ID: 1113452045

View in Genome Browser
Species Human (GRCh38)
Location 13:110417555-110417577
Sequence CCTTCTCCATAGCATGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113452045 Original CRISPR CCTTCTCCATAGCATGATTC TGG (reversed) Intronic
900573719 1:3372818-3372840 CCTCCTCCAGAGCCTGAGTCAGG + Intronic
903520703 1:23946034-23946056 CTTTCTCCATTGAATGATTTTGG + Intergenic
904038187 1:27569922-27569944 CCTTCTCCCTAGCCAGACTCAGG - Intronic
909338443 1:74504163-74504185 CCCTCTGCATTGCATGCTTCTGG + Intronic
909688183 1:78374675-78374697 CCTTCTACATAGAATTATTGGGG + Intronic
917605082 1:176619427-176619449 CCTTCTCAATACCATGCTTCAGG - Intronic
918141807 1:181726094-181726116 CCTTCTGCAGTGCATGTTTCTGG - Exonic
923326422 1:232884230-232884252 CCTTCTCCACATGATGATCCAGG + Intergenic
924937981 1:248788469-248788491 CCTTCACCTTTGCATGATACAGG - Intergenic
1065342743 10:24722887-24722909 CCCGCTCCAGGGCATGATTCTGG + Intronic
1069108990 10:64420879-64420901 CCTCCCCCATAGAATTATTCAGG - Intergenic
1074098570 10:110334952-110334974 TTTTCTCCTTAGCATGATTCTGG + Intergenic
1074999949 10:118788573-118788595 CTTGCTCCATAGAATGATTTAGG - Intergenic
1075949845 10:126467732-126467754 CCTGCTGCATAGCTTAATTCTGG - Intronic
1079380046 11:19930122-19930144 CCTCTTCCATAGAATGATTTTGG - Intronic
1084619998 11:70263232-70263254 CCGTCCCCACAGCATGAATCAGG - Intergenic
1085483057 11:76838514-76838536 GCTTCTCCAGGGCAGGATTCCGG - Intergenic
1089213118 11:116819723-116819745 CCTCCTCCTTAGCATGTTCCAGG + Intergenic
1089283516 11:117391149-117391171 CCTTCTCCTTTGCAGCATTCAGG - Exonic
1092624624 12:10313082-10313104 CCTTCACAATACCATGATTTTGG + Intergenic
1095040540 12:37435757-37435779 CCTTCTCAAGCGCAGGATTCAGG - Intergenic
1098687159 12:73436605-73436627 TCTATTCCATAGCATGATTCAGG + Intergenic
1100123694 12:91397733-91397755 CCTTCTCCATGGGATGACACAGG - Intergenic
1102978025 12:117220546-117220568 CCCTCTCCAGGGGATGATTCTGG - Intronic
1103663287 12:122539717-122539739 CCTTCTCAATGACAAGATTCTGG - Exonic
1104122437 12:125812218-125812240 CCATTTCCAAAGCATCATTCTGG - Intergenic
1104321861 12:127759093-127759115 TCTTCTGCATAGAAAGATTCTGG + Intergenic
1105888409 13:24662808-24662830 TCTGCTCCATAGCCTGACTCTGG - Intergenic
1108870913 13:54984662-54984684 CCTTCTCCATCTCATGCTTTAGG + Intergenic
1112175325 13:97017430-97017452 CCTTCTCCAGATAATCATTCAGG + Intergenic
1112585413 13:100714925-100714947 TCTGCTCCATGTCATGATTCAGG - Intergenic
1113452045 13:110417555-110417577 CCTTCTCCATAGCATGATTCTGG - Intronic
1117935430 14:60900375-60900397 CTTTCTCCATAGCAGCAATCAGG - Intronic
1118950296 14:70430413-70430435 CCTTCCCCATTGCTTGTTTCTGG + Intergenic
1125804695 15:42483384-42483406 CCTACTCCATCGCATGATGGAGG - Intronic
1126926890 15:53598870-53598892 ACTTCTGCATATCATGATGCTGG + Intronic
1126976398 15:54186725-54186747 ACTTCTCCACTGCATGATTAAGG - Intronic
1129219473 15:74123102-74123124 CTCTTTCCATAGCAAGATTCAGG - Intronic
1129476213 15:75786035-75786057 CCTTCTCCATAGCCTCCTTGAGG - Intergenic
1131091725 15:89629054-89629076 CCTTCTCCAGAGCTTGAATCCGG + Exonic
1131417716 15:92275158-92275180 CCCTCTCCATTGCATGTTTCCGG + Intergenic
1132227217 15:100151668-100151690 CCTTCTCCACAGGATGGTGCAGG + Intronic
1132409302 15:101564687-101564709 CCTTCTCCACAGCATCCTACAGG - Intergenic
1133774393 16:8885912-8885934 CCTTCTCCCTAGGATGCTTGAGG + Intergenic
1134771484 16:16813068-16813090 CCTTCCTCATAGCATTATACAGG - Intergenic
1135991310 16:27220464-27220486 CCTTCTCCATAACACGAGCCAGG + Exonic
1139599027 16:67975621-67975643 CCTTCTCCCTAGCGGGATTGGGG - Intergenic
1141843544 16:86590972-86590994 CCTTCTCCATAGTGTGACTATGG - Intergenic
1145377295 17:22362599-22362621 CCTTCTCAAGCGCAGGATTCAGG + Intergenic
1146165901 17:30588492-30588514 CCTGCTCCACAGAATGATTTGGG + Intergenic
1146569647 17:33941442-33941464 CCTTATCCATAGCAGCATCCTGG + Intronic
1146813383 17:35922619-35922641 CCTTCTGAATAGCAAGCTTCTGG + Exonic
1147326345 17:39671545-39671567 CCTTTGCCATAGCCTGATTTTGG - Exonic
1148025689 17:44586023-44586045 CCTTCTCCAGGGCTTGCTTCTGG + Intergenic
1148113906 17:45163424-45163446 GCTTGTAGATAGCATGATTCTGG - Intronic
1149080485 17:52650823-52650845 CCATTTCAATAGCATGATACTGG - Intergenic
1150785134 17:68156630-68156652 CCTTCTGAATAGCAAGCTTCTGG + Intergenic
1151193890 17:72418248-72418270 CCCTCTCCATACCTTGATTTTGG - Intergenic
1151478812 17:74358065-74358087 CCTTCTCCTTGCCATGAGTCTGG + Intronic
1157231056 18:45916437-45916459 GCTTCTCAACAGCATGATCCAGG - Exonic
1159344868 18:67188522-67188544 CCTCCTCCATACCATCTTTCAGG + Intergenic
1160485992 18:79293080-79293102 CTTTCTCCATAGCATTATCTTGG - Intronic
1165547276 19:36551042-36551064 CCTGGTCCAGATCATGATTCAGG - Intronic
1165599053 19:37037298-37037320 CCTTCTCAAGCGCAGGATTCAGG + Intronic
926507278 2:13732796-13732818 TCTACTCCTTAGCATAATTCAGG + Intergenic
926691504 2:15737482-15737504 TCTCCTCCATAGAGTGATTCAGG - Intronic
927403015 2:22735292-22735314 TCTGCTCTATAGCATGATTCAGG + Intergenic
928031664 2:27784859-27784881 CTTTCTCCATTGCATCCTTCAGG - Intronic
928072511 2:28231550-28231572 CCTCCTCCACAGTATGATTCAGG - Intronic
933640565 2:84754543-84754565 CCTTACCCATTGAATGATTCTGG + Intronic
934536096 2:95134851-95134873 CCTTCCCCATAGAATGGTCCTGG + Intronic
935740534 2:106143657-106143679 CTTTCTTCAGAGGATGATTCAGG + Intronic
935912816 2:107915640-107915662 CTTTCCCCAAAGAATGATTCAGG + Intergenic
939538927 2:143468932-143468954 CATTCTCCAAATCATGATTTTGG - Intronic
940864765 2:158807094-158807116 CCTTCTCCAGTGCGTCATTCAGG - Exonic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945418157 2:209600476-209600498 TCTTCTCTATAGCCTGTTTCCGG + Intronic
1171062219 20:21976722-21976744 CTTACTTCATAGAATGATTCAGG + Intergenic
1171339101 20:24413117-24413139 GGTTCTCCACAGCCTGATTCAGG + Intergenic
1171535100 20:25880428-25880450 CCTTCTCAAGCGCAGGATTCAGG - Intergenic
1171805964 20:29680522-29680544 CCTTCTCAAGCGCAGGATTCAGG + Intergenic
1173971139 20:47153141-47153163 CCTTGTGCACAGCATGATCCAGG + Intronic
1177085504 21:16697662-16697684 CTTTCTCCATGGCATTATTTTGG + Intergenic
1178501026 21:33125562-33125584 CCTTATCCAAAGCCAGATTCTGG - Intergenic
1179609649 21:42541633-42541655 CCTTCTCCATGGCATGGTAAGGG + Intronic
1183032709 22:35117639-35117661 CCCTGTCCATAGATTGATTCAGG + Intergenic
949573607 3:5317666-5317688 TTTTCTCCATGGAATGATTCAGG + Intergenic
955546869 3:60040574-60040596 CCTTCTCCCAAGCCTGGTTCTGG + Intronic
960186820 3:114652291-114652313 TCTTCTGCATACCATGTTTCTGG + Intronic
962559029 3:136586967-136586989 TTTTCTTCATAGGATGATTCAGG - Intronic
962830361 3:139133885-139133907 CCATCTCCATAGTATTACTCAGG - Intronic
962877184 3:139543950-139543972 CATTCTCCATCGCATAACTCCGG - Intergenic
966173547 3:177111157-177111179 CCATCACCATATCATTATTCAGG + Intronic
967867089 3:194198998-194199020 CCTCCTCCATAGCCTCTTTCTGG + Intergenic
968964668 4:3763887-3763909 CCTTCTCCAAAGCCTGCATCTGG + Intergenic
969483528 4:7459278-7459300 CCTTCTCCATAGCAATACTTAGG - Intronic
969655717 4:8497138-8497160 CCTTCTCCAGAGCAAGGTTGAGG + Intergenic
970584411 4:17501553-17501575 TCTTCTCCCTAAAATGATTCAGG + Intronic
973036996 4:45419676-45419698 CTTTCTTCATAGAATGATTTAGG + Intergenic
973609857 4:52625445-52625467 TGTTCTCCAGAGCATGATTCAGG - Intronic
975459667 4:74635937-74635959 CATTCTCCATAGCACAATCCAGG + Intergenic
975915597 4:79321968-79321990 CCTACTCCATGGTATCATTCAGG - Intronic
978396515 4:108286202-108286224 GCTGCTTCATAGCCTGATTCTGG - Intergenic
978711585 4:111788975-111788997 CCTACTCTATAGCGTGGTTCAGG + Intergenic
978966175 4:114744617-114744639 CCTTCTCCAGTGTATGATCCTGG - Intergenic
979744768 4:124198213-124198235 TCTTGTCCATAGAATGATTGAGG - Intergenic
983472150 4:168170509-168170531 TCTTCTCCAAACCATGATTCAGG + Intronic
984898596 4:184564191-184564213 CCTTCTCAAGCGCAGGATTCAGG + Intergenic
986227667 5:5831403-5831425 CCAGCTTCATAGAATGATTCAGG - Intergenic
988193268 5:27966107-27966129 CCTTCTCCCTACCAGAATTCTGG - Intergenic
990249665 5:53900294-53900316 CCTTTGGCATAGCTTGATTCAGG - Intronic
990480576 5:56206532-56206554 ACTCCTCCATTGCATGATGCAGG - Intronic
990907908 5:60823316-60823338 CCTTCTCCAGAGCCTAAGTCTGG + Intronic
997357612 5:133273843-133273865 CCTTCCCCCAAGCATGAGTCAGG + Intronic
1001224621 5:169933119-169933141 CCTTCTCCTTACCCTGTTTCAGG - Intronic
1004033212 6:11894083-11894105 ACTTCTCCACAGTCTGATTCAGG + Intergenic
1009486360 6:64228001-64228023 CATCATCTATAGCATGATTCAGG + Intronic
1009737089 6:67690269-67690291 CCTTCAGAATAGCATTATTCTGG - Intergenic
1010842346 6:80661438-80661460 CATTCTCCACAGCATGCCTCAGG - Intergenic
1021262422 7:18474758-18474780 CCGTCTCCATAGCAAGAATCTGG + Intronic
1023231172 7:38031213-38031235 CCTTTTCCATAGAATACTTCAGG + Intergenic
1026496131 7:70905002-70905024 CTGTCTCCATAGAATGTTTCTGG + Intergenic
1028845834 7:95478951-95478973 CCTTGTCCACAGACTGATTCAGG - Intronic
1029989068 7:104946485-104946507 CCTCCTCCAGAGCATGCTTTGGG - Intergenic
1031852623 7:126883706-126883728 TCTTCTGCTTTGCATGATTCTGG - Intronic
1036173760 8:6516021-6516043 ACTTCTCCCCAGCATGGTTCTGG + Intronic
1039080712 8:33731609-33731631 CCCTCTCCATGGCATGGTCCAGG - Intergenic
1042045861 8:64650891-64650913 CCTTCTCCATAGAATGCTGTGGG + Intronic
1043015579 8:74936396-74936418 CCTTCTTCATAGCTTGAACCCGG + Intergenic
1044414454 8:91920468-91920490 CTTTCTCCATATGATTATTCAGG - Intergenic
1051794312 9:20847586-20847608 CCTTCCCCAAAGCATAATCCAGG - Intronic
1053794107 9:41709395-41709417 CCTTCTCAAGTGCAGGATTCAGG - Intergenic
1054182514 9:61921434-61921456 CCTTCTCAAGTGCAGGATTCAGG - Intergenic
1054470845 9:65536544-65536566 CCTTCTCAAGTGCAGGATTCAGG + Intergenic
1054655994 9:67667045-67667067 CCTTCTCAAGTGCAGGATTCAGG + Intergenic
1055086799 9:72322776-72322798 CCTTCTACCTAGCATAACTCAGG - Intergenic
1056291584 9:85148961-85148983 CCTGTTCCATAGCAAGATTTGGG + Intergenic
1057267289 9:93626839-93626861 CCTTCTCCATTGCATGGTCTAGG + Intronic
1057530870 9:95844797-95844819 CTTTCTCCATTGAATGATTTTGG + Intergenic
1058758681 9:108107824-108107846 CCTTCTTCAGCGCATCATTCTGG - Intergenic
1059970532 9:119663270-119663292 TTTTCTGCATAGCATGCTTCAGG + Intergenic
1187356986 X:18584849-18584871 ATTTCTCCATACCATGAATCAGG - Intronic
1188166123 X:26866531-26866553 CCTTCTCCATAGCATAATCAGGG + Intergenic
1188769929 X:34140774-34140796 TTTTCTCTATAGCATAATTCAGG + Intergenic
1190169467 X:48100421-48100443 CCATCTACATTGCATGTTTCTGG + Intergenic
1193418650 X:81256013-81256035 TCTTCTTCATAGAATGATTTGGG + Intronic