ID: 1113448442

View in Genome Browser
Species Human (GRCh38)
Location 13:110388213-110388235
Sequence CTCGCTTGCCGCCGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113448442_1113448446 16 Left 1113448442 13:110388213-110388235 CCTCCAGGACGGCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1113448442_1113448450 26 Left 1113448442 13:110388213-110388235 CCTCCAGGACGGCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1113448450 13:110388262-110388284 AGCCGCAGCCAGGCAGCTGCCGG 0: 1
1: 0
2: 3
3: 47
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113448442 Original CRISPR CTCGCTTGCCGCCGTCCTGG AGG (reversed) Intronic
900181754 1:1314178-1314200 CCTGCTTGCTGCTGTCCTGGGGG - Intronic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900431561 1:2605371-2605393 ATTGCTTGCCACCATCCTGGGGG - Intronic
900760742 1:4468507-4468529 TTCACTTCCCGCAGTCCTGGAGG - Intergenic
903614772 1:24643613-24643635 CTCGCTGCCCGCCTGCCTGGCGG + Intronic
906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG + Intronic
1063889436 10:10614580-10614602 CTCTCTTGCCGAGTTCCTGGTGG - Intergenic
1072485351 10:95849451-95849473 CTCTCTTGCTGGGGTCCTGGAGG - Intronic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1092917675 12:13203106-13203128 CCAGCTTGCCGCCTTCCAGGAGG + Intronic
1096780291 12:53987749-53987771 CTCTCTTGCCTCTGGCCTGGTGG - Intronic
1105027161 12:132856945-132856967 CTCGCTTGCCCAGGTGCTGGTGG + Intronic
1105344735 13:19561673-19561695 CTCGCTTGCCGAAGTCCCTGGGG - Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG + Intergenic
1129226624 15:74174137-74174159 CTAGCTTGGAGCCGTCCAGGGGG + Intronic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG + Exonic
1142304692 16:89278721-89278743 CTCTCGTGAGGCCGTCCTGGTGG + Intronic
1143510973 17:7394773-7394795 CACGCACGCCGCCGGCCTGGCGG - Exonic
1148903372 17:50895314-50895336 TTCGCTTGCCTCCTTACTGGGGG + Intergenic
1150335484 17:64327516-64327538 CTCGCCTCCCCCCTTCCTGGAGG - Intronic
1151674079 17:75589053-75589075 CCCGCTGGCGGCCCTCCTGGTGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
925171664 2:1754029-1754051 CTCCCCTGCTGCCGTCGTGGGGG - Intergenic
932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG + Intronic
937876266 2:126827680-126827702 CTGGCTTCCCGCAGCCCTGGAGG + Intergenic
1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG + Intergenic
1175516169 20:59571692-59571714 CTCGCCTGCACCCGTCCTAGTGG + Intergenic
1178417036 21:32412577-32412599 CTCCGTTGCCGCCGTGCCGGAGG - Exonic
955325780 3:58008557-58008579 CTCGGTTACCGGCATCCTGGTGG - Exonic
956867542 3:73384537-73384559 CACTCTTGCCGGCGTCCAGGGGG + Exonic
964766228 3:160180714-160180736 CTTGCTTGCCAACGTCCTGTTGG - Intergenic
968703764 4:2068967-2068989 CTCGCTCGCCCCCACCCTGGGGG - Exonic
968962858 4:3753937-3753959 CCCGCCTGCCGCGGTCTTGGAGG - Intergenic
973532167 4:51844377-51844399 CTCGCTTCCCGCCGTCCGGGGGG - Intronic
985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG + Exonic
998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG + Intergenic
998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG + Exonic
1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG + Intronic
1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG + Intergenic
1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG + Intergenic
1018156723 6:160991979-160992001 CACGCCTGCCGCCGCCATGGAGG + Exonic
1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG + Intergenic
1019751037 7:2729942-2729964 CTCGGATGCCGCTGTCCTGGGGG - Exonic
1020071213 7:5228170-5228192 CACACTCGCCGCCCTCCTGGGGG - Exonic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1032011700 7:128351654-128351676 CTCGCGTGCCGCCGCGCTGCTGG - Exonic
1036442939 8:8797420-8797442 CTCGCTCGCTGCCGTTCTTGGGG + Exonic
1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG + Exonic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1057224147 9:93278490-93278512 GGCGCTTGCCTCAGTCCTGGAGG + Intronic
1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG + Exonic
1062007828 9:134250300-134250322 CTCGTTTCCCGCAGTCCTGGAGG - Intergenic