ID: 1113448446

View in Genome Browser
Species Human (GRCh38)
Location 13:110388252-110388274
Sequence GCATTTCCCCAGCCGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113448442_1113448446 16 Left 1113448442 13:110388213-110388235 CCTCCAGGACGGCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1113448444_1113448446 -7 Left 1113448444 13:110388236-110388258 CCCTCAAGCGCAGTCTGCATTTC 0: 1
1: 0
2: 2
3: 14
4: 211
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1113448441_1113448446 17 Left 1113448441 13:110388212-110388234 CCCTCCAGGACGGCGGCAAGCGA 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1113448443_1113448446 13 Left 1113448443 13:110388216-110388238 CCAGGACGGCGGCAAGCGAGCCC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1113448440_1113448446 18 Left 1113448440 13:110388211-110388233 CCCCTCCAGGACGGCGGCAAGCG 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1113448445_1113448446 -8 Left 1113448445 13:110388237-110388259 CCTCAAGCGCAGTCTGCATTTCC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113448446 Original CRISPR GCATTTCCCCAGCCGCAGCC AGG Intronic
900555433 1:3278116-3278138 CCATTTCCCCAACCCCACCCAGG + Intronic
900952335 1:5865052-5865074 GCCTCTCCCCAACCCCAGCCTGG - Intronic
901405040 1:9039770-9039792 CCAGCTCCCGAGCCGCAGCCCGG + Intronic
901639764 1:10687311-10687333 GCAGTGCCCCAGCCTCAGCCAGG + Intronic
902752361 1:18525986-18526008 GCATTTCCCCAGCAGAGGTCAGG + Intergenic
902992247 1:20196447-20196469 GGATTTCCCCAGCTGAGGCCTGG + Intergenic
904380423 1:30107051-30107073 GCATTGCCCCAGCCTCTGGCAGG + Intergenic
906647638 1:47487304-47487326 GCATTTCCTCAGCCACTCCCTGG + Intergenic
908930557 1:69312343-69312365 GCTTTTCCCCTGCTGGAGCCGGG - Intergenic
910518347 1:88088559-88088581 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
910595303 1:88974575-88974597 GCGATTCCCCTGCCTCAGCCTGG + Intronic
910706144 1:90131788-90131810 TGATTTCCCCAGCCCCTGCCAGG - Intergenic
913541183 1:119822461-119822483 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
913610152 1:120503039-120503061 GCACTTTCCCAGCCCTAGCCAGG - Intergenic
913984650 1:143553799-143553821 GCACTTTCCCAGCCCTAGCCAGG + Intergenic
914001461 1:143698330-143698352 GCATTTCGCCAGCCTCTCCCAGG - Intergenic
914581038 1:149019200-149019222 GCACTTTCCCAGCCCTAGCCAGG + Intronic
915136293 1:153733934-153733956 CCATTTCCCCTCCCTCAGCCAGG - Intronic
915334615 1:155133862-155133884 GGATTCCCTCAGCCTCAGCCTGG - Intronic
916849034 1:168684035-168684057 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
917024888 1:170631199-170631221 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
917060581 1:171033120-171033142 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
917512210 1:175678115-175678137 TTATTTCCCCAGCCCCAGCCTGG + Intronic
917582388 1:176391927-176391949 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
917682742 1:177384571-177384593 GAATTTCCGCAGCTCCAGCCAGG - Intergenic
918168714 1:181975108-181975130 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
918943156 1:191027166-191027188 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
919031830 1:192251997-192252019 GCTTTTCCCCTGCTGCAGCCAGG - Intergenic
919586643 1:199447976-199447998 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
920375538 1:205505920-205505942 GCAGTTCCCCAGCTGTAGCCTGG + Intronic
920966442 1:210705159-210705181 TCTTTTCCCCACCCTCAGCCTGG - Intronic
921126548 1:212183072-212183094 GCAATTCTCCTGCCCCAGCCTGG + Intergenic
921169814 1:212536796-212536818 GCAATTCTCCTGCCTCAGCCTGG + Intergenic
923146790 1:231203879-231203901 GCATTTCTCCAGCTGCAGTAGGG - Exonic
1066085030 10:31967986-31968008 GTATTTTGCCAGCCTCAGCCGGG + Intergenic
1066574721 10:36812943-36812965 GCAATTCTCCTGCCTCAGCCTGG + Intergenic
1067111325 10:43403130-43403152 GCAATTCTCCTGCCTCAGCCTGG + Intronic
1067209901 10:44251333-44251355 GCAATTCCCTAGCCAGAGCCAGG - Intergenic
1069604200 10:69729552-69729574 GTATGTTCCCAGCCGGAGCCTGG + Intergenic
1069750865 10:70744195-70744217 TCATCCCCCCAGCCCCAGCCCGG - Intronic
1070920573 10:80183048-80183070 TCATTTCCCCAGCCCATGCCAGG - Intronic
1071342040 10:84658302-84658324 GCATTTCCCCAGCTCCATCCAGG - Intergenic
1071524518 10:86350411-86350433 CCATCTCCCCAGCCCCAGCCTGG - Intronic
1071880988 10:89898017-89898039 GCCATTCCCCAGCACCAGCCTGG - Intergenic
1071966349 10:90857088-90857110 GCCGGTCCCCAGCCGGAGCCTGG + Intronic
1073138081 10:101230426-101230448 GCAAAGCCCCAGCCGCGGCCTGG - Intergenic
1075555266 10:123426434-123426456 GAATTTCCCCAGCCCCAGCAGGG + Intergenic
1076457943 10:130615852-130615874 TCATTTCTGCAGCCACAGCCTGG + Intergenic
1076533282 10:131159585-131159607 GCCTTTCCCCAGAGTCAGCCAGG - Intronic
1077473280 11:2774830-2774852 GCATGTTCCCAGACCCAGCCCGG + Intronic
1077524589 11:3056799-3056821 GCCTTTCCCCAGCCGGTGCCTGG - Intronic
1078122758 11:8527073-8527095 GCAATTCTCCTGCCTCAGCCTGG + Intronic
1078604598 11:12764200-12764222 GGATTTTCCAAGCCGAAGCCTGG - Exonic
1079361807 11:19776466-19776488 GCCTTTCTCCAGCAGCGGCCAGG + Intronic
1079800263 11:24860092-24860114 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1081528827 11:43944273-43944295 ACATCTCCCCACCCGCCGCCAGG - Intronic
1081691075 11:45079075-45079097 GCCTCTCCCCTGCAGCAGCCTGG - Intergenic
1083159000 11:60842938-60842960 GCCTTTGCCCTGCTGCAGCCTGG + Intronic
1083573317 11:63771535-63771557 GAATTTTCCCAGCCTCTGCCAGG - Intergenic
1083581835 11:63830079-63830101 GGGTCTCCCCAGCCTCAGCCAGG + Intergenic
1084163722 11:67365323-67365345 CCACTGCCCCAGCCGCTGCCTGG - Exonic
1084470827 11:69357945-69357967 CCATTTCCCCACCTGCAGCGTGG - Intronic
1085456193 11:76666582-76666604 GGACTTCCCCAGGAGCAGCCTGG + Intronic
1086029913 11:82342023-82342045 GCAATTCCTCAGTTGCAGCCTGG - Intergenic
1088084468 11:105960484-105960506 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1088697704 11:112382681-112382703 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1088924232 11:114284377-114284399 GCAATTCCTGAGCCTCAGCCAGG - Intronic
1090007026 11:123011774-123011796 GCATCTCCCCTACTGCAGCCAGG + Intergenic
1090056181 11:123426994-123427016 CCCTTTCCCCACCTGCAGCCAGG - Intergenic
1091165732 11:133474593-133474615 CCATACCCCCAGCCGCAGCAGGG - Intronic
1091847872 12:3671192-3671214 GCAATTACCCAGCCTTAGCCTGG - Intronic
1093296802 12:17401040-17401062 GCAGTGCCCCACCCCCAGCCTGG - Intergenic
1097748938 12:63330892-63330914 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1099187942 12:79536069-79536091 GCTTTTACCCAGTCGCAGGCTGG - Intergenic
1099793283 12:87363517-87363539 GCTTTTCCCCTGCTGAAGCCAGG - Intergenic
1100028104 12:90153462-90153484 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1101066525 12:101027509-101027531 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1102327688 12:112002287-112002309 GCAATTCTCCTGCCTCAGCCAGG - Intronic
1102851900 12:116254651-116254673 GCAGTTCTCCAGCCTCAGCCAGG - Intronic
1103419187 12:120766422-120766444 GACTTTGCCCAGCAGCAGCCAGG - Intronic
1105323424 13:19348068-19348090 GCCTCTCCCCAGCCGCAGCAAGG - Intergenic
1105413231 13:20189075-20189097 GCACTTCACCAGCCGCTGCATGG + Exonic
1105668484 13:22586688-22586710 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1105873964 13:24537769-24537791 GCCTCTCCCCAGCCGCAGCAAGG + Intergenic
1106287882 13:28334031-28334053 GCATTTTCACAGCCACAGTCCGG + Exonic
1106593965 13:31121377-31121399 GCTCTGCCCCAGCAGCAGCCTGG - Intergenic
1107553427 13:41497361-41497383 GCATTTCCCGTGGCCCAGCCTGG - Intergenic
1111999814 13:95199753-95199775 GCATTCCCCAGGCTGCAGCCAGG + Intronic
1113448446 13:110388252-110388274 GCATTTCCCCAGCCGCAGCCAGG + Intronic
1113724532 13:112588236-112588258 GCATTCCCCCTGCTGCTGCCCGG + Intergenic
1113769328 13:112898404-112898426 GCCTTTACCCAGCAGCAGCGTGG - Intronic
1114683954 14:24510139-24510161 CCATTTCCTCACCCTCAGCCAGG - Intergenic
1114705953 14:24726816-24726838 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1115855062 14:37622255-37622277 GCGTTTCCTGCGCCGCAGCCCGG + Intronic
1119226117 14:72945829-72945851 GCAGTCCACCAGGCGCAGCCTGG + Intronic
1119691482 14:76676199-76676221 GCAATTCTCCTGCCTCAGCCTGG + Intergenic
1121220529 14:92281482-92281504 GCATCTCCTCAGGGGCAGCCTGG + Intergenic
1121905713 14:97741112-97741134 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1123661992 15:22572587-22572609 GCATTTCCCCTGCCTTAACCAGG - Intergenic
1125437705 15:39665108-39665130 GCATGACCCCAGCTGCATCCAGG + Intronic
1125769280 15:42154281-42154303 GGAGTTCCCCTCCCGCAGCCTGG + Intronic
1126836075 15:52666721-52666743 GCATTTCCCCATACACAGACAGG - Intronic
1127687725 15:61364962-61364984 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1127752493 15:62060078-62060100 GCATCTCCCCAGCCGGAGTCGGG + Intronic
1128114679 15:65097800-65097822 GCATTTGCCCAGCCCCACCCCGG + Intronic
1128650814 15:69411719-69411741 GCAATTCTCCTGCCTCAGCCAGG - Intergenic
1133348167 16:5084023-5084045 TCACTTCCTCAACCGCAGCCCGG - Intronic
1134029678 16:10981852-10981874 GCATCTCCCCAGACACTGCCAGG - Intronic
1136188014 16:28599463-28599485 GCAGTCCCCCGGCCCCAGCCTGG - Intergenic
1136190486 16:28612457-28612479 GCAGTCCCCCGGCCCCAGCCTGG - Intronic
1136582493 16:31161555-31161577 GCAGTTCTCCTGCCTCAGCCTGG - Intergenic
1142167096 16:88597952-88597974 GCAGTTCCCCAGAGGCTGCCAGG - Intronic
1142518484 17:489383-489405 ACATCACCCCAGCCCCAGCCTGG - Intergenic
1142911557 17:3097824-3097846 ACTTTTCCCCTGCCGGAGCCTGG + Intergenic
1146616936 17:34364115-34364137 GCAATCCTCCAGCCTCAGCCAGG + Intergenic
1148506623 17:48132477-48132499 GCATTTCCTCAGCCCCTACCTGG + Intergenic
1149377961 17:56064577-56064599 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1149722546 17:58860831-58860853 GCAATTCCCCTGCCTCAGCTGGG - Intronic
1150236134 17:63594344-63594366 GCAGTGCCCCAGCCCGAGCCGGG + Intergenic
1150389133 17:64780756-64780778 GCATTCCCAGAGCCGCAGGCGGG - Intergenic
1152070902 17:78133156-78133178 GCACTTCCCCACCCTCATCCTGG + Intronic
1152597531 17:81245234-81245256 GCAGCTCCCCAGCCTGAGCCTGG + Exonic
1153655025 18:7274610-7274632 GCGATTCCCCTGCCTCAGCCTGG + Intergenic
1154201137 18:12301671-12301693 GCATCTCCCCAGCCTCCACCAGG - Intergenic
1154351076 18:13583964-13583986 CCATCTCCGCAGCCTCAGCCTGG + Intronic
1155762876 18:29588819-29588841 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1156020980 18:32598641-32598663 GACTTTCCCCAGCACCAGCCTGG + Intergenic
1156621027 18:38851845-38851867 GCAGTTCCCCAACCCCAGCCAGG - Intergenic
1160060831 18:75527390-75527412 ACTCTTCCCCAGCCGTAGCCTGG + Intergenic
1160584069 18:79903173-79903195 GCATGTGCACAGCCTCAGCCCGG + Exonic
1160710553 19:549196-549218 TCATTCCCCCAGCCCCACCCGGG - Intronic
1160733056 19:649827-649849 GCCTGTCCCCATCCCCAGCCTGG - Intronic
1160733074 19:649873-649895 GCCTGTCCCCATCCCCAGCCAGG - Intronic
1160733111 19:649965-649987 GCCTGTCCCCATCCCCAGCCAGG - Intronic
1160733131 19:650011-650033 GCCTGTCCCCATCCCCAGCCTGG - Intronic
1160733151 19:650057-650079 GCCTGTCCCCATCCCCAGCCTGG - Intronic
1160733170 19:650103-650125 GCCTGTCCCCATCCCCAGCCTGG - Intronic
1160733188 19:650149-650171 GCCTGTCCCCATCCCCAGCCAGG - Intronic
1160733207 19:650195-650217 GCCTGTCCCCATCCCCAGCCTGG - Intronic
1160861550 19:1239274-1239296 GCAATTTTCCAGCCTCAGCCCGG + Intergenic
1161287026 19:3473882-3473904 TCAGTTCTCCAGCCTCAGCCTGG - Intergenic
1161719493 19:5895136-5895158 GCCTTGCCCCAGCCCCAGCTGGG - Intronic
1161919327 19:7254423-7254445 GCAATCCTCCAGCCTCAGCCTGG - Intronic
1163799121 19:19354464-19354486 CCTCTTCCCCAGCCCCAGCCTGG + Intronic
1164163877 19:22650764-22650786 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1164923747 19:32109665-32109687 GCAATTCTCCTGCCACAGCCTGG + Intergenic
1164937345 19:32224563-32224585 GCAGTTGCCCCGCCGCCGCCCGG - Intergenic
1165422612 19:35729821-35729843 GCCTCTCCCCAGCCGCATCCAGG - Intronic
1165434225 19:35787750-35787772 CCAGTTCCCCAGCCCCAGTCTGG + Exonic
1165994536 19:39834312-39834334 GCCTTTGCGCAGCGGCAGCCTGG - Intergenic
1166203861 19:41256328-41256350 ACAGATCCCCACCCGCAGCCAGG + Intronic
1166331470 19:42080331-42080353 GCACTTCCCCTACCGCTGCCAGG + Exonic
1166840230 19:45692729-45692751 ACGTTCCCCCAGCCGCAGGCGGG - Exonic
1168690781 19:58376020-58376042 GCAATTCTCCTGCCTCAGCCTGG + Intronic
925817657 2:7769041-7769063 CCTTTTCTCCAGGCGCAGCCGGG - Intergenic
926227022 2:10973933-10973955 GCATTTGCCTGGCCCCAGCCTGG - Intergenic
926336795 2:11869547-11869569 GCATTTACCCAGGCCCAGCTGGG - Intergenic
928318721 2:30266515-30266537 GCATGACCCCAGCTGTAGCCTGG - Intronic
929589047 2:43133452-43133474 GCCCTTCCCCAGCCTCAGGCTGG - Intergenic
930017434 2:46980656-46980678 CCATTTCCCCTGCCCCAGCCAGG - Intronic
932434784 2:71696613-71696635 GCATTTCCCAAGCCCAGGCCGGG - Intergenic
932826718 2:74948005-74948027 GCCTTTCCCCTGCTGGAGCCAGG + Intergenic
933237599 2:79882556-79882578 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
935816734 2:106852843-106852865 GCATTTGGCCAGTGGCAGCCTGG - Intronic
937893982 2:126963461-126963483 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
938926766 2:136050280-136050302 TCATTTGCCCTGCCCCAGCCTGG + Intergenic
941694389 2:168535061-168535083 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
943216536 2:185044406-185044428 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
944706862 2:202298526-202298548 GCAATTCTCCTGCCTCAGCCAGG - Intronic
946415727 2:219538811-219538833 GCATGTGCCCAGCCTCACCCCGG - Intergenic
946622419 2:221573494-221573516 GCATTTCCCCAGGCGCTGGCAGG + Intronic
947533787 2:230928436-230928458 CCATTTCCCCAGCCGCAAATTGG + Intronic
1168787097 20:549116-549138 GCTTTCCCCCAGCAGCAGGCAGG - Intergenic
1168933545 20:1644408-1644430 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1170496587 20:16930935-16930957 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1171011859 20:21513349-21513371 CCATTCCTGCAGCCGCAGCCCGG - Intronic
1172238369 20:33394264-33394286 GCAATTCTCCTGCCTCAGCCTGG + Intronic
1172441592 20:34970218-34970240 GCAGTAGCCCAGCCTCAGCCTGG - Intergenic
1172609673 20:36240594-36240616 GCAGTTCCCCAGCAGCCCCCAGG + Exonic
1173091331 20:39974972-39974994 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1174587270 20:51618881-51618903 GCAGTGCCCCTGCCGAAGCCGGG + Intronic
1175600531 20:60268990-60269012 GCATTTCGGCAACTGCAGCCAGG + Intergenic
1176965115 21:15204289-15204311 GCCTTTCCACAGCCTCAGGCAGG - Intergenic
1177511393 21:22091884-22091906 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1179773483 21:43642901-43642923 GCAATTCTCCTGCCTCAGCCAGG + Intronic
1180000933 21:44995238-44995260 ACATTGCCCCAGCCTCTGCCTGG - Intergenic
1180597635 22:16989104-16989126 GCATTTACCCAACAGAAGCCAGG + Intronic
1181631127 22:24151915-24151937 GCAGTGACCCAGCCACAGCCTGG - Intronic
1182606727 22:31511568-31511590 GCAATTCTCCTGCCTCAGCCTGG + Intronic
1183616149 22:38946964-38946986 GCCCTTCCCCAGCAGCAGCTGGG - Intergenic
1185006365 22:48279094-48279116 GCATTTCCTGAGCAGCAGCAAGG - Intergenic
949592719 3:5510613-5510635 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
953103674 3:39854946-39854968 ACATTCCCCCAGCACCAGCCTGG - Intronic
954630130 3:52043597-52043619 CCATTTCCCCTGCCCCACCCAGG + Intergenic
957291328 3:78281579-78281601 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
957394725 3:79622482-79622504 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
957434144 3:80152117-80152139 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
957630099 3:82707245-82707267 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
958503757 3:94946711-94946733 GCTTTTCCCCTGATGCAGCCAGG - Intergenic
958768215 3:98396048-98396070 GACTTTCCCCAGCACCAGCCTGG + Intergenic
959065259 3:101649220-101649242 GCAGTTCCCCAGCAAAAGCCTGG - Exonic
959452696 3:106523161-106523183 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
960233429 3:115254922-115254944 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
961263576 3:125622094-125622116 GCAATTCTCCTGCCTCAGCCGGG - Intergenic
962026766 3:131555969-131555991 GCATTTCCCCACCTGCAGAAGGG - Intronic
962763936 3:138543543-138543565 GCATCTGCCCAGCCACAGCTTGG - Intronic
963461261 3:145617330-145617352 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
966539647 3:181075205-181075227 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
966553344 3:181230137-181230159 GACATTCCCCAGCAGCAGCCTGG - Intergenic
968606447 4:1537895-1537917 GCCTTTCCCCTGCCCCAGCATGG - Intergenic
970001937 4:11373037-11373059 GCACTTCTGCAGCCGGAGCCCGG - Intergenic
970494282 4:16609502-16609524 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
970666520 4:18343049-18343071 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
970952754 4:21775798-21775820 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
974386251 4:61203482-61203504 TCATTTCCCCAGCAGCTGGCTGG - Intronic
974741630 4:66014352-66014374 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
974920573 4:68234055-68234077 GCAGTTCTCCTGCCTCAGCCTGG - Intronic
977693762 4:99946235-99946257 GCATTCCCCGAGCCCCAGCCCGG + Intronic
978656808 4:111074841-111074863 GCCTTTCCCCTGCTGGAGCCAGG + Intergenic
979197851 4:117941644-117941666 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
979775421 4:124583361-124583383 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
980489391 4:133505824-133505846 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
980864826 4:138542492-138542514 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
982421856 4:155208316-155208338 GCAGTCCCTCAGCCGCAGCTGGG + Intergenic
982663188 4:158229841-158229863 GCTTTTCCACTGCCGGAGCCAGG - Intronic
983450934 4:167910453-167910475 CTATTTTCCCAGCCACAGCCTGG + Intergenic
983726921 4:170940548-170940570 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
984092096 4:175387376-175387398 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
984626127 4:182009571-182009593 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
984854895 4:184186755-184186777 GCATTTGCCCCGCCGTGGCCTGG + Intronic
985839862 5:2298190-2298212 GCAGTTTGCCAGACGCAGCCAGG - Intergenic
985902977 5:2811427-2811449 GCGATTCCCCTGCCTCAGCCGGG - Intergenic
985907532 5:2852661-2852683 ACATTTCCCCAGCCTCAGCCTGG + Intergenic
988059489 5:26148854-26148876 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
993117273 5:83733823-83733845 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
994092090 5:95818508-95818530 AGGTTTCCCCAGCCTCAGCCAGG + Intronic
995666167 5:114544810-114544832 GCATTTCCCCTGCTGGAGCCAGG + Intergenic
995960165 5:117829762-117829784 GCATTTCCCCTGCTGGAGCCAGG - Intergenic
996893818 5:128456095-128456117 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
996965926 5:129306867-129306889 TCTTTTCCCCTGCTGCAGCCAGG - Intergenic
998191551 5:140029582-140029604 GCAATTCTCCTGCCTCAGCCTGG - Intronic
998262518 5:140642249-140642271 CCATCTCCCCACACGCAGCCTGG + Intronic
998486976 5:142511534-142511556 GCCCTTCCCCACCAGCAGCCTGG - Intergenic
999712176 5:154328553-154328575 GCAATTCTCCAGCACCAGCCTGG + Intronic
999735570 5:154510599-154510621 GCATTTCCCCAGGGGGACCCAGG - Intergenic
1001788812 5:174437084-174437106 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1002351354 5:178585675-178585697 GCATTACCCCAGCGCCATCCAGG - Intronic
1002373446 5:178772446-178772468 GCATGTGCCCAGCCTCATCCTGG - Intergenic
1002430198 5:179198979-179199001 GCCTTTCCCCAGCCTCTGCTTGG - Intronic
1002440921 5:179264078-179264100 GCTCTTCCCCAGCAGCAGCGAGG - Intronic
1002691624 5:181054056-181054078 GCACTTCCCCATCCCCTGCCTGG + Intronic
1004608090 6:17212755-17212777 GCTTTGCCCCACCCCCAGCCTGG + Intergenic
1004752507 6:18577560-18577582 ACATTTCCCCAGCCGTTGCTTGG - Intergenic
1005346746 6:24897918-24897940 GCAATTCTCCTGCCTCAGCCAGG - Intronic
1006446028 6:34080179-34080201 GCAGATCCCCAGCTGCAGCGAGG - Intronic
1008184880 6:48376408-48376430 GCGATTCTCCAGCCTCAGCCAGG + Intergenic
1010637830 6:78282744-78282766 ACATTTCCCCAACACCAGCCTGG - Intergenic
1012462619 6:99480558-99480580 GCAATTCTCCTGCCTCAGCCTGG - Intronic
1012519520 6:100104092-100104114 GCATCTGCCCACCCTCAGCCAGG + Intergenic
1014864001 6:126505853-126505875 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1015660197 6:135566420-135566442 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1017892402 6:158649799-158649821 ACATTTCACCAGCATCAGCCTGG + Intergenic
1018538999 6:164856430-164856452 GCAATTCCTCAGCCCCATCCCGG + Intergenic
1018746287 6:166764644-166764666 GCACTTCCCCAGGCACAGCCGGG + Intronic
1019014125 6:168867445-168867467 GCCTTTCCCCAGCCGGGGGCAGG - Intergenic
1019113543 6:169738148-169738170 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1019404280 7:875668-875690 GCAGGTCCCCAGCCACGGCCAGG + Intronic
1019571883 7:1716722-1716744 GCACTCCCCCAGCCTCACCCGGG + Intronic
1019826108 7:3285729-3285751 ACATTGCCCCAGCCACAGCCAGG + Intergenic
1019911016 7:4100606-4100628 GCATTTGGCCATCCCCAGCCTGG + Intronic
1020621772 7:10527886-10527908 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1021981371 7:26058804-26058826 GCCTTTCCCCAGATGCAGCATGG - Intergenic
1022375764 7:29809589-29809611 GCCTTTCCCCAGCCGATGCTGGG + Intronic
1023000453 7:35801913-35801935 GCCTCTCTCCAGGCGCAGCCCGG + Intronic
1023324400 7:39037356-39037378 GCATTTACTCAGCAGCACCCTGG + Intronic
1024099481 7:46015700-46015722 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1024837631 7:53541624-53541646 GCATAACCCCATCAGCAGCCGGG + Intergenic
1026967541 7:74449998-74450020 GCATGACCCCAGCCTCACCCAGG - Intergenic
1027567852 7:79820560-79820582 GCATTTTCCCAGCCTCAGAGAGG + Intergenic
1028667016 7:93357360-93357382 ACATTTCCCCAGCAGCAGCAGGG + Intronic
1029692513 7:102191657-102191679 GCCTTTGCCCAGCCTCACCCTGG + Intronic
1031081850 7:117265633-117265655 GCAATTCTCCTGCCTCAGCCTGG + Intergenic
1031804569 7:126292648-126292670 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1032919908 7:136534075-136534097 GCTTTTCCCCTGCTGAAGCCAGG + Intergenic
1034205011 7:149307700-149307722 GCAATCCTCCAGCCTCAGCCTGG + Intergenic
1034426985 7:151019149-151019171 GGCTTTCCTCAGCCGCGGCCTGG - Exonic
1034628328 7:152511444-152511466 GCAATCCCCCTGCCTCAGCCTGG + Intergenic
1035066583 7:156109515-156109537 GCATTTCCCCATCAGCAGGGTGG - Intergenic
1036577628 8:10043046-10043068 GCAATTCTCCTGCCTCAGCCCGG - Intergenic
1036803326 8:11808868-11808890 GCATTTCCCCATCCAGCGCCTGG - Exonic
1037147190 8:15586537-15586559 GCATTACCTCAGGCCCAGCCAGG + Intronic
1038243350 8:25830996-25831018 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1038643942 8:29348531-29348553 GCGTTTCCCCAGCAGCTGACAGG + Intronic
1039201103 8:35094667-35094689 GCCTCTGCCCAGCCGCCGCCCGG - Intergenic
1039646731 8:39292892-39292914 GCCATTCTCCAGCCTCAGCCTGG - Intergenic
1041211863 8:55559792-55559814 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1043233304 8:77830215-77830237 GCTTTTCCCCTGCTGAAGCCAGG + Intergenic
1044315759 8:90748786-90748808 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1045263529 8:100598208-100598230 GCATCTCCCAAGCTGAAGCCTGG - Intronic
1045823678 8:106371878-106371900 GCTTTTCCCCTGCTGGAGCCAGG - Intronic
1048487134 8:134858839-134858861 GCATTTCATCAGCCGCAGAATGG - Intergenic
1049008887 8:139874449-139874471 GCGTTTCCCCACCCCCAGCATGG - Intronic
1049203228 8:141351815-141351837 GCCTGTGCCCAGCCCCAGCCAGG - Intergenic
1049814344 8:144591195-144591217 TCCTCTCCCCAGCCGGAGCCTGG + Intronic
1050630084 9:7549535-7549557 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1050660727 9:7880169-7880191 GCTTTTCCCCTGCTGGAGCCAGG + Intronic
1052225298 9:26077986-26078008 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1052369223 9:27645464-27645486 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1056934886 9:90908896-90908918 GCATCTGCCCTGCCGCAGCCCGG + Intergenic
1057488700 9:95506299-95506321 GGGTTTCGCCGGCCGCAGCCAGG + Intronic
1057801339 9:98192877-98192899 GCCTGTCCCCAGCCTCCGCCTGG - Intergenic
1059276176 9:113099180-113099202 GCATCTCCCCAGCCTCAATCAGG - Intergenic
1060526889 9:124325913-124325935 CCCTGTCCCCAGCCCCAGCCTGG - Intronic
1061076556 9:128345004-128345026 GCATGTTCCCAGCAGGAGCCAGG + Intronic
1061149417 9:128820430-128820452 GCCTGTCCCCAGCCCCACCCAGG - Exonic
1062004808 9:134233822-134233844 CCAGCTCCCCAGCTGCAGCCAGG + Intergenic
1062459737 9:136657885-136657907 GGATGTCCCCAGCAGCACCCAGG - Intergenic
1185446448 X:260330-260352 GCAATTCTCCTGCCTCAGCCAGG - Intergenic
1186589100 X:10909866-10909888 ACATTTCCCCAGCCCCAGGGTGG - Intergenic
1187244040 X:17538158-17538180 GCATTTCCTCATCTGCAGGCTGG + Intronic
1187388280 X:18868491-18868513 GCAATTCTCCTGCCTCAGCCTGG + Intergenic
1188092142 X:25977055-25977077 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1190529590 X:51361579-51361601 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1193091082 X:77494455-77494477 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1193768550 X:85561269-85561291 GCATTTCCCCTGCTGGAACCAGG - Intergenic
1194058214 X:89163827-89163849 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1194596703 X:95867911-95867933 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1196029658 X:111082713-111082735 GCATTTCCCCATGCTTAGCCAGG - Intronic
1196517289 X:116628618-116628640 GCCTTTCCCCTGCTGGAGCCAGG - Intergenic
1197602164 X:128543474-128543496 ACTTTTCCCCTGCTGCAGCCAGG - Intergenic
1200742031 Y:6864287-6864309 GCTTTTCCCCTGCTGGAGCCAGG - Intergenic
1201979638 Y:19892881-19892903 GCTTTTCCCCTGCTGGAGCCAGG + Intergenic