ID: 1113457044

View in Genome Browser
Species Human (GRCh38)
Location 13:110456762-110456784
Sequence GATGCTGGTGCCTCACAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113457037_1113457044 7 Left 1113457037 13:110456732-110456754 CCTGTGTCTGGGGGGACCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 346
Right 1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 150
1113457034_1113457044 13 Left 1113457034 13:110456726-110456748 CCATGCCCTGTGTCTGGGGGGAC 0: 1
1: 0
2: 3
3: 21
4: 241
Right 1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 150
1113457041_1113457044 -10 Left 1113457041 13:110456749-110456771 CCTGGGCATCCTTGATGCTGGTG 0: 1
1: 0
2: 0
3: 21
4: 187
Right 1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 150
1113457040_1113457044 -9 Left 1113457040 13:110456748-110456770 CCCTGGGCATCCTTGATGCTGGT 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 150
1113457033_1113457044 14 Left 1113457033 13:110456725-110456747 CCCATGCCCTGTGTCTGGGGGGA 0: 1
1: 0
2: 2
3: 21
4: 179
Right 1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 150
1113457035_1113457044 8 Left 1113457035 13:110456731-110456753 CCCTGTGTCTGGGGGGACCCTGG 0: 1
1: 0
2: 4
3: 32
4: 295
Right 1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113457044 Original CRISPR GATGCTGGTGCCTCACAACT GGG Intronic
900953583 1:5873418-5873440 GAGGCTGGTGGCTCCCAGCTGGG - Intronic
901561504 1:10075364-10075386 GATGCTGGTGCCTTGGACCTGGG - Intronic
902600644 1:17538663-17538685 GAGGCTGGTGCCTGACAAATAGG + Intergenic
905659795 1:39712679-39712701 GATGCTGGTGCCTTTGAACCTGG - Intronic
907610046 1:55860071-55860093 GACGCTGTTGCCTCACAGCAAGG + Intergenic
912463323 1:109852054-109852076 GATGCTGGTGACCCACAGATGGG - Intergenic
915601305 1:156924606-156924628 GAGGCAGGTGCCTCAGACCTGGG - Intronic
915674708 1:157519330-157519352 GAAGATGGAGCCGCACAACTTGG - Intronic
918148181 1:181776163-181776185 CATCCTGGGGCCTCACCACTTGG + Exonic
921481092 1:215665342-215665364 CATTCTGGTGCCTCATGACTGGG - Intronic
921980857 1:221257268-221257290 GATGCTGGTAGCTCACATCAGGG + Intergenic
922652779 1:227355521-227355543 GAGGCTGTTGCCTCACAAAATGG - Intergenic
922921194 1:229306205-229306227 GAGGCTGGTGACCAACAACTTGG - Intergenic
1065259083 10:23906034-23906056 GTTGCTGGTTCCTCACATGTTGG + Intronic
1068235718 10:54230324-54230346 GATCCTTGTGCTACACAACTGGG - Intronic
1068942588 10:62694095-62694117 GTTGCTGCTGCCTCACCTCTGGG - Intergenic
1069733981 10:70639303-70639325 GCTGCTGGTGCCTGAGCACTGGG + Intergenic
1072719522 10:97772000-97772022 GATCCTGGCGCCTCCCACCTCGG + Intergenic
1072781157 10:98252735-98252757 GAGGCTGGTGCCTGACAGCAAGG + Intronic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1078247886 11:9592659-9592681 GATGCTGCTGCTTAAGAACTGGG - Intronic
1079341721 11:19617184-19617206 GACCCTGCTGCCTCTCAACTAGG - Intronic
1082221493 11:49643655-49643677 CATGCTGATGCCTCCCACCTAGG - Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1086321867 11:85657782-85657804 GATTCTTTTGCCTCATAACTGGG - Intergenic
1086627551 11:88975497-88975519 CATGCTGATGCCTCCCACCTAGG + Intronic
1088493345 11:110407540-110407562 GATGCTGATGCCACACCCCTTGG + Intergenic
1090681887 11:129068450-129068472 GATGCTTGTACATCATAACTTGG - Intronic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1092840723 12:12538720-12538742 GAGGCTGTTGCCTCACCATTTGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1097000926 12:55875901-55875923 GCTGCTGAGGCCTCAGAACTGGG - Intergenic
1099352218 12:81587856-81587878 CATAATGGTGCCTCACAACAAGG + Intronic
1105825991 13:24123993-24124015 GATGCTGGTGCCGTCCAGCTTGG + Intronic
1111092252 13:83462461-83462483 GCTCCTTGTGCCTCCCAACTGGG + Intergenic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1115467192 14:33728419-33728441 AATGCTGAAGACTCACAACTGGG + Intronic
1118393750 14:65318133-65318155 CTTGCTGGTCCCGCACAACTAGG - Intergenic
1118720974 14:68593622-68593644 GATGCAGGTGCCTGGCACCTGGG + Intronic
1120727940 14:87966931-87966953 GATTCTGATGCCACACAAGTTGG - Intronic
1121309980 14:92930428-92930450 GATCCTGGTGTCTCCCATCTGGG + Intronic
1122406270 14:101502923-101502945 GAAGCGGGTGCCACAGAACTGGG + Intergenic
1126536495 15:49771332-49771354 GATGATGGTGCCTAATGACTGGG + Intergenic
1132900269 16:2250375-2250397 GCTCCTGGTGCCTCTGAACTTGG - Intronic
1134322718 16:13178411-13178433 GATGCTTCTGCCTCCCATCTTGG + Intronic
1137275497 16:46930417-46930439 GAGGCTGCTGCCTCACTCCTCGG - Exonic
1141708180 16:85681251-85681273 GATGCTGGTGGCTCACACTGGGG + Intronic
1145962652 17:28896746-28896768 GGTCCTGGTGCCTGACAGCTTGG - Intronic
1146404874 17:32528370-32528392 GAAGCTGGCTCCTCAGAACTGGG + Intronic
1147585715 17:41653003-41653025 AATGCTGAGGCCTCAGAACTGGG + Intergenic
1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG + Intergenic
1150857293 17:68765352-68765374 GATGATGGTGCCTCAGACCAAGG + Intergenic
1152105179 17:78324535-78324557 GATGCTGGTGCCTAACAAAGGGG - Intergenic
1155891724 18:31278616-31278638 GCTGCTGATGCCACTCAACTGGG + Intergenic
1155910669 18:31501108-31501130 GATACTGCTGCATCACAAATTGG + Intronic
1158591293 18:58780984-58781006 GATCCTGTTGCCTCAGAGCTAGG - Intergenic
1158706721 18:59798915-59798937 GCTGCTGGAGCATCACCACTTGG + Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1161887030 19:7005086-7005108 GATGATGGCGCCCCACACCTCGG + Intergenic
1162475516 19:10897162-10897184 GATGCTGGTGCCAGTCACCTCGG + Intronic
1163708936 19:18833744-18833766 TATGCTGGTGTTTCAGAACTGGG + Intronic
1163850010 19:19657380-19657402 GATGGTGGTGCCTGACTTCTCGG - Exonic
1163926946 19:20355116-20355138 GATCCAGGAGCCTCAAAACTGGG + Intergenic
925697977 2:6602654-6602676 TAAGCTGGTGACTCACCACTAGG + Intergenic
925825356 2:7843093-7843115 GATGCTGGTGCCACTGACCTGGG + Intergenic
928649660 2:33390917-33390939 CATGCTGTTGCCCCAGAACTGGG - Intronic
929568708 2:43006487-43006509 GATGCTTGTGTCTCATACCTCGG + Intergenic
934899813 2:98150540-98150562 GATGGTGGTGCCTGCCCACTAGG + Intronic
935289384 2:101596764-101596786 GATCCTGCTGCCTCAGGACTGGG - Intergenic
935644487 2:105322976-105322998 GATGCTGGTGCCATATAATTAGG + Intronic
936560523 2:113535109-113535131 GATGGTGGTTCCTGACAAATGGG + Intergenic
937339877 2:121084350-121084372 GCTGCTGCTGCCTCAGCACTTGG + Intergenic
937687667 2:124716274-124716296 GATGATGGTGCCACACATTTAGG - Intronic
942117106 2:172738726-172738748 GATGCTGGGACCTTTCAACTGGG + Intronic
943233684 2:185290829-185290851 GATGCTGGTGACTTACAGATGGG - Intergenic
944496806 2:200315455-200315477 TCAGCTGGTGCCTCACAAATAGG - Intronic
948871543 2:240801672-240801694 GAGGGTGGGGCCTCACAAATGGG + Intronic
1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG + Intergenic
1169637194 20:7705558-7705580 GCTGCTGGTCTCTAACAACTGGG + Intergenic
1171378986 20:24718881-24718903 GGTGCTGGTGACTCACATCAAGG - Intergenic
1174001640 20:47379138-47379160 GATGCTGGTGGCTCAGAGCAGGG + Intergenic
1174188743 20:48725085-48725107 GATGCTGGAGCCTCTGAACTGGG - Intronic
1179767706 21:43585466-43585488 GGTGATGGTGGCTCAAAACTGGG + Intronic
1183565560 22:38611956-38611978 GATGCTGAAGCCGCACACCTGGG + Intronic
950671651 3:14530347-14530369 GATGCTGGGGCTTCTCTACTGGG - Intronic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
953344749 3:42165875-42165897 GATGCTGGTACCCCACTATTAGG - Intronic
953641266 3:44710684-44710706 GAAGATGTTGCCTTACAACTGGG - Intergenic
954653383 3:52178774-52178796 TATTCTGGTGCCTCACAGCCTGG - Intergenic
956239219 3:67110286-67110308 GATCCTGGGGGCTCACAACAGGG + Intergenic
959029703 3:101283981-101284003 GATGCTGGTGGCTCATACCAGGG + Intronic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
966540601 3:181085893-181085915 GATGCTGTTGGCTCACAACCTGG + Intergenic
968435163 4:581638-581660 GGTGGTGGTGACTCACAACAAGG - Intergenic
968600860 4:1508655-1508677 GCTGCTGGGGCCACACACCTGGG - Intergenic
969282814 4:6182564-6182586 GATCATGGTGCCAGACAACTTGG - Intronic
969855210 4:9993778-9993800 GATGCAGGTTCCTCACCTCTTGG - Intronic
971613666 4:28759517-28759539 TATGATGCTGCCTCCCAACTTGG + Intergenic
972261959 4:37417754-37417776 GATTCAGGTTTCTCACAACTGGG + Intronic
978729391 4:112007308-112007330 GATGCTGGTGGATCACAAAATGG + Intergenic
981898263 4:149830970-149830992 TATGCCGGTGTCTCACAAGTAGG - Intergenic
983472521 4:168174315-168174337 CATGGTGGTGCCTGAAAACTTGG - Intronic
983542059 4:168921608-168921630 GATGCTGGTGCGTGAGAACGGGG + Exonic
984280141 4:177660572-177660594 AATTCTGCTGCCTCAGAACTAGG - Intergenic
984852386 4:184165351-184165373 GAGGCTGGAGCCGCACAGCTAGG + Intronic
986613545 5:9593700-9593722 GATTCTGGTGCCTCCCACCGTGG + Intergenic
987043763 5:14087274-14087296 GATGCTGGTGGGTCACCCCTCGG + Intergenic
992307615 5:75459597-75459619 GATCCTCATGCCTCCCAACTGGG + Intronic
993902278 5:93592687-93592709 GCTGCTGCTGCTTCAGAACTGGG - Intronic
995669725 5:114588696-114588718 GATCCTGGTACCTTACAAATAGG + Intergenic
997365770 5:133324367-133324389 CATGCAGGTGCCTCACCCCTGGG - Intronic
998964162 5:147520553-147520575 GTTACTGGTGCCTCCTAACTTGG + Intergenic
999754081 5:154651728-154651750 GATGCTGGTCACTCACAGGTGGG + Intergenic
1001458348 5:171885485-171885507 GAAGCTGCTGCCCCACAAATTGG - Intronic
1001636148 5:173211688-173211710 GATGCTGGCGCGGCACACCTTGG + Intergenic
1002479000 5:179486932-179486954 GCAGCTGGTGCCTCAGAACCAGG - Intergenic
1005848620 6:29801858-29801880 GGAGATGGTGCCTCACAACTAGG - Intergenic
1006707891 6:36037770-36037792 GATGCTGGTTTCTAACTACTGGG - Intronic
1012963084 6:105643691-105643713 GTTGCTGGTGCTTCAGACCTTGG + Intergenic
1014632271 6:123802817-123802839 GAGGCTGGTGCATCTCCACTAGG + Intergenic
1024241279 7:47438502-47438524 GATGGTGGTGCCTCTCACCAGGG - Intronic
1024481535 7:49868227-49868249 GATGCTGTTTCCTAAGAACTTGG + Intronic
1027899600 7:84093949-84093971 GTTCCTGGTGCCTCCCACCTTGG - Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1032180242 7:129669819-129669841 GATCCTGGTGTCTCACTTCTGGG + Intronic
1033367934 7:140685492-140685514 GAAGCTGGTGCCTCCTAAGTAGG - Intronic
1034990053 7:155542481-155542503 GATGCTGGGGCCTCACTGCTGGG + Intergenic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1036909569 8:12744299-12744321 GTTGCTGGTGCCTGAGAACTGGG + Intronic
1044221311 8:89673113-89673135 GATGATGGTGACTCACAGATGGG - Intergenic
1045052415 8:98339433-98339455 TATGCTGGTGCCCCTCTACTGGG - Intergenic
1045193995 8:99911643-99911665 GCTGGTGCTGCCTCACAACATGG + Intergenic
1046421778 8:113994500-113994522 GATGCTCTTCCCACACAACTTGG + Intergenic
1048248058 8:132831022-132831044 AATGTTGGTGGCTCAGAACTTGG - Intronic
1049892157 9:80236-80258 GATGGTGGTTCCTGACAAATGGG - Intergenic
1050127080 9:2368205-2368227 GATGCTGGTGTGTCACTGCTTGG - Intergenic
1051000661 9:12278527-12278549 GATGAGGGTGTCTCACAAGTTGG - Intergenic
1053733579 9:41081324-41081346 GATGGTGGTTCCTGACAAATGGG - Intergenic
1054694836 9:68350235-68350257 GATGGTGGTTCCTGACAAATGGG + Intronic
1054974942 9:71132100-71132122 GATGTTGATGCCTCACAAAGTGG + Intronic
1056298397 9:85217015-85217037 GATGATGGTGGCTCAGACCTAGG - Intergenic
1056829862 9:89907070-89907092 GATGCTGGTGACCCACAGATGGG - Intergenic
1059067124 9:111097053-111097075 GATGCAGGTGGCACACAACATGG + Intergenic
1059456782 9:114404762-114404784 AATGATGGTGCCTAACCACTGGG + Intronic
1060909099 9:127334498-127334520 GAAGCTGGAACCTGACAACTGGG - Intronic
1062069491 9:134547889-134547911 GGTGCTGCTGCCACACAACAGGG - Intergenic
1062323030 9:135999619-135999641 GATGCTGGCGCCTGAGATCTGGG - Intergenic
1186476676 X:9862992-9863014 GATCCTGGGGCCTCAGGACTTGG - Intronic
1191876004 X:65797037-65797059 GAAGCTTATGCCTCACATCTGGG + Intergenic
1192997393 X:76526989-76527011 GATGTTGGTGACTCACGAATGGG + Intergenic
1194123401 X:89987241-89987263 CATGGTGGTGCCTGAAAACTTGG + Intergenic
1195130294 X:101844382-101844404 GATGCTTGGTCCCCACAACTTGG + Intronic
1195846060 X:109229766-109229788 GATGTTGGTGACTCACAGATGGG - Intergenic
1195847866 X:109248167-109248189 GATGTTGGTGACTCACAGATGGG + Intergenic
1197870926 X:131061617-131061639 GATCCTGCTGCAGCACAACTAGG - Intronic
1198822911 X:140667990-140668012 GAGGCTGGTGTCTTACCACTGGG + Intergenic
1199856458 X:151762675-151762697 TATGCTGGTGACTCACTGCTAGG + Intergenic