106992338-106992360 AATGCTGTGGAGGAGGGAAAGGG - Intronic
1196316165 X:114226811-114226833 ACAGCAGTGCAGGCTGTGAAAGG - Intergenic