ID: 1113448442

View in Genome Browser
Species Human (GRCh38)
Location 13:110388213-110388235
Sequence CTCGCTTGCCGCCGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113448442_1113448450 26 Left 1113448442 13:110388213-110388235 CCTCCAGGACGGCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1113448450 13:110388262-110388284 AGCCGCAGCCAGGCAGCTGCCGG 0: 1
1: 0
2: 3
3: 47
4: 369
1113448442_1113448446 16 Left 1113448442 13:110388213-110388235 CCTCCAGGACGGCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113448442 Original CRISPR CTCGCTTGCCGCCGTCCTGG AGG (reversed) Intronic