ID: 1113454512

View in Genome Browser
Species Human (GRCh38)
Location 13:110438563-110438585
Sequence TGGCTGGAGGGGCCGCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113454501_1113454512 8 Left 1113454501 13:110438532-110438554 CCTGGAGCAGAGGATGACACGTG 0: 1
1: 0
2: 0
3: 32
4: 1065
Right 1113454512 13:110438563-110438585 TGGCTGGAGGGGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113454512 Original CRISPR TGGCTGGAGGGGCCGCCCCT GGG Intronic
900310874 1:2032596-2032618 TGGGTGGAAGGCCCGCCCTTGGG - Intergenic
900344349 1:2204014-2204036 AGGCTGGAGGGGCTGCCCCAGGG - Intronic
900366556 1:2314142-2314164 TGGCTGGTGTGGCCGGCACTGGG + Intergenic
900460877 1:2801662-2801684 TGGCTGGAGGGCCCAGGCCTGGG + Intronic
900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG + Intronic
900673486 1:3869989-3870011 GGGCTGCAGGGCCCGCCCCAGGG + Intronic
900946757 1:5835127-5835149 TGGCTGGATGAGACTCCCCTGGG - Intergenic
902748170 1:18487338-18487360 TGGCTGGAGGGGCCATCCAGGGG + Intergenic
905883714 1:41480585-41480607 TGGCTGTAGGGGCAGCCTCTGGG - Intronic
907764824 1:57398767-57398789 AGGCTGGAGATGCCGCCTCTGGG + Intronic
910439640 1:87239515-87239537 CGGCTGGAGGGGACCCCCATGGG - Intergenic
914882379 1:151557418-151557440 TGGCTGTAGGGGCCGGGGCTGGG - Intronic
915952977 1:160202315-160202337 TCACTGGAGGGGCCACCTCTGGG - Intergenic
916890075 1:169106012-169106034 TGGCTGGGGGATCCGCACCTGGG - Intronic
917791410 1:178501505-178501527 TGGATGGAGGGGCAGCTCTTAGG + Intergenic
917959759 1:180132799-180132821 TGGCTGGAGGAGCACCCCATGGG - Intergenic
918040766 1:180912803-180912825 GGGCTGGAGGAGCCGGGCCTCGG - Intergenic
922672413 1:227520864-227520886 AGGCTGGAGGGGCCTGCCCTCGG - Intergenic
922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG + Intergenic
923089301 1:230727287-230727309 TGGCTTGGGGGGCCACCCATGGG - Intergenic
923596898 1:235367458-235367480 TGGCTGGAGGGGCTGCTGCTGGG + Exonic
924442344 1:244096723-244096745 TTGCCGGAGGGGGCTCCCCTTGG + Intergenic
924826760 1:247547745-247547767 TGGCTGGAGTGGCATCACCTGGG + Intronic
1062857860 10:788332-788354 TGGCTGGAGGGTCAGCACCCAGG + Intergenic
1062903937 10:1166949-1166971 TGGCTGGAGGGCCAGTCCCAGGG - Intergenic
1063098847 10:2932296-2932318 TGGCTGAAAGGCCAGCCCCTGGG + Intergenic
1066462158 10:35621598-35621620 TGGCTGGAGGGGATGCCCAGTGG + Intergenic
1067084494 10:43230586-43230608 TGGCCGGCGGGGCGGCCGCTAGG + Intronic
1068783467 10:60944839-60944861 TGGCGGGAGGGGTCCCCCCAGGG + Intronic
1069922719 10:71826774-71826796 TGGGTGGAGTGGCCGGCTCTAGG - Intronic
1070687821 10:78502744-78502766 TGGCTGGAGAGGCTGCCCTTGGG + Intergenic
1071511751 10:86266550-86266572 GGGCAGGAGGGCCCTCCCCTGGG - Intronic
1075738121 10:124676614-124676636 TGGCTGGGGGGGCTTCACCTGGG + Intronic
1076791462 10:132779058-132779080 GGGCTGGAGGCGGGGCCCCTTGG + Intronic
1077137729 11:1009554-1009576 GGTCTGGAGGGGCGGCCCCGGGG + Intronic
1077137748 11:1009604-1009626 GGTCTGGAGGGGCGGCCCCGGGG + Intronic
1077319339 11:1934219-1934241 TGTCTGGAAGGGCCCACCCTGGG - Intronic
1081887648 11:46512675-46512697 TGGGGGGAGGGGCGGCCCTTGGG - Intronic
1083994623 11:66265942-66265964 TGGCTGGGGGTGCCGGGCCTCGG + Exonic
1084441863 11:69179155-69179177 GGGCTGGATGGGCAGCACCTCGG + Intergenic
1084857944 11:72000818-72000840 TGGGTGGAGGGGCTGGCCTTGGG - Intronic
1085386628 11:76161544-76161566 TGGATGGAGGGGCTGGGCCTGGG + Intergenic
1085544165 11:77301677-77301699 TGGCTGGAAGGGCAGCCCGAGGG + Intronic
1088368084 11:109059911-109059933 TGGGTGGAAGAGCCGCCTCTGGG - Intergenic
1089364814 11:117915263-117915285 TGCCTGGAGGCACCTCCCCTTGG + Intronic
1091779123 12:3202767-3202789 TGGCTGGAGGGCCCAACCCATGG - Intronic
1092020507 12:5198729-5198751 TAGCTGGAGGGGCCCCCGCTTGG - Intergenic
1093043142 12:14408521-14408543 TGGCTGCAGGGGGCTCCCTTTGG + Intronic
1094812207 12:34149551-34149573 AGGCTGGAGGGGCCTTCCCTAGG + Intergenic
1099996671 12:89786426-89786448 TGGCTGGAGGTGAAGCACCTGGG - Intergenic
1100391459 12:94148948-94148970 GGGCTGGGGGGGCCGCCCCCGGG - Exonic
1101000971 12:100356956-100356978 TGGCTGGAGGGGCTGGAGCTAGG + Intergenic
1101814708 12:108136948-108136970 TGGCTGGAGGGTCCCCTGCTAGG + Intronic
1101870664 12:108562784-108562806 GGGCTGGAGGGGCGGCCGCGGGG + Intronic
1102579466 12:113877072-113877094 TGGCTGCAGGGGCAGCCCAGTGG - Intronic
1103322330 12:120099376-120099398 GGGCGGGAGGGCCAGCCCCTGGG + Intronic
1103433165 12:120904591-120904613 TGGCTGGTGCAGCAGCCCCTCGG - Intergenic
1104477380 12:129081909-129081931 TGGCTGAGGCGGCCGGCCCTGGG - Exonic
1104728919 12:131094477-131094499 TGGGTGGAGGGGCCTCTCCTTGG - Intronic
1104747346 12:131218956-131218978 TGGGAGGAGTGGCCGCCCCGAGG + Intergenic
1104789266 12:131471740-131471762 GGGATGGAGGGGCCGGCTCTGGG - Intergenic
1104927438 12:132321110-132321132 TTCCTGGCGGGGCCGCCCCCTGG - Intronic
1106809953 13:33349998-33350020 TACCTGGAGGGGCTGCCCCCGGG - Intronic
1112561737 13:100521334-100521356 GGGCTGGACGGGTGGCCCCTGGG + Intronic
1112611806 13:100962460-100962482 TGGATGGAGGGGCAGCGCTTAGG + Intergenic
1113454512 13:110438563-110438585 TGGCTGGAGGGGCCGCCCCTGGG + Intronic
1113649654 13:112026675-112026697 GGGCTGGTGGGGCCACCTCTTGG + Intergenic
1119046132 14:71320561-71320583 TGGCTGCGGGGGCGGCCTCTGGG - Intronic
1121309699 14:92929150-92929172 TGGCTGCAGGCGCCAACCCTGGG + Intronic
1121671467 14:95713897-95713919 AGGCAGCAGGGGCAGCCCCTGGG - Intronic
1122242251 14:100376521-100376543 GGGCTGGAGGGGCCGGGACTGGG + Exonic
1122890030 14:104727930-104727952 GGGCTGAAGGGGCCTGCCCTGGG + Intronic
1125520690 15:40346362-40346384 GGGCTGGAGGGACCAGCCCTAGG + Intergenic
1129407206 15:75327673-75327695 GGGCTGGAGGTGCAGCTCCTTGG - Intergenic
1130892533 15:88145243-88145265 TGGCTGGAGGGGCCGCGTGTTGG - Intronic
1131263408 15:90902001-90902023 TGGTTGAAGGGGCCGACTCTCGG + Intergenic
1132696468 16:1204323-1204345 AGGCTGGATGGGCCGCCTCTGGG + Exonic
1132757828 16:1494501-1494523 TGGCTGGAGCTGCTGCCCCATGG + Exonic
1132759207 16:1500748-1500770 GGGCTGGAGAGGCAGCCGCTCGG - Intronic
1135173710 16:20209636-20209658 TGGCAGGAGGGGCTGTCCTTTGG - Intergenic
1135403791 16:22184040-22184062 TGGCTGCAGGGTCTGCCCCCTGG + Intronic
1135485923 16:22864557-22864579 TGGCTGCAGGGGCCCCTCCTGGG + Intronic
1136011626 16:27367265-27367287 GGGCAGGAGGGGACGCCCCTGGG + Intergenic
1137027050 16:35486667-35486689 TGGGTGGGGGGGCCACCCCACGG - Intergenic
1137531474 16:49281404-49281426 TGGCTGGCGGGCCCGGCCCGCGG - Exonic
1138551729 16:57752329-57752351 TGGCTGTTGGGGCCAACCCTGGG + Intronic
1139062036 16:63264015-63264037 TGGCTGGAGCTGCAGCCTCTGGG + Intergenic
1139207846 16:65046396-65046418 TGGCTGGAGGTGCCCCTCTTTGG - Intronic
1139481687 16:67234223-67234245 TGGCTGCAGGGGCTGTCTCTGGG + Exonic
1141132237 16:81444592-81444614 CGACGGGAGGGGCAGCCCCTGGG - Intergenic
1141380374 16:83570990-83571012 TAGCTGGAGGTGCTGGCCCTTGG - Intronic
1141655342 16:85413048-85413070 CTGCTGGAGGGGCCGCCCCACGG + Intergenic
1142027871 16:87824157-87824179 TGGGGGGAGGGGCCACGCCTTGG - Intergenic
1142612466 17:1116764-1116786 TGGGTGGCAGGGCAGCCCCTGGG + Intronic
1142631853 17:1230399-1230421 TGGCTGCAGGGGCCGCGGCCTGG + Intergenic
1143118351 17:4593007-4593029 TGGCTGGTGGGGCAGCCGCAAGG - Exonic
1143130130 17:4672594-4672616 TGGCAGGGGGGGAAGCCCCTCGG + Exonic
1143729792 17:8874574-8874596 TGTCTGGAGGAGCCCCCTCTCGG + Intergenic
1145785619 17:27591936-27591958 TAGCCGGAGGGGCTGCCCTTTGG + Intronic
1151975270 17:77480741-77480763 TGGCGGGAGGGGCCCTGCCTGGG + Intronic
1152696536 17:81800492-81800514 AGGGTGGTGGGGCTGCCCCTCGG - Intergenic
1154358626 18:13641692-13641714 GGGCTGGCGGGGCCGCCAGTCGG + Intronic
1157763151 18:50279958-50279980 TGGCTGGACTGCCCGGCCCTGGG - Exonic
1157987677 18:52458219-52458241 CGGCTGCAGGGGCTGCCCCTGGG + Intronic
1159988519 18:74874474-74874496 TGGCTGGAGGGGCATCTCCTTGG + Intronic
1160981370 19:1818053-1818075 TGGCTTTAGGGGCCGCCACAGGG + Intronic
1161105821 19:2443491-2443513 TGGCAGGAGGGGTGGCACCTCGG - Intronic
1161219889 19:3113651-3113673 TCCCTGGAGGGGCCACGCCTTGG + Intronic
1161317147 19:3622622-3622644 AGGCAGGAGGGGCCTCCCCTCGG + Intronic
1161560132 19:4968710-4968732 TGGCTTGAGGGGCCAGCCCGAGG - Intergenic
1161979932 19:7625020-7625042 TGGCTGGGGGAGCCGCCAGTGGG - Intronic
1162042790 19:7980533-7980555 CTGCTGGAGGTGCTGCCCCTGGG + Intronic
1162733746 19:12734398-12734420 CGGCAGGAGGAGCCGCCCCCGGG - Exonic
1162798768 19:13099769-13099791 GGGCAGGAGGGGCCGCCCTTTGG - Intronic
1163826728 19:19528316-19528338 TGGATCCAGGGGCAGCCCCTAGG - Intronic
1163828869 19:19538409-19538431 GGGCTGGAGGCGCCTCACCTCGG - Exonic
1164137500 19:22427817-22427839 AGGCCGAAGGTGCCGCCCCTGGG + Intronic
1164160708 19:22623878-22623900 AGGCCGAAGGTGCCGCCCCTCGG - Intergenic
1164387927 19:27793187-27793209 TGGCTGCAGGGCCCACACCTGGG - Intergenic
1165095019 19:33405590-33405612 TGTCTGCAGGGGCCGCCCACTGG - Intronic
1165874846 19:38998992-38999014 TGGCTGGAAGGGCCCACCCTGGG - Intronic
1166213926 19:41323769-41323791 TGGCCGCAGGGCCCGCCCCATGG + Exonic
1166566097 19:43766649-43766671 GGGCTGGAGGTGGCGCCCCCTGG - Exonic
1167152695 19:47719043-47719065 TGGCTGGCGGGGCAGCCGCAGGG + Intronic
1167360970 19:49030162-49030184 TAGGTGGAGGGGCTGCCGCTGGG + Intronic
1167650300 19:50725024-50725046 TGCCTGAAGGGGCTGCGCCTGGG + Exonic
925148077 2:1594416-1594438 TGTCTGCAGGAGCTGCCCCTCGG - Intergenic
926035186 2:9630744-9630766 TGGCGGGAGCGGCCGCGGCTCGG - Intronic
926052488 2:9753842-9753864 TGGCTGGAGGCACCCCCCGTCGG - Intergenic
926212086 2:10878708-10878730 TGTCTGGTGGGGCCTCCCTTTGG + Intergenic
927692049 2:25215411-25215433 GGCCTGGAGGAGCCTCCCCTGGG - Intergenic
928339456 2:30429246-30429268 TGCCTGTAGGGGTGGCCCCTTGG - Intergenic
930812891 2:55561113-55561135 TGGCTGGAGCTGCAGCACCTGGG - Intronic
932321968 2:70829023-70829045 AGGCTGGAGGGGCCGTCACGTGG - Intergenic
933966408 2:87432993-87433015 TGGCTGGAGGGGCTGGCCATAGG - Intergenic
934980597 2:98836602-98836624 TGGTTGGAGGGGCCACTCCCAGG + Intronic
935692800 2:105745392-105745414 TGGCTGGCGTCCCCGCCCCTGGG - Intronic
936327387 2:111517492-111517514 TGGCTGGAGGGGCTGGCCATAGG + Intergenic
937122633 2:119451510-119451532 GGCCTGGAGGGGCGGCCCCAGGG - Intronic
937374174 2:121323927-121323949 TGGCAGGAAAGGCCGCCCCTAGG + Intergenic
937884028 2:126888033-126888055 TGGATGGAGGGTCAGGCCCTGGG - Intergenic
937913145 2:127085846-127085868 TGGCAGGAGGGGCTGGCTCTAGG + Intronic
938087730 2:128412321-128412343 AGGCTGGATGGGATGCCCCTGGG + Intergenic
938723568 2:134087369-134087391 TGGCTGGGGAGGCAGACCCTGGG - Intergenic
946453274 2:219799457-219799479 AGGCTGGAGGGGCTCCCCCTGGG + Intergenic
947588347 2:231370610-231370632 TGGATGGAGGGGCCGCCAGAAGG + Intronic
948934760 2:241156117-241156139 AGGCTGGAGGAGCCAGCCCTTGG + Intronic
1169074294 20:2751876-2751898 GGGACGGAGGGGCAGCCCCTGGG - Intronic
1171013477 20:21521320-21521342 GGGGCGGAGGGGGCGCCCCTCGG + Intergenic
1171975680 20:31593466-31593488 CAGCTGGAGGCGCCGCCCCCTGG + Intergenic
1172573334 20:35987178-35987200 TGGCTGGAGGGGAGGGCCTTGGG + Intronic
1172790906 20:37504854-37504876 TGGATGGTGGGGAGGCCCCTGGG - Intronic
1173004917 20:39132914-39132936 TGGTTGTTGGGGCCACCCCTGGG + Intergenic
1173726328 20:45300906-45300928 TGCCTGAAGTTGCCGCCCCTCGG + Exonic
1174204356 20:48828053-48828075 GGGCGGGAGGGGGCGGCCCTCGG + Intergenic
1174287377 20:49482838-49482860 TGGAGGGAGGGGCCGCCCCTCGG + Intergenic
1174661642 20:52218878-52218900 GGGCTGGAGGCACAGCCCCTGGG - Intergenic
1175901457 20:62361462-62361484 TGGCTGGAGGGCCGGCCCCAAGG - Intronic
1175923512 20:62461096-62461118 AGGCTGGAGGGGCCGCTGCAAGG + Intergenic
1175936124 20:62514877-62514899 TGGCTGGAGGTCCCTTCCCTGGG + Intergenic
1176168138 20:63685249-63685271 TGGCGGGAGGAGAGGCCCCTCGG + Intronic
1177235840 21:18388988-18389010 TGGGTGTAGGGGCAGCTCCTGGG + Intronic
1177782930 21:25639612-25639634 GGGCTGGAGGACCCGCCTCTTGG + Exonic
1178830588 21:36053304-36053326 TGGCTGGTGGGGCAGTCCCATGG - Intronic
1180055445 21:45356671-45356693 TGCCTGCAGGGAACGCCCCTTGG - Intergenic
1180701637 22:17784484-17784506 GGGCTAGAGGGGCAGGCCCTGGG + Intergenic
1181082626 22:20424928-20424950 TGGCTGGAGGCTCCCTCCCTTGG - Exonic
1182322269 22:29485618-29485640 TGGCTGGATGGGCCTGCTCTGGG + Intronic
1183708175 22:39487717-39487739 ATGCTGGAGAGGCCGCCCCCGGG + Exonic
1184306571 22:43606995-43607017 TGGCTGGGGGTGCTGGCCCTGGG - Intronic
1184479744 22:44739315-44739337 GGGCAGGAGGGGAGGCCCCTGGG + Intronic
1185057284 22:48587637-48587659 TGGCTGATGGGGCCGCCCTGTGG + Intronic
1185068602 22:48644292-48644314 GGGCAGCAGGGGCCTCCCCTGGG - Intronic
950129314 3:10531112-10531134 TTGCAGGAGGGGCAGCCTCTGGG + Intronic
950170650 3:10837072-10837094 TGGCAGGAGGGGCTGGCCCTGGG + Intronic
952338679 3:32427155-32427177 TGGCTGGAGGGACCACTCCCTGG + Intronic
953210863 3:40873805-40873827 TGATTGGAGGTGCCTCCCCTGGG - Intergenic
953413127 3:42701350-42701372 TGGCTCTAGGGGCAGCACCTGGG - Intronic
953785820 3:45910397-45910419 TGGTTGGTGGTGCTGCCCCTGGG + Intronic
953905259 3:46865412-46865434 TGGGTGGTGGGGCCTCCCCGGGG - Intronic
953916161 3:46922417-46922439 TTGCTGGAGGGGGCTGCCCTGGG + Intronic
954097311 3:48338702-48338724 TGGCTGCAGGGGCCTCCCTGCGG - Intergenic
954689647 3:52388786-52388808 GAGCTGGAGGGGCAGCCCCGTGG - Exonic
954709941 3:52500574-52500596 TGGCTGGAGGTCCAGCCCCACGG + Intronic
955019649 3:55106936-55106958 TGGCTGGAGTGACCCGCCCTTGG + Intergenic
955409672 3:58647442-58647464 TGGCTGGAGGTGGGGCCCCAAGG - Intronic
960993263 3:123325294-123325316 TGGCTGGTGGGGCAGCCTGTGGG - Intronic
961044909 3:123701406-123701428 GGCCTGGAGGGGCAGCTCCTGGG + Intronic
961449851 3:126997779-126997801 TGGCTGGCAGGGCCACCCATGGG + Intronic
966172862 3:177101642-177101664 AGGCTTGAGGGGCCGCCTGTGGG - Intronic
966860617 3:184229513-184229535 AGGCTGGAGGGGCGGCCTCTCGG + Intronic
967298558 3:187989735-187989757 AGGCTGAAGGGGCCACCCCTTGG - Intergenic
968556874 4:1249963-1249985 AGTCTGCAGGGGCAGCCCCTGGG - Intergenic
968573268 4:1353503-1353525 GGGATGCAGGGGCCTCCCCTGGG + Intronic
968664137 4:1811384-1811406 TGGCTGCAGGGGCTGGGCCTTGG - Intergenic
969685541 4:8672066-8672088 TGGCTGGAGGGAGCCCACCTGGG + Intergenic
971957152 4:33435331-33435353 GGGCTGGAGTGGCAGCCCTTTGG - Intergenic
977429961 4:96919748-96919770 TGGCTGGGGAGGCCTCCCTTAGG + Intergenic
983087941 4:163470263-163470285 TAGCTGGAGGGGAAGCCCTTAGG - Intergenic
985588450 5:752766-752788 TGCCTGGAGGGGCTGCTGCTTGG - Intronic
985603122 5:845221-845243 TGCCTGGAGGGGCTGCTGCTTGG - Intronic
985665849 5:1181209-1181231 TGCCAGCAGGGGCGGCCCCTCGG - Intergenic
985884889 5:2670141-2670163 AGGCTGGAGGGGCCCCTCCAAGG - Intergenic
985912778 5:2896467-2896489 TGGCAGGAGTGGCAGCTCCTAGG - Intergenic
997337596 5:133119006-133119028 TGGCTGCAGGGGACTCCCATGGG + Intergenic
997362398 5:133303455-133303477 TGGCTGGAGAGCCAGACCCTGGG - Intronic
998192855 5:140042235-140042257 GGGGGGGTGGGGCCGCCCCTGGG - Intronic
999317878 5:150595948-150595970 AGCATGGAGGGGCCTCCCCTGGG + Intergenic
1001745451 5:174089218-174089240 TTACTGGAGGTGCTGCCCCTCGG - Intronic
1002581481 5:180211792-180211814 TGGCTGCAGGTGCCACCACTGGG + Intergenic
1004326250 6:14676407-14676429 AGGCTTCAGGGGCAGCCCCTGGG + Intergenic
1007767644 6:44170396-44170418 GGGCTGGAGGGTCTGCTCCTAGG + Intronic
1008501803 6:52190816-52190838 TGGCTGGAGAGGCCAACCCCTGG - Intergenic
1013441780 6:110179179-110179201 TGGCTGCAGGGACCGCCCCGGGG - Intronic
1013974422 6:116060516-116060538 TGGCTGGAGGTGCTACCCCGAGG + Exonic
1014913372 6:127118818-127118840 CGGCTGCAGCGGCGGCCCCTTGG - Exonic
1017718693 6:157229849-157229871 TGCCTGGAGTGTCCTCCCCTAGG - Intergenic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1018998431 6:168727562-168727584 GCGCTGGAGGGGCTGCTCCTGGG + Intergenic
1019212801 6:170420066-170420088 GTGCTGGAGGTGCCACCCCTCGG + Intergenic
1019287040 7:228863-228885 TGGCTGGAGGGTCCCACGCTGGG + Exonic
1019343457 7:519041-519063 CGGCTGGAGCGCCCGCCCCGCGG - Exonic
1020059960 7:5144426-5144448 CGTCTGGAGGAGCCGCCCCCAGG + Intergenic
1022943191 7:35258369-35258391 GGCCTGGAGGCGCCGCGCCTTGG - Intergenic
1023345964 7:39271522-39271544 TGGCTGTAGGAGCTGCTCCTTGG - Intronic
1023866844 7:44242405-44242427 TGGCTGGAGATGAAGCCCCTTGG - Intronic
1025996628 7:66531465-66531487 TGGGTAGAGGGGCCCCTCCTTGG - Intergenic
1026878555 7:73893846-73893868 GGGCTGGGGGAGCCTCCCCTGGG - Intergenic
1026988681 7:74570868-74570890 TGGGTAGAGGGGCCCCTCCTTGG - Intronic
1029117332 7:98244115-98244137 TGTCAGGTGGGGCTGCCCCTGGG - Intronic
1029675200 7:102063940-102063962 TGGTGGGAGGGGCCGCGGCTGGG + Intronic
1032270311 7:130398946-130398968 TGGCTGGCGGGGCCGCCACCTGG + Exonic
1034322869 7:150201230-150201252 TGGCAGGTGGGGCAGCACCTGGG - Intergenic
1034770316 7:153767893-153767915 TGGCAGGTGGGGCAGCACCTGGG + Intergenic
1034969788 7:155411657-155411679 TGGCTGGAGGGGTCAGCCCTTGG - Intergenic
1035119826 7:156557433-156557455 TGACTGCAGGCTCCGCCCCTGGG - Intergenic
1035268936 7:157708526-157708548 TGGACGGAGGGGCCGTCCCAGGG + Intronic
1037581097 8:20246508-20246530 TGGCTGGAGGAGCAGCAGCTTGG - Exonic
1037819131 8:22127318-22127340 TGGCTGGGGGGACAGGCCCTGGG + Exonic
1037879891 8:22567380-22567402 TGGCTGCTGGGTCCTCCCCTGGG - Intronic
1037902723 8:22697026-22697048 TGGCAGGAGGGGACAACCCTGGG + Intergenic
1039824710 8:41163340-41163362 AGGCTGGAGGGACCTCCCTTCGG - Intergenic
1044591543 8:93917581-93917603 TGGATGGAGGGGCTGGCCCTCGG + Intronic
1044710092 8:95048883-95048905 TGGCTGAGGGTGCAGCCCCTGGG - Intronic
1047771190 8:128031289-128031311 TGGCTGGGCGAGCAGCCCCTGGG - Intergenic
1048406554 8:134128382-134128404 TGGATGGAGTGCCAGCCCCTGGG + Intergenic
1048974729 8:139664802-139664824 TGGCTGGAGGAGCTGGCTCTTGG - Intronic
1049660177 8:143816248-143816270 TGGCAGGAGGGGCCTGCCGTGGG - Intergenic
1049747846 8:144270556-144270578 TGGCTGGCGGGCCGGGCCCTCGG - Intronic
1049780352 8:144425953-144425975 GGTCTGGAGGGGCTGCCCCAGGG + Intronic
1050109556 9:2200505-2200527 TGGCTGGAGCTGGAGCCCCTGGG + Intergenic
1051641792 9:19230641-19230663 TGGCTGTAGGCGGCGCCCCTCGG + Exonic
1053072108 9:35107731-35107753 GGCCTGGAGGGGCTGGCCCTGGG + Exonic
1056788707 9:89611319-89611341 TGGCTGGAGGGAGCTCACCTGGG + Intergenic
1057492021 9:95527860-95527882 TGGCTGGAGATGCTGCCCCAGGG + Intergenic
1057704105 9:97385764-97385786 GGGCTGGAGGAGCCGGCCCAGGG + Intergenic
1060831976 9:126722777-126722799 GGCCTGGTGGGGCCACCCCTCGG + Intergenic
1060968280 9:127723697-127723719 TGGCTGGGTGGACCGCCCCCTGG - Intronic
1061208445 9:129177398-129177420 CGGCCGGAGGGGCGGCCCCTGGG + Exonic
1061225850 9:129280666-129280688 AGGCTGGAGGAGCAGCCCCCAGG - Intergenic
1062443718 9:136584644-136584666 TGGCTGCAGCGCCGGCCCCTGGG - Intergenic
1062539626 9:137035818-137035840 TGGCTGGGTGGGCCGGCCCCGGG - Exonic
1199979913 X:152915223-152915245 TGGCTGGTGGGTCAGCCCCAGGG + Intronic