ID: 1113450077

View in Genome Browser
Species Human (GRCh38)
Location 13:110402815-110402837
Sequence ATCCCTTGGAAGCTGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 474}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113450066_1113450077 25 Left 1113450066 13:110402767-110402789 CCTGCTCCTGTGTCAGGTCTGTG 0: 1
1: 0
2: 3
3: 42
4: 247
Right 1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 474
1113450068_1113450077 19 Left 1113450068 13:110402773-110402795 CCTGTGTCAGGTCTGTGCCTGGT 0: 1
1: 0
2: 0
3: 17
4: 329
Right 1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 474
1113450065_1113450077 26 Left 1113450065 13:110402766-110402788 CCCTGCTCCTGTGTCAGGTCTGT 0: 1
1: 0
2: 1
3: 24
4: 268
Right 1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 474
1113450069_1113450077 2 Left 1113450069 13:110402790-110402812 CCTGGTCACAGAAGTTCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113450077 Original CRISPR ATCCCTTGGAAGCTGGGTGG AGG Intronic
900580112 1:3404618-3404640 ATCCCTCGGCAGCGTGGTGGGGG + Intronic
900991171 1:6099100-6099122 AGCCCTTGGAAAGTGGGAGGTGG - Exonic
901308064 1:8247667-8247689 ATCGCTTGAATCCTGGGTGGCGG + Intergenic
901341087 1:8500032-8500054 ATCGCTTGAAACCTGGGAGGCGG + Intronic
902368136 1:15990483-15990505 ATCCCCTGGAGCCTGGCTGGAGG - Intergenic
903121584 1:21219880-21219902 ATGCCCTGGAGGCTGGATGGGGG + Exonic
903396617 1:23006503-23006525 ATCCCTTAAAATCTGGGTGGAGG - Intergenic
903956993 1:27032521-27032543 ATCTCTTAGAACCTGGGAGGCGG - Intergenic
904376908 1:30087394-30087416 ATCCCTGGGGAAATGGGTGGAGG - Intergenic
905279425 1:36839513-36839535 ATTCCTTGGAGGCTGGGGAGGGG - Intronic
905542923 1:38774408-38774430 ATCCCCTGGAAGTTGGGGTGTGG - Intergenic
906196797 1:43934742-43934764 ATCCATAGGAGGCTGGGAGGGGG + Intronic
907035525 1:51212828-51212850 ATCACTTTGAACCTGGGAGGTGG - Intergenic
907112722 1:51940964-51940986 ACCCCTTGAAAGTTGGGTGTGGG - Intronic
908458783 1:64329571-64329593 ATCCTTTGGAATCTGGGTGGAGG - Intergenic
908674589 1:66589561-66589583 ATTGTTTGGAAGCTGGTTGGTGG - Intronic
909422752 1:75484756-75484778 ATCCTTTGAAAGCTAGGTGGAGG + Intronic
909501608 1:76340734-76340756 TTCCCCTGGAAGCTGGGGTGGGG + Intronic
909501619 1:76340769-76340791 TTCCCCTGGAAGCTGGGGTGGGG + Intronic
909602887 1:77479289-77479311 CTCCCTTGAAACCTGGGAGGCGG - Intronic
911026608 1:93442521-93442543 TTCCCTTGAAAGCAGGGTGTTGG - Intergenic
911251922 1:95585952-95585974 CTCCCATGGAAAGTGGGTGGAGG + Intergenic
911392884 1:97268489-97268511 ATCCTTTGAAATCTAGGTGGAGG + Intronic
911515785 1:98866558-98866580 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
911660977 1:100500662-100500684 ATCCCTTAGAACCTGGGAGGTGG + Intronic
911893528 1:103401756-103401778 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
912118656 1:106440219-106440241 ATTGCTTGGAACCTGGGAGGTGG - Intergenic
912335885 1:108862390-108862412 ATCCCTTGGAATCAGGGGTGAGG + Intronic
914723198 1:150306359-150306381 ATCCCTTGAACTCGGGGTGGAGG - Intronic
915565554 1:156710881-156710903 GTCCCTAGGAAGCAGGCTGGGGG - Intergenic
915583060 1:156827346-156827368 ATCCCTTAGAACCTGGGAGGTGG - Intronic
916397961 1:164412684-164412706 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
916472560 1:165138270-165138292 ATCCCTTGGATGCTGGGAACAGG + Intergenic
917281998 1:173386372-173386394 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
917350191 1:174069590-174069612 ATCACTTGTAACCTGGGAGGCGG - Intergenic
917892444 1:179453105-179453127 ATCCTCTGAAATCTGGGTGGAGG - Intronic
918393749 1:184093327-184093349 GCCCCTTGGAGGCAGGGTGGTGG + Intergenic
918449423 1:184644576-184644598 AAGCCTTGGGAGCTGGGTGAGGG - Intergenic
919262003 1:195208445-195208467 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
920831577 1:209470338-209470360 ATCTTTTGGAGTCTGGGTGGAGG + Intergenic
920836925 1:209519766-209519788 ATCCTTTGGAATCTTGGTGGAGG - Intergenic
920859942 1:209697624-209697646 ACCACATGGTAGCTGGGTGGAGG - Intronic
921033942 1:211358388-211358410 ATCGCTTGAAACCTGGGAGGCGG + Intronic
921998566 1:221449270-221449292 ATCCCTTGCAAACTGTATGGAGG + Intergenic
923139826 1:231151740-231151762 ATCCCCTGGAATCTAGGTGGAGG + Intergenic
923605856 1:235442092-235442114 ATCGCTTAGAACCTGGGAGGCGG - Intronic
923731788 1:236558233-236558255 ATACCTGGGAAGCTGGGGGATGG + Exonic
924131229 1:240910802-240910824 ATCCCCTTGAACCTGGGAGGCGG - Intronic
924707903 1:246513227-246513249 ATCCCCTGGAGCCTGGCTGGAGG + Intergenic
1062846099 10:706952-706974 ATCTCTTGAAATCTAGGTGGAGG + Intergenic
1062868384 10:876862-876884 ATCTCTTGAAATCTAGGTGGAGG + Intronic
1064054392 10:12085221-12085243 AATCCTTGGAACCTGGGAGGTGG + Intronic
1064544977 10:16440938-16440960 ATACCTTGGGAGCTGTGGGGAGG + Intronic
1064901245 10:20297842-20297864 ATCACTTGGAATTTGGGTGGAGG + Intergenic
1065766682 10:29036779-29036801 ATCGCTTAGAACCTGGGAGGCGG + Intergenic
1066475023 10:35738467-35738489 ATCCCTTGGAGTCATGGTGGTGG - Intergenic
1067328607 10:45293268-45293290 ATCCCAGGGAAGCTGAGTGGAGG + Intergenic
1069421112 10:68247403-68247425 AACCCTTGGAAGCTTAGAGGAGG + Intergenic
1069787955 10:71001399-71001421 ATCCCTTGAAATCTAGGTGGAGG + Intergenic
1069802210 10:71088959-71088981 ATCGCTTAGAACCTGGGAGGTGG + Intergenic
1070053633 10:72913346-72913368 ATCCCCAGGGAGCTGGTTGGTGG + Exonic
1070647449 10:78211551-78211573 AGGACTTGGGAGCTGGGTGGGGG - Intergenic
1071507027 10:86238808-86238830 ATCCTTTGAAATCTAGGTGGAGG - Intronic
1071563815 10:86661558-86661580 ACCCCTGGGAAGCTGGGGCGGGG - Intronic
1073312921 10:102557008-102557030 ATCACTTTGAACCTGGGAGGCGG + Intronic
1074075057 10:110115300-110115322 ATCGCTTTGAACCTGGGAGGTGG + Intronic
1074293034 10:112155371-112155393 ATCCCTTGGAAACTGTTTGGTGG + Intronic
1074379951 10:112971392-112971414 ATCGCTTGAAACCTGGGAGGCGG - Intronic
1075711196 10:124531255-124531277 ATCCCGTGCAAGCTGGGGTGTGG + Intronic
1076619772 10:131779767-131779789 AGGCCTTGGAAGCTGGTGGGGGG - Intergenic
1076672354 10:132130273-132130295 AGCTCTTGGGAGCTGGGTGATGG + Intronic
1076803106 10:132841623-132841645 ATCCTTTGAAATCTGGATGGAGG + Intronic
1077183080 11:1225004-1225026 ACCCCATGGAGGCTGGGAGGAGG - Intronic
1080136207 11:28857662-28857684 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1081369560 11:42283507-42283529 ATCACTTGGAAGCTGAATGATGG + Intergenic
1082073045 11:47954867-47954889 AATCCTTTGAACCTGGGTGGCGG - Intergenic
1083331911 11:61902660-61902682 TTCCTTTGGAAGCCGGGTGGGGG - Intronic
1083536965 11:63478405-63478427 ATCCCTTGAAACCAGGGAGGCGG - Intronic
1084073616 11:66754873-66754895 GTCCCTTGAATGCTGAGTGGAGG + Intronic
1084104974 11:66975267-66975289 ATCTCTTGTCAGATGGGTGGAGG + Exonic
1084530365 11:69723790-69723812 AACACCTGGAAGTTGGGTGGGGG + Intergenic
1084672274 11:70614395-70614417 ATCTCTTAGAACCTGGGAGGCGG - Intronic
1086564700 11:88212236-88212258 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1086934755 11:92732832-92732854 GTCCCTTGGAAGACAGGTGGAGG - Intronic
1087438313 11:98151151-98151173 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1087495926 11:98890718-98890740 ATCCTCTGAAAGCTAGGTGGAGG + Intergenic
1088769639 11:113020840-113020862 ATCACTTGGAACCTGGGAGACGG - Intronic
1089063182 11:115642848-115642870 ACCTCATGGAAGCTGTGTGGTGG + Intergenic
1089579857 11:119474838-119474860 ATCTTTTGGAAGCTGGATGCCGG + Intergenic
1089865285 11:121626292-121626314 TCCCCTTGGAAGTGGGGTGGGGG + Intronic
1091279412 11:134373623-134373645 AGCCCTGGGAAGCTGGGGTGAGG - Intronic
1091407943 12:220699-220721 ACCCTTGGGAAGCTGGGTGGGGG - Exonic
1092199686 12:6572641-6572663 ATCGCTTGGAACCCGGGAGGCGG - Intronic
1092257719 12:6936458-6936480 ATGCCTGGGAAGCTGGGAAGGGG - Exonic
1092727060 12:11497243-11497265 ATTGCTTGAAAGCTGGGAGGTGG - Intronic
1092881567 12:12891336-12891358 CACCCCTGGAAGCTGGGCGGGGG - Exonic
1093790570 12:23245131-23245153 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1094013112 12:25829945-25829967 ACCCCATAGAAGCTGGGTGCAGG + Intergenic
1094293612 12:28879157-28879179 ATCACTTTGAACCTGGGAGGCGG + Intergenic
1094496607 12:30992892-30992914 ACCCCCTGGAAGCAGTGTGGTGG - Exonic
1094738315 12:33260075-33260097 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
1095748519 12:45686253-45686275 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1096492130 12:52018743-52018765 ATCCCTTTGGGGCTGGGTGGCGG + Intergenic
1096875672 12:54628567-54628589 ATCCTTTGAAATCTTGGTGGAGG - Intergenic
1096958068 12:55546988-55547010 ATTCTTTGAAATCTGGGTGGAGG + Intergenic
1097186425 12:57198848-57198870 TTCCCAAGGGAGCTGGGTGGTGG - Intronic
1097189616 12:57213140-57213162 AGCCCTGGGAACCTCGGTGGGGG - Exonic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097404828 12:59176903-59176925 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1097417718 12:59333679-59333701 ATCGCTTTGAACCTGGGAGGCGG - Intergenic
1097501544 12:60409958-60409980 ATCCTCTGAAATCTGGGTGGAGG + Intergenic
1097986216 12:65785769-65785791 ATCCCTAGGAAGTTCAGTGGTGG - Intergenic
1098351159 12:69562535-69562557 ATCCTTTGGGAGCAGGGGGGTGG - Intronic
1098439757 12:70504963-70504985 CTCCCTTGGTTGGTGGGTGGGGG + Intergenic
1098543471 12:71685646-71685668 ATCGCTTAGAACCTGGGAGGCGG + Intronic
1100933012 12:99632275-99632297 ATTCTTTGAAATCTGGGTGGAGG - Intronic
1101526389 12:105535040-105535062 ATCCTCTGAAATCTGGGTGGAGG + Intergenic
1102413262 12:112738613-112738635 GTCCCCTGGAAGGTGAGTGGTGG + Intronic
1102619647 12:114183729-114183751 ATTCCTTTGAACCTGGGAGGTGG + Intergenic
1102626178 12:114237073-114237095 ATCCCCTGGAAGAGGGCTGGAGG - Intergenic
1102673821 12:114642801-114642823 ATCGCTTGAAACCTGGGAGGTGG + Intergenic
1102846992 12:116195535-116195557 ATCGCTTTGAACCTGGGAGGCGG - Intronic
1103147129 12:118604542-118604564 ATCACTTGAAACCTGGGAGGTGG + Intergenic
1103354420 12:120309287-120309309 AAACCTTGGAATCTGGGTGATGG - Intronic
1103821616 12:123703265-123703287 ATCACTTGAAACCTGGGAGGTGG - Intronic
1103853764 12:123950481-123950503 GTTCCTAGGAAGCTGGGTGAGGG + Intronic
1104497701 12:129256505-129256527 ATCACTTGAATGCTGGGAGGCGG - Intronic
1104661905 12:130617207-130617229 ATCCCTTGTGTGCTGGATGGAGG - Intronic
1105418998 13:20236270-20236292 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1105504455 13:20998264-20998286 ATCACTTTGAACCTGGGAGGTGG + Intronic
1105681405 13:22731438-22731460 AACCCTTGAAACCTGGGAGGTGG + Intergenic
1106227694 13:27797243-27797265 ATCCCTGGGAAGCCGAGAGGAGG - Intergenic
1106502153 13:30339435-30339457 AACACTTGGAAGTTGGGTAGAGG - Intergenic
1106641280 13:31586983-31587005 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1107017482 13:35719406-35719428 ATCCCAGGGAAGCTGGCTGAGGG + Intergenic
1107619047 13:42206057-42206079 ATGCCTTGCAAGCTGGGAAGAGG - Exonic
1108927405 13:55769966-55769988 ATCCTCTGGAATCTAGGTGGAGG - Intergenic
1109294448 13:60513066-60513088 ATCCTCTGAAATCTGGGTGGAGG + Intronic
1110585857 13:77191759-77191781 TTCTCCTGCAAGCTGGGTGGTGG - Exonic
1111472051 13:88695783-88695805 ATCCCCTGAAATCTAGGTGGAGG + Intergenic
1111568499 13:90047829-90047851 ATCCCCTGGAATCTAGGTGGAGG + Intergenic
1112669934 13:101623984-101624006 ATACATTGTAAACTGGGTGGGGG - Intronic
1112954572 13:105042121-105042143 ATCCTGTGGAATCTAGGTGGAGG + Intergenic
1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG + Intronic
1113553432 13:111211784-111211806 ATTCCTTTGAAGCTGGGCAGTGG + Intronic
1114401436 14:22414568-22414590 TTCCCTTGGGAGAGGGGTGGTGG - Intergenic
1114574689 14:23701268-23701290 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1115556078 14:34546072-34546094 ATCCCTTGGGGACTGGGCGGTGG + Intergenic
1115557830 14:34557009-34557031 ATCCCTTGGGGACTGGGCGGTGG - Intergenic
1116272188 14:42786291-42786313 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1116500641 14:45617118-45617140 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1116644489 14:47509490-47509512 ATCCTTTGAAAGGTAGGTGGAGG - Intronic
1116783875 14:49267151-49267173 ATCCCCTGAAATCTAGGTGGAGG - Intergenic
1119283828 14:73434005-73434027 ATCGCTTAGAACCTGGGAGGCGG + Intronic
1119408204 14:74411721-74411743 CTTCCTAGGAAGCGGGGTGGGGG + Intronic
1119419759 14:74501566-74501588 AGCCCTTCGAAGCCGGCTGGGGG + Exonic
1119547444 14:75482545-75482567 ATCCCTTGAAATCCAGGTGGAGG + Intergenic
1120564524 14:86038449-86038471 ATCTTTTGAAATCTGGGTGGAGG - Intergenic
1120718771 14:87868245-87868267 ATCACTAAGAAGTTGGGTGGTGG - Intronic
1121372568 14:93374007-93374029 ATCTTTTGAAATCTGGGTGGAGG - Intronic
1121382919 14:93489937-93489959 ATCCTTTGAAATCTAGGTGGAGG + Intronic
1121505516 14:94474028-94474050 CTCCCTTGGAATCAGGGTGAAGG + Intronic
1122262966 14:100533693-100533715 AGCCCCAGGAAGGTGGGTGGAGG - Intergenic
1122323338 14:100868207-100868229 CTCACCTGGAGGCTGGGTGGAGG - Intergenic
1122555541 14:102577474-102577496 ATCCTTTGAAATCTCGGTGGAGG - Intergenic
1122627668 14:103092467-103092489 ATGCCCTGGGAGCTGGGGGGCGG + Intergenic
1123030124 14:105447650-105447672 CTCCCTGGAAAGCTGCGTGGCGG + Intronic
1123552320 15:21394485-21394507 AACCATTGGAACCTGGGAGGCGG - Intergenic
1125066092 15:35487384-35487406 ATCCTTTGAAATCTAGGTGGAGG + Intronic
1126097232 15:45098169-45098191 ATCCCTGGCCAACTGGGTGGAGG - Intronic
1126654900 15:50966621-50966643 ATCACTTGAAACCTGGGAGGAGG - Intronic
1126936454 15:53714272-53714294 ACCCCTGGGAAGATGGATGGGGG + Intronic
1128025777 15:64435437-64435459 AATCCTTGGAACCTGGGTGGCGG + Intronic
1128658859 15:69483307-69483329 ATTCCTAGGAAGCTGGGAAGGGG + Intergenic
1128713379 15:69888800-69888822 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1131905177 15:97134903-97134925 ATCCCTTGAAGGCAGGGAGGTGG - Intergenic
1133166244 16:3949603-3949625 GACCCTTGGAAAGTGGGTGGGGG - Intergenic
1133269364 16:4602892-4602914 AGGCCTTGGAAGCTGGGAGGGGG + Intergenic
1134078703 16:11309977-11309999 ATCCCCAGGGAGCTGGGGGGAGG - Intronic
1134166500 16:11934141-11934163 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1134350073 16:13429080-13429102 ATCACTAGGCAGCTGGGTGGAGG + Intergenic
1134526137 16:14945334-14945356 AACCGTTTGAAGCTGGGAGGTGG - Intronic
1134546271 16:15111039-15111061 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1134580985 16:15370337-15370359 AACCGTTTGAAGCTGGGAGGTGG + Intronic
1134713716 16:16343805-16343827 AACCGTTTGAAGCTGGGAGGTGG - Intergenic
1134721586 16:16387160-16387182 AACCGTTTGAAGCTGGGAGGCGG - Intronic
1134945840 16:18324715-18324737 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1134953101 16:18364852-18364874 AACCGTTTGAAGCTGGGAGGTGG + Intergenic
1135311892 16:21411558-21411580 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1135364841 16:21844010-21844032 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1135446999 16:22527327-22527349 AACCGTTTGAAGCTGGGAGGCGG - Intronic
1135736403 16:24935026-24935048 TTCCCCTGGCTGCTGGGTGGAGG + Intronic
1135844359 16:25905275-25905297 CTTCCTTGGCAGCAGGGTGGAGG + Intronic
1136151058 16:28349462-28349484 AACCATTTGAAGCTGGGAGGCGG + Intronic
1136167292 16:28463302-28463324 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1136195685 16:28651714-28651736 AACCATTTGAAGCTGGGAGGCGG - Intronic
1136212023 16:28765839-28765861 AACCATTTGAAGCTGGGAGGCGG - Intronic
1136256743 16:29045767-29045789 AACCATTTGAAGCTGGGAGGCGG - Intronic
1136295762 16:29301307-29301329 ATGCCCCGGAAGGTGGGTGGCGG - Intergenic
1136308594 16:29390563-29390585 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1136322011 16:29492091-29492113 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1136436691 16:30232064-30232086 AACCGTTTGAAGCTGGGAGGCGG + Intronic
1138290126 16:55839700-55839722 ACCCCTTGGAACCTGATTGGTGG - Intergenic
1138336094 16:56253749-56253771 ATCACATGGAAGCAGAGTGGGGG + Intronic
1138693046 16:58786660-58786682 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1139163625 16:64540119-64540141 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1139166078 16:64566650-64566672 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1139856297 16:69982974-69982996 AACCGTTTGAAGCTGGGAGGCGG + Intergenic
1140366434 16:74385099-74385121 AACCGTTTGAAGCTGGGAGGCGG - Intronic
1140941002 16:79721984-79722006 ATCCCTTAGAAGCGGGGGTGTGG - Intergenic
1141439484 16:84020456-84020478 ATCTTTTGAAATCTGGGTGGAGG + Intronic
1141641339 16:85343375-85343397 TGCCCTTGGAGGCTGGGTGAAGG + Intergenic
1142099247 16:88262899-88262921 ATCCGTAGGAGGCTGTGTGGGGG - Intergenic
1142318904 16:89368280-89368302 ATCGCTTGTAACCTGGGAGGCGG - Intronic
1142421705 16:89974570-89974592 ATCGCTTAGAACCTGGGAGGCGG + Intergenic
1143131550 17:4681422-4681444 ATCACTTGGAACCTGGGAGGTGG + Intronic
1143205247 17:5136450-5136472 ATCCCCTGGAGCCTGGCTGGAGG - Intronic
1143523475 17:7459547-7459569 TTCCCTGGGAAGACGGGTGGTGG - Exonic
1144195437 17:12890278-12890300 ATCCTTTGAAATCTAGGTGGAGG + Intronic
1144876298 17:18399143-18399165 ATCCCCTGGAGCCTGGCTGGAGG - Intergenic
1145155931 17:20545277-20545299 ATCCCCTGGAGCCTGGCTGGAGG + Intergenic
1145269423 17:21396763-21396785 CACCCCTGGATGCTGGGTGGAGG - Intronic
1145759588 17:27418653-27418675 ATCCCTGGTGAGCTGGCTGGAGG + Intergenic
1146160983 17:30559442-30559464 ATCCCCTGGAGCCTGGCTGGAGG - Exonic
1147180914 17:38685162-38685184 ATCACTTTGAACCTGGGAGGTGG + Intergenic
1147560329 17:41505030-41505052 AGCCCTTGGAAGCTGAGGAGGGG - Intronic
1147639291 17:41984911-41984933 ATCACTTGAAACCTGGGAGGCGG - Intronic
1148561585 17:48609841-48609863 ATCCCAGTGAACCTGGGTGGGGG - Intronic
1148588166 17:48795831-48795853 AACCCTGGGAGGCTGGGAGGAGG - Intronic
1148667166 17:49383359-49383381 TTCCCATGGAAACTGGGTGGTGG - Intronic
1149095366 17:52833387-52833409 GTCCCCTGGACCCTGGGTGGTGG + Intergenic
1149339675 17:55672479-55672501 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1150215339 17:63465555-63465577 ATCGCTTGAAACCTGGGAGGCGG - Intergenic
1150385172 17:64753479-64753501 ATCGCTTGAACTCTGGGTGGGGG - Intergenic
1150444352 17:65217090-65217112 CTCCCTGAGAAGATGGGTGGGGG + Intronic
1150693721 17:67386276-67386298 ACCCCTTGAAACCTGGGAGGCGG - Intronic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1153624566 18:7011932-7011954 CTCCCCTGGGAGGTGGGTGGGGG - Intronic
1154254237 18:12768697-12768719 ATCCCTGGGGAGCTCTGTGGTGG + Intergenic
1154948901 18:21188824-21188846 ATCCCTTAGAACCCGGGAGGTGG - Intergenic
1155545517 18:26910378-26910400 TTCCTTTGGAAGCTTGGCGGGGG + Exonic
1156015331 18:32540940-32540962 ATCCCTTGGCACATGTGTGGTGG + Intergenic
1156294513 18:35777446-35777468 CTACCTTGGAAGCTGGGATGTGG - Intergenic
1156322345 18:36038460-36038482 ATCCTCTGAAATCTGGGTGGAGG - Intronic
1156525872 18:37766694-37766716 ATCCTCTGGAATCTAGGTGGAGG + Intergenic
1156660113 18:39336687-39336709 CTCCCTGGAACGCTGGGTGGTGG - Intergenic
1156707472 18:39900398-39900420 ATCACTAAGAAGCTGAGTGGTGG + Intergenic
1157272578 18:46287904-46287926 ATTCCTTAAAAGCTGGTTGGGGG + Intergenic
1159782148 18:72672598-72672620 ATCCTTTGAAAGCTGTGTGCTGG - Intergenic
1160723230 19:606184-606206 ATCCCTTGAACCCTGGGAGGTGG - Intronic
1161229117 19:3163640-3163662 ATCCCTTGCAGGCTGGGGGCTGG + Exonic
1162249075 19:9427404-9427426 ATCCCTTGAACCCTGGGTGGCGG - Intronic
1162413778 19:10521681-10521703 ATCCCTTGAACTCGGGGTGGAGG - Intergenic
1162421471 19:10568343-10568365 CCCCCTTCGAAGGTGGGTGGTGG - Intronic
1163579262 19:18128611-18128633 CTGCCTTGGAAGTCGGGTGGGGG + Intronic
1163605506 19:18273115-18273137 ATCACTTTGAACCTGGGAGGCGG - Intronic
1163968282 19:20769072-20769094 ATCCCTTGGCTGTGGGGTGGGGG - Intronic
1164768873 19:30792709-30792731 ATCCCTGGGAAGCTGTGTTCAGG + Intergenic
1165311141 19:35030214-35030236 CTCCCTGGGAAGGTGGGGGGGGG + Intergenic
1165402951 19:35613353-35613375 TTCCCTGGGAAGGCGGGTGGTGG - Intronic
1165982184 19:39734241-39734263 ATCCCATGGAAGCCGGGTGCGGG + Intronic
924963770 2:57531-57553 ACCCCTTGCAAGCTGGTGGGAGG + Intergenic
925753406 2:7110046-7110068 ATCCTCTGGAAGCTGGGAGCCGG - Intergenic
926214133 2:10893240-10893262 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
927190834 2:20515872-20515894 AGCTCTTGGAAGCTTGATGGTGG + Intergenic
929079590 2:38109326-38109348 ATCCCTTGGTAGAAGGCTGGGGG - Intronic
929562071 2:42962222-42962244 GTGCCTTGGGAGGTGGGTGGGGG + Intergenic
929699635 2:44150889-44150911 ATCCTTTGGAATCTAGGTGGAGG - Intergenic
931496522 2:62813337-62813359 ATCCCTTGAAATCTAGGTAGAGG - Intronic
932326528 2:70865717-70865739 ATCGCTTGAAACCTGGGAGGCGG + Intergenic
932606928 2:73171715-73171737 TTCCAAGGGAAGCTGGGTGGGGG - Intergenic
933496319 2:83054146-83054168 ACCCTTTGAAATCTGGGTGGAGG + Intergenic
933548138 2:83740666-83740688 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
933790058 2:85876546-85876568 ATCCCTTGAAACCTGGGAGGCGG - Intronic
933925500 2:87088696-87088718 TTCCAAGGGAAGCTGGGTGGGGG + Intergenic
934561921 2:95317939-95317961 ATCTCTGGGAACCTGGCTGGAGG + Intronic
934845875 2:97661016-97661038 AACCCCAGGAAGCTGGGTCGGGG + Intronic
935334074 2:101998812-101998834 ACCCCTTGGAAACCAGGTGGAGG + Intronic
935588537 2:104823948-104823970 ATCACTTGAAACCTGGGAGGTGG + Intergenic
936551547 2:113446658-113446680 ATCACTTCAAAGCTGGGAGGCGG + Intronic
936813644 2:116433142-116433164 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
936949208 2:117960536-117960558 AGAGCATGGAAGCTGGGTGGGGG - Intronic
937802175 2:126092635-126092657 ATCCTTTGAAATATGGGTGGAGG - Intergenic
937988955 2:127651693-127651715 TTCCCTTCGAAGCTGGGGGGCGG - Exonic
938777552 2:134555265-134555287 ACCCCATGGAAGTTGGGGGGTGG - Intronic
939578090 2:143919659-143919681 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
939818195 2:146922453-146922475 ATCTCTTAGAACCTGGGAGGCGG - Intergenic
940907106 2:159179471-159179493 ATCCTGCAGAAGCTGGGTGGGGG - Intronic
941119174 2:161508325-161508347 ATCACTTTGAACCTGGGAGGTGG - Intronic
941526976 2:166618347-166618369 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
942870850 2:180732634-180732656 ATCCTTTGAAATCTAGGTGGTGG - Intergenic
943283868 2:185972246-185972268 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
943570210 2:189564998-189565020 ATCCCTTGGACTCTGTGAGGAGG - Intronic
943690945 2:190869033-190869055 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
943920566 2:193701781-193701803 AGTCCTTGGCAGCTGGCTGGAGG + Intergenic
946807332 2:223484340-223484362 GCCCCTTGGATTCTGGGTGGAGG - Intergenic
947549075 2:231033559-231033581 CTTCCTGGGGAGCTGGGTGGAGG - Intergenic
948125784 2:235563927-235563949 ATCAGTGGGAAGCTGGGTGGGGG + Intronic
948412089 2:237771561-237771583 GTCCCTTGGTATCTGGGCGGGGG - Intronic
948745922 2:240094157-240094179 TTGCCATGAAAGCTGGGTGGTGG + Intergenic
1169132198 20:3172125-3172147 ATCCCCTGGCAGCTGCCTGGGGG - Intronic
1169282104 20:4276756-4276778 ATCCCTTGCTAGGTGGGAGGTGG - Intergenic
1169771050 20:9200860-9200882 ATTCCTAGCAAGCTGGGGGGAGG - Intronic
1170103417 20:12727209-12727231 ACCCCTTTAGAGCTGGGTGGAGG - Intergenic
1171409502 20:24936618-24936640 ACCCCTGGGAAGCTGGCTGCTGG - Intergenic
1172486990 20:35304279-35304301 GTCACTGGGGAGCTGGGTGGCGG + Intronic
1173412759 20:42828781-42828803 ATCCTTTGAAATCTAGGTGGAGG - Intronic
1173417380 20:42869060-42869082 ATCTTTTGAAATCTGGGTGGAGG - Intronic
1173577551 20:44122991-44123013 TGCCTTTGGAAGCTGGGTTGAGG + Intronic
1174161807 20:48556427-48556449 ATCCCTTGGGAGCAGGATAGGGG + Intergenic
1174389510 20:50209437-50209459 ATCACTTAGAACCTGGGAGGTGG - Intergenic
1175625189 20:60483880-60483902 ATCCCTTGGGAGCTGGGAGCAGG + Intergenic
1175702663 20:61151464-61151486 ATCCTTTGAAATCTGGGTGGAGG + Intergenic
1176201586 20:63863223-63863245 TTCCCTTAGGAGCTGGGTGGGGG - Exonic
1178212883 21:30558167-30558189 ATCGCTTAGAACCTGGGAGGCGG - Intronic
1179370440 21:40801824-40801846 ATCCTTAGAAATCTGGGTGGAGG - Intronic
1179384449 21:40929146-40929168 ATTCTCTGGAATCTGGGTGGAGG + Intergenic
1179514895 21:41899571-41899593 ATCCCTAGGCAGCTGGGGGTTGG + Intronic
1179538633 21:42068945-42068967 AGCCCTTGGATGCTGTGTGGGGG + Intronic
1179621346 21:42618212-42618234 ATCTTTTGGAAACTGTGTGGGGG - Intergenic
1179884500 21:44307764-44307786 AGCCCTGGGGAGCTGGGTGTGGG + Intronic
1180163077 21:46006718-46006740 CTCCCCTGTAAGCTGGGTGAAGG + Intergenic
1181505517 22:23353781-23353803 ACCCCTTGGAGCCTGGCTGGTGG + Intergenic
1181816509 22:25441327-25441349 ATCGCTTTGAACCTGGGAGGCGG - Intergenic
1182026186 22:27121105-27121127 ATCCTTCTGAAGTTGGGTGGGGG - Intergenic
1182105218 22:27684258-27684280 ATCACTTAGAACCTGGGAGGTGG + Intergenic
1182350154 22:29694881-29694903 ATCCATAGGGAGCTGGCTGGGGG + Exonic
1182395666 22:30034078-30034100 ACATCTTGGAAGCTTGGTGGAGG + Intergenic
1183044420 22:35208266-35208288 ATCCCTTGAAATCTAGGAGGAGG + Intergenic
1183478671 22:38050926-38050948 ACCACTGGGAAGCTGGGTTGGGG - Intergenic
949657530 3:6238129-6238151 ATCCTTTGCAATCTAGGTGGAGG - Intergenic
950381899 3:12623173-12623195 ATCTATTGCAAGCTGGGTGCAGG - Intronic
952327417 3:32334062-32334084 ATCGCTTAGAACCTGGGAGGTGG - Intronic
952585438 3:34886958-34886980 ATCCTTTGCAATCTAGGTGGAGG - Intergenic
954109645 3:48426862-48426884 ATCCCTTGGAAACTAGGTGGGGG - Intronic
954357264 3:50092473-50092495 ATCACTTGAAACCTGGGAGGCGG + Intronic
955301476 3:57784050-57784072 ATCCTTTGAAATCTAGGTGGAGG - Intronic
955529647 3:59859631-59859653 ATTGCTTAGAAGCTGGGAGGCGG + Intronic
956161332 3:66356593-66356615 ATACTATGGAAGCTGGGTGAAGG + Intronic
956674865 3:71724731-71724753 ATCCCTTGGGAGGTGTGCGGTGG - Intronic
957295546 3:78328635-78328657 ATCGCTTGAAACCTGGGAGGCGG - Intergenic
957464222 3:80565569-80565591 ATTGCTTGGAACCTGGGAGGCGG + Intergenic
958528386 3:95291961-95291983 ATCCTTTGAAAACTTGGTGGGGG - Intergenic
959446074 3:106441340-106441362 ATCCCTTGAACCCAGGGTGGTGG + Intergenic
959837906 3:110942620-110942642 ATCCCTTGGAAGATGATGGGTGG + Intergenic
960281828 3:115788825-115788847 AACCATTGAAAGCTGGCTGGGGG - Intergenic
961753061 3:129108665-129108687 AACCCTTGGAACCTGGAAGGTGG - Intronic
961839534 3:129697209-129697231 ATCCTTTGAAATCTAGGTGGAGG + Intronic
961954258 3:130784992-130785014 ATCGCTTTGAACCTGGGAGGCGG - Intergenic
962843530 3:139255837-139255859 ATCCCTGGGAAGGTGGCTGATGG - Intronic
963681848 3:148388189-148388211 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
964169803 3:153756567-153756589 ATCCCTGGGGAGAAGGGTGGTGG - Intergenic
964222689 3:154365091-154365113 ATCCTTTGAAATCTAGGTGGAGG + Intronic
964943590 3:162190850-162190872 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
965679931 3:171239813-171239835 ATCCCTGGGAAGCTAGTTGCTGG + Intronic
966526138 3:180921280-180921302 ATCCCTTGAACCCAGGGTGGGGG + Intronic
967222549 3:187259822-187259844 CTCACTTGGAAGCTGAGTGAGGG - Intronic
967904462 3:194488426-194488448 AACACTTGGAAGCTAGTTGGAGG - Intronic
968614778 4:1572553-1572575 CCGCCTTGGAAGCTGGGTGGGGG - Intergenic
968621530 4:1605434-1605456 AGCCCCTGGAAGCTGGGTGCAGG - Intergenic
970871418 4:20820970-20820992 ATCCTTTGAAACCTAGGTGGAGG - Intronic
971906398 4:32732182-32732204 CTCCCTTGGAAGGGGGTTGGGGG - Intergenic
972082695 4:35173210-35173232 ATCCTTTGAAATCTAGGTGGCGG - Intergenic
972367801 4:38392612-38392634 ATCCCCTGAAATCTAGGTGGAGG - Intergenic
973543116 4:51953945-51953967 ATCCTTTGAAATCTGGGTAGAGG + Intergenic
976099948 4:81550789-81550811 ATCCCATGGAAGCAGAGGGGTGG + Intronic
976348964 4:84038687-84038709 ATCCTTTAGAGGCAGGGTGGGGG + Intergenic
976478170 4:85508853-85508875 AGACCTTGGAATGTGGGTGGAGG - Intronic
977396556 4:96478739-96478761 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
977905061 4:102467771-102467793 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
978005347 4:103608598-103608620 ATAGATTGGAAGCTGGGTGGAGG + Intronic
979849279 4:125556312-125556334 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
979906533 4:126300562-126300584 ATCCTCTGAAATCTGGGTGGAGG + Intergenic
980743259 4:136979401-136979423 ATCTCTTAGAAAATGGGTGGGGG - Intergenic
982019656 4:151190669-151190691 ATCCCCTGAAATCTAGGTGGAGG - Intronic
982832942 4:160086387-160086409 ATCCCCTGAAATCTAGGTGGAGG + Intergenic
983296174 4:165872285-165872307 GTCCCTTGGAAGCTTGTTGGGGG + Intergenic
984047214 4:174815546-174815568 ATCCTCTGAAATCTGGGTGGAGG + Intronic
985758481 5:1733074-1733096 GTCCCATGGCAGCTGGCTGGGGG - Intergenic
986084861 5:4434014-4434036 ATCCTTTGAAATCTTGGTGGAGG + Intergenic
986281901 5:6330345-6330367 ATCCTCTGGAATCTAGGTGGAGG - Intergenic
986464253 5:8005730-8005752 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
987102581 5:14605132-14605154 ATCCTCTGAAACCTGGGTGGAGG + Intronic
987507466 5:18792670-18792692 CTCCAGTGGAACCTGGGTGGCGG + Intergenic
989206726 5:38816589-38816611 CTCCCCAGGAGGCTGGGTGGAGG - Intergenic
990335921 5:54772715-54772737 TTCCCCTTGAATCTGGGTGGGGG - Intergenic
991151030 5:63370262-63370284 ATCACTTGAAACCTGGGAGGCGG + Intergenic
991321968 5:65383844-65383866 ATCCTTTGGAATCTAGGTGGAGG + Intronic
991547165 5:67795483-67795505 ATCTGTTGAAATCTGGGTGGAGG - Intergenic
992866494 5:80961221-80961243 ATCACTTGGCAGTGGGGTGGAGG - Intronic
995559450 5:113364710-113364732 ATCCTTTGAAATCTAGGTGGAGG + Intronic
996641631 5:125761790-125761812 ATCCTCTGGAATCTAGGTGGAGG - Intergenic
997273744 5:132564938-132564960 ATCCCCTGAAATCTAGGTGGAGG - Intronic
997310304 5:132874126-132874148 AGCCCTGGGAAGCTGGGCAGAGG + Intronic
997394442 5:133546935-133546957 ATCCTTTGAAATCTGGGGGGAGG - Intronic
997517075 5:134497512-134497534 ATCACTTTGAACCTGGGAGGCGG + Intergenic
997669491 5:135658703-135658725 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
998460878 5:142309138-142309160 ATCGCTTAGAACCTGGGCGGTGG + Intergenic
999025588 5:148227836-148227858 TTCACTTGGAAGTAGGGTGGAGG - Intergenic
999499480 5:152132379-152132401 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1000350920 5:160352194-160352216 ATGACTTGGAGGCTGCGTGGTGG - Intronic
1000574525 5:162960969-162960991 ATCCCTTGAATCCGGGGTGGTGG - Intergenic
1000703754 5:164485997-164486019 ATGCCTTGGAAGTTAGGTGAAGG - Intergenic
1000784391 5:165526140-165526162 ATACCTTGGAAGCTGGAGTGTGG - Intergenic
1001352273 5:170980664-170980686 ATCCTCTGAAATCTGGGTGGAGG - Intronic
1003314514 6:5000272-5000294 ATCGCTTTGAACCTGGGAGGCGG - Intronic
1003880579 6:10476434-10476456 ATCACTCGGAAGCTCAGTGGTGG + Intergenic
1003984097 6:11418303-11418325 AGCCCCAGGAAGCTAGGTGGAGG - Intergenic
1004113007 6:12738776-12738798 ATCCCCTTGAACCTGGGAGGCGG + Intronic
1005602964 6:27446483-27446505 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1006231365 6:32589811-32589833 ATAACTTGGAATGTGGGTGGAGG - Exonic
1006278179 6:33022740-33022762 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1007064527 6:38976561-38976583 ATCACTTGGGAGCTTGTTGGAGG + Intronic
1007225095 6:40308280-40308302 ATCCCCTGGAAGCTGGCTACAGG - Intergenic
1007521718 6:42455126-42455148 GTCCTTTGGAAGGTGGGGGGGGG - Intergenic
1008278420 6:49567396-49567418 ATCACTTAGAACCTGGGAGGCGG + Intergenic
1008286791 6:49662784-49662806 ATCCCATGGAAGCAGGCTGCTGG + Intergenic
1010009677 6:71035948-71035970 AAGACTTGGAGGCTGGGTGGAGG + Intergenic
1010525348 6:76894339-76894361 ATCCTCTGAAATCTGGGTGGAGG + Intergenic
1012047130 6:94291477-94291499 ATTCCTTGGAAGCAGGGCTGTGG + Intergenic
1012125274 6:95420736-95420758 ATCCTCTGAAAGCTAGGTGGAGG + Intergenic
1013427952 6:110032338-110032360 ATCCCATTGTAGCTGGGTGGAGG + Intergenic
1014170624 6:118275088-118275110 ATCCCTTAGAACTTGGGAGGTGG + Intronic
1015487681 6:133790549-133790571 ATCCCCTGAAATCTGCGTGGAGG + Intergenic
1015713116 6:136163228-136163250 ATCCTTTGAAATCTAGGTGGAGG + Intronic
1015936540 6:138410566-138410588 ATCACTTTGAACCTGGGAGGCGG - Intronic
1015994460 6:138984167-138984189 ATCACTTAGAACCTGGGAGGAGG - Intronic
1016489126 6:144577116-144577138 ACGCCTTGGAGGCTGAGTGGAGG + Exonic
1016731254 6:147430795-147430817 AGACCTTGAAACCTGGGTGGAGG - Intergenic
1016804092 6:148195628-148195650 TTCCCCTGGCAGGTGGGTGGTGG + Intergenic
1017133571 6:151129148-151129170 ATCCTCTGAAATCTGGGTGGAGG - Intergenic
1017506566 6:155073917-155073939 ATCCCTTTGAGGCTGGTAGGTGG + Intronic
1018592657 6:165443714-165443736 ATCCTCTGAAATCTGGGTGGAGG + Intronic
1018990866 6:168672729-168672751 AACCCTTTGAACCTGGGAGGCGG - Intronic
1020175110 7:5876089-5876111 ATCACTTAGAACCTGGGAGGTGG - Intergenic
1020376945 7:7498444-7498466 TACCCTTGGAGGCTGGGAGGAGG + Intronic
1021578999 7:22132723-22132745 ATCCCTAGGAAGAGGGGTGAGGG - Intronic
1021992265 7:26150819-26150841 AAGCCTTGGAAGATGGGTTGGGG - Intergenic
1022399673 7:30025218-30025240 GAACCTTGGAAGATGGGTGGAGG - Intronic
1022483880 7:30762931-30762953 ACCCCTTTTAAGCTGGGTGGTGG + Intronic
1022842937 7:34182041-34182063 ATCCTTTGAAATCTGGGTGAAGG - Intergenic
1023101379 7:36721800-36721822 CTCCCTTTGAGTCTGGGTGGAGG + Intronic
1023239808 7:38131290-38131312 ATCCGCTTGAACCTGGGTGGTGG + Intergenic
1023406900 7:39843171-39843193 ATCCTCTGAAAGCTAGGTGGAGG - Intergenic
1024738773 7:52333827-52333849 ATCCCTAGGAGTCTGGGTGCAGG - Intergenic
1027240629 7:76325736-76325758 ATAGCTTGGAACCTGGGAGGTGG + Intergenic
1027249126 7:76387828-76387850 ATCGCTTTGAACCTGGGAGGCGG + Intergenic
1027341143 7:77209712-77209734 ATCCCTTGAAAGCTAGGCAGAGG + Intronic
1029574101 7:101391644-101391666 ATCTCTTTGAACCTGGGAGGTGG - Intronic
1031238680 7:119210939-119210961 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1032012755 7:128357583-128357605 CTCCCTTGGATGGTGGGTGAGGG - Intronic
1033114407 7:138612599-138612621 ATCCCTTAGAACCTGGGAGGCGG - Intronic
1035660875 8:1347328-1347350 CTCTCATGGTAGCTGGGTGGAGG + Intergenic
1035691236 8:1561477-1561499 GCCTCTTGGAATCTGGGTGGAGG + Intronic
1036518491 8:9468442-9468464 ATCCTCTGGAATCTAGGTGGAGG - Intergenic
1036934259 8:12985945-12985967 ATCCATTTGAACCTGGGAGGCGG - Intronic
1037194934 8:16177406-16177428 AGCCCGTAGAAGCTGGGAGGAGG + Intronic
1037516093 8:19633602-19633624 CACCGTTGGAAGCTGGGAGGAGG + Intronic
1038292674 8:26263861-26263883 ATCTCCTGTAAGCTGAGTGGAGG - Intergenic
1038683416 8:29692571-29692593 ATACCTTCCCAGCTGGGTGGGGG + Intergenic
1039244769 8:35596697-35596719 CTCCCCTGGAAGCAGGGAGGGGG + Intronic
1039414148 8:37379198-37379220 ATCCTTTGGAAGCAGGGATGTGG - Intergenic
1039414834 8:37384999-37385021 AATCCTTTGAAGCTGGGAGGTGG + Intergenic
1039588453 8:38727106-38727128 ATCCCTGGGGTGCGGGGTGGGGG + Intergenic
1040543949 8:48382308-48382330 CTCCCTCTGCAGCTGGGTGGAGG + Intergenic
1041753658 8:61288761-61288783 ATCACCAGGAAGCAGGGTGGGGG + Intronic
1042168843 8:65973179-65973201 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1044839181 8:96323394-96323416 ATCCTTTGAAATCTAGGTGGAGG + Intronic
1045248481 8:100463625-100463647 ATCCCTGAGTAGCTGGGTGGAGG + Intergenic
1045314021 8:101027756-101027778 CTCCCTTGGAAGCATGGTGTGGG + Intergenic
1046735728 8:117774856-117774878 ATCTCTTGTAAGGTGGGTGTGGG - Intergenic
1046878052 8:119277776-119277798 ATCCGTTGAAATCTAGGTGGAGG + Intergenic
1047149360 8:122243120-122243142 CTCCCTTGGAAGTTAGGTGATGG + Intergenic
1048181785 8:132201910-132201932 ATCCTTTGAAATCTAGGTGGAGG + Intronic
1048729189 8:137418799-137418821 ATCCTCTGAAAGCTAGGTGGAGG + Intergenic
1048753311 8:137704069-137704091 ACCTCTTGGAAGATGAGTGGGGG + Intergenic
1049458631 8:142709525-142709547 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1049901450 9:170470-170492 ATCGCTTGAAAGCTGGGAGGCGG - Intronic
1050121563 9:2313908-2313930 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1051968961 9:22863682-22863704 ATCCTTTGAAACCTAGGTGGAGG + Intergenic
1052821902 9:33144318-33144340 ATCGCTTGAAACCTGGGAGGCGG - Intronic
1053197171 9:36128242-36128264 ATTCTTAGGGAGCTGGGTGGAGG - Intergenic
1053309714 9:37009866-37009888 CCCCCTTGGAAGCTGGGGAGGGG + Intronic
1053744485 9:41180765-41180787 ATCGCTTGAAAGCTGGGAGGCGG - Intronic
1054349753 9:64010655-64010677 ATCGCTTGAAAGCTGGGAGGCGG - Intergenic
1054482785 9:65684448-65684470 ATCGCTTGAAAGCTGGGAGGCGG + Intronic
1054683859 9:68250485-68250507 ATCGCTTGAAAGCTGGGAGGCGG + Intronic
1055670015 9:78595276-78595298 ATCCTTTGAAAGCTAGGTAGAGG - Intergenic
1056386731 9:86102821-86102843 ATTCTTTGGAATCTAGGTGGAGG + Intergenic
1057247054 9:93465651-93465673 ATTCCCTGGAAGCTGAGTGAGGG - Intronic
1057506680 9:95639763-95639785 ATCACTTTGAACCTGGGAGGCGG + Intergenic
1058234954 9:102478427-102478449 AACCCTTGGAAAGTGGGGGGGGG - Intergenic
1058572800 9:106365706-106365728 ATCCATTGTAATCTAGGTGGAGG + Intergenic
1059887120 9:118758434-118758456 ATTCTTTGGAATCTGGGTGGAGG + Intergenic
1060845546 9:126834139-126834161 TTCCCTTGCCAGCTGGGCGGTGG - Exonic
1061079942 9:128363902-128363924 ATCGCTTGAAACCTGGGAGGCGG + Intergenic
1062538798 9:137032432-137032454 AGGCCTGGGTAGCTGGGTGGGGG - Exonic
1062617330 9:137403732-137403754 AGCCCTTGGAAGCTGGCGGTGGG - Intronic
1186063564 X:5737785-5737807 ATCCCCTGGAAGCAGGGTGGAGG - Intergenic
1186476588 X:9862461-9862483 CTCACTAGGAAGCTGGCTGGGGG + Intronic
1189079919 X:37959882-37959904 ATCCTTTGAAATCTGGGTGAAGG + Intronic
1189666227 X:43357677-43357699 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1190229313 X:48569560-48569582 ATCACTTGGAACCCGGGAGGTGG + Intergenic
1190949079 X:55124385-55124407 ATTCCTTGGACGGGGGGTGGAGG + Intronic
1193175582 X:78388641-78388663 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1193246552 X:79236966-79236988 ATCCCCTGAAATCTAGGTGGAGG + Intergenic
1193332945 X:80256108-80256130 ATCCTCTGGAATCTAGGTGGAGG - Intergenic
1194830772 X:98620012-98620034 ATCCTCTGAAATCTGGGTGGAGG + Intergenic
1195349068 X:103979951-103979973 AGCCCTGGGCAGCGGGGTGGGGG + Intergenic
1195352658 X:104009518-104009540 AGCCCTGGGCAGCGGGGTGGGGG - Intergenic
1195356435 X:104044044-104044066 AGCCCTGGGCAGCCGGGTGGGGG + Intergenic
1195358375 X:104058888-104058910 AGCCCTGGGCAGCGGGGTGGGGG - Intergenic
1195805782 X:108763606-108763628 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1195965901 X:110430001-110430023 ATCCTATGAAAACTGGGTGGTGG + Intronic
1196975018 X:121149774-121149796 ATCCCTTGGAAGATGGTTTTGGG + Intergenic
1197560528 X:128014985-128015007 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1197581900 X:128294308-128294330 ATCCCCTGAAATCTAGGTGGAGG - Intergenic
1197672954 X:129298798-129298820 ATCCTTTGAAATCTAGGTGGAGG - Intergenic
1198937064 X:141909663-141909685 ATCGTTATGAAGCTGGGTGGTGG + Intergenic
1199219215 X:145297496-145297518 ATCCTTTGAAATCTAGGTGGAGG + Intergenic
1199261429 X:145779891-145779913 ATCCTTTGAAATCTCGGTGGAGG - Intergenic
1200281168 X:154778198-154778220 ATCCCCTGGAACCTGGGAGGTGG + Intergenic
1200530311 Y:4327277-4327299 ATCTCTTGGAACCAGGGAGGTGG - Intergenic
1201275255 Y:12290980-12291002 ATCACTTAGAACCTGGGAGGAGG + Intergenic
1201532756 Y:15010288-15010310 ATCCCCTGGAAGCAGGGTGGAGG + Intergenic