ID: 1113458840

View in Genome Browser
Species Human (GRCh38)
Location 13:110467715-110467737
Sequence CCTGCACTCCAGGGTCTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113458829_1113458840 24 Left 1113458829 13:110467668-110467690 CCTGGCTGGCCACCACTGCCGTC 0: 1
1: 0
2: 2
3: 39
4: 389
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269
1113458833_1113458840 2 Left 1113458833 13:110467690-110467712 CCCGCCTGCGCTGCGATTCTGCT 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269
1113458834_1113458840 1 Left 1113458834 13:110467691-110467713 CCGCCTGCGCTGCGATTCTGCTG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269
1113458835_1113458840 -2 Left 1113458835 13:110467694-110467716 CCTGCGCTGCGATTCTGCTGCCC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269
1113458831_1113458840 12 Left 1113458831 13:110467680-110467702 CCACTGCCGTCCCGCCTGCGCTG 0: 1
1: 0
2: 0
3: 38
4: 862
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269
1113458832_1113458840 6 Left 1113458832 13:110467686-110467708 CCGTCCCGCCTGCGCTGCGATTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269
1113458830_1113458840 15 Left 1113458830 13:110467677-110467699 CCACCACTGCCGTCCCGCCTGCG 0: 1
1: 0
2: 3
3: 194
4: 6834
Right 1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113458840 Original CRISPR CCTGCACTCCAGGGTCTCCG TGG Intronic
900356333 1:2266565-2266587 CCTGACCTCCAGGGTCCCTGGGG + Intronic
900371156 1:2332827-2332849 CCAGGACCCCAGGGTCTCAGAGG + Intronic
902799514 1:18820543-18820565 CGTGCACACACGGGTCTCCGTGG + Intergenic
903336689 1:22629133-22629155 TTTGCACTCCAGGCTCTCCCTGG + Intergenic
905730987 1:40299551-40299573 CCTGCACTCCAGGGGGCCCTTGG + Intergenic
908647261 1:66291708-66291730 GCTGCACTCCATGGGCTCCAAGG + Intronic
910832957 1:91478764-91478786 CCTGCTCTCCAAGGTGTCAGAGG + Intergenic
911098681 1:94076829-94076851 CTTGCATTCCAGGCTCTCTGAGG - Intronic
911731321 1:101294935-101294957 CCTGAACTCCAGGCTGGCCGAGG - Intergenic
914876832 1:151518555-151518577 TCTGGACTCCATGGTCTACGGGG - Exonic
914985995 1:152457657-152457679 CTGGCACTCCAGAGTCTGCGAGG + Intergenic
917222865 1:172749822-172749844 CCTACACCACAGGGTCTCCTTGG + Intergenic
917973710 1:180225237-180225259 CCTGCTCTCCCGGGGCTCTGTGG - Intergenic
918550198 1:185733895-185733917 CCTGCAGTCCAGAGTCTCAGAGG + Intergenic
922572405 1:226641936-226641958 CCTGAACCCCAGGGTGGCCGTGG + Exonic
922724325 1:227915403-227915425 CCTGCACCCCGGGGCCTCCTGGG + Intergenic
923020942 1:230163307-230163329 CCTGAATTCCATGGACTCCGTGG + Intronic
1063660643 10:8033606-8033628 CCTGTACTCCAGGGGCTTGGGGG + Intergenic
1069895545 10:71678273-71678295 GTTGCACTCCATGGTCTCTGTGG - Intronic
1070163589 10:73881187-73881209 TCTGCACTCCAGGGACTCTGGGG + Intergenic
1070780769 10:79136266-79136288 CCCACCCTCCAGGGTCTCCTTGG + Intronic
1070789908 10:79182779-79182801 CCTTGTCTCCAGGGTCTCCATGG + Intronic
1073041754 10:100612670-100612692 CTTCCACTCCAGGGCCTCCAAGG + Intergenic
1073485811 10:103818560-103818582 CCTGCACATCAGGGTCTACCGGG - Intronic
1073842933 10:107518918-107518940 CCTGCACTCCAGGGGGACCGTGG - Intergenic
1074235059 10:111576735-111576757 CTTGCTCTCCAGGGTTTCCAGGG - Intergenic
1074300901 10:112232560-112232582 CCTGGACTCGAGGGTGTCAGAGG + Intergenic
1074779864 10:116794165-116794187 ACTGCACTCCAGTGACTCCTGGG + Intergenic
1075559876 10:123460621-123460643 CCTTCACCCCAGGGGCTCCTCGG + Intergenic
1076134435 10:128035901-128035923 CCTACACTCTGGGGTCTCCTGGG + Intronic
1076366234 10:129922492-129922514 CCTGCCCTCCAGGGGCTATGGGG - Intronic
1076602013 10:131663399-131663421 CCTGCCCTCCACTGTCTCCTTGG + Intergenic
1076781893 10:132729029-132729051 CCTGGACTCCAGGGCCTGTGGGG + Intronic
1076919269 10:133442843-133442865 CCTGCATGCCAGGCTGTCCGTGG - Intergenic
1077496526 11:2889462-2889484 CCTCCACTCCAGTGCCTCCCCGG + Intronic
1080383819 11:31798940-31798962 CCTCCACTCCGGGCTCTCCCCGG - Intronic
1081461678 11:43278272-43278294 CCTGGCCTCCAGGATCTCAGAGG - Intergenic
1081760909 11:45575852-45575874 CCTGCCCTCGAGGGGCTCCCAGG + Intergenic
1081927940 11:46846172-46846194 CCTGCACTCGAGGGCCTCGCGGG + Intronic
1083068378 11:59949433-59949455 CCTTCCCTCCAGGATCTGCGGGG - Intergenic
1083897369 11:65626785-65626807 CCCTCCCCCCAGGGTCTCCGAGG + Intronic
1084643320 11:70438877-70438899 CCTCCACGCCAGGGCCTGCGTGG + Intergenic
1085463357 11:76708364-76708386 CCGGCACGCCAGTGTCTGCGTGG - Intergenic
1088747605 11:112817469-112817491 CCTGCACTGCAGGGAGTCAGTGG - Intergenic
1089368313 11:117934660-117934682 CCTGCCCTCCAGGACCTCCCAGG + Intergenic
1091787622 12:3252503-3252525 CCTGCACTCCCAGAGCTCCGGGG + Intronic
1094835795 12:34321465-34321487 CAGGGACTCCAGGATCTCCGAGG + Intergenic
1096810878 12:54169067-54169089 CCTCCACCCCAGGGTCTGAGAGG + Intronic
1097743375 12:63271538-63271560 CAAGCACTCCAGGGTCTTTGGGG + Intergenic
1101716983 12:107319980-107320002 CGTGTGCTCCAGGGTCTCCACGG - Exonic
1101737905 12:107476704-107476726 CCTGCAATCCTGGCTCTCTGTGG - Intronic
1101830012 12:108249661-108249683 CCTGCACTCCAAGGCTTCAGAGG - Exonic
1101957355 12:109222992-109223014 CCTGCCCTCCAGGTGCTCAGTGG + Intronic
1104546964 12:129721617-129721639 CCTGGACCCCAGGTTCTCAGAGG - Intronic
1104806245 12:131591329-131591351 CCTGCACACCTGGGGCTCAGAGG + Intergenic
1106226182 13:27788999-27789021 CCTGCCCTCCAGGGCTTCCTGGG + Intergenic
1106551268 13:30773258-30773280 AATGGACTCCAGGGCCTCCGAGG + Intergenic
1107044049 13:35976503-35976525 CCAGCACTTCAGCTTCTCCGAGG + Intronic
1112655939 13:101452702-101452724 CCTGCAAGCCTGGGTGTCCGTGG + Exonic
1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG + Intronic
1113627292 13:111856631-111856653 CCTCCACACCAGGGCCTCCAGGG - Intergenic
1113630230 13:111877411-111877433 ACTTCACACCAGGGTCTCCAGGG + Intergenic
1114075074 14:19157475-19157497 CATGGACGCCAGGGTCGCCGGGG - Intergenic
1114087195 14:19242502-19242524 CATGGACGCCAGGGTCGCCGGGG + Intergenic
1116186314 14:41605356-41605378 CCGGGACTTCAGGGTCTCCGCGG - Intergenic
1121736404 14:96220944-96220966 CCTGCCCTCAGGGGTCTCCCAGG - Intronic
1122261747 14:100527555-100527577 CCTCCACTGCAGGGTGTCCCAGG + Intronic
1122339340 14:101018233-101018255 CCTGCCTTCCAGGGGCTCAGAGG - Intergenic
1123414606 15:20086041-20086063 CCTCCACCCCAGGCTCTCCATGG + Intergenic
1123523948 15:21093152-21093174 CCTCCACCCCAGGCTCTCCATGG + Intergenic
1128800718 15:70495082-70495104 CCTGGAATCCATGGCCTCCGGGG + Intergenic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1132626775 16:895065-895087 CCTGCGTTCCAGGGGCTCCTGGG - Intronic
1132681603 16:1144692-1144714 CCAGCCCTTAAGGGTCTCCGGGG - Intergenic
1132713504 16:1279449-1279471 CCTGAACTGTGGGGTCTCCGTGG - Intergenic
1132825586 16:1903779-1903801 CATGCACCTGAGGGTCTCCGTGG + Intergenic
1132857688 16:2054218-2054240 CCTGCACTTCAGGGACTTCTTGG + Intronic
1133056129 16:3146247-3146269 CCTGGTCTCCAGGGTCCCCGAGG + Intronic
1133459777 16:5977367-5977389 CCTGCCCTCCATGGTCACTGTGG + Intergenic
1136069856 16:27781225-27781247 GCTGCCCTCGAGGGTCTCCAGGG - Intergenic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1137555070 16:49465222-49465244 CCCGCAACCCAGGGTCTCCGGGG - Intergenic
1138312920 16:56043306-56043328 CCTGCCCTCAAGGGACTCCATGG + Intergenic
1139574737 16:67833756-67833778 CGAGCACTCCGGGGTCGCCGCGG + Exonic
1140030007 16:71328156-71328178 CCTGCACTGCAGGTTGTCCTTGG - Intergenic
1140814519 16:78608773-78608795 CCTGCCCTCCAGGGGTTCCTGGG + Intronic
1140889707 16:79274477-79274499 CCTGGACACCAGAGTCTCCAGGG - Intergenic
1141608923 16:85170423-85170445 CCTGCTCTCCAGGGTCTTAGTGG - Intergenic
1141655431 16:85413432-85413454 CCTGCTCTCCCGGGTGACCGTGG + Intergenic
1142441169 16:90098411-90098433 CCTGCTCTCCAGTGTCCCCAAGG - Intergenic
1142592221 17:1011308-1011330 CCTCCACTCCAGGCTCCCCACGG + Intronic
1144787435 17:17839869-17839891 CCTGCCCGCCGGGGTCACCGTGG - Intergenic
1144835509 17:18154682-18154704 CCTGCACGACACGCTCTCCGAGG + Exonic
1145019201 17:19416499-19416521 CCTACAATCCAGGGTCATCGGGG - Exonic
1147670886 17:42176204-42176226 CCTCCACTACAGCGTCTCCAAGG - Exonic
1147867464 17:43562636-43562658 CCTGCACACCCAGGTCTCTGAGG - Intronic
1148793648 17:50187112-50187134 CCCCCACTCCAGGGTCCCCCTGG - Exonic
1149657470 17:58318017-58318039 CCAGCACTCCAGAGCCTCCCTGG + Intronic
1151876627 17:76870679-76870701 ACTTCACCCCAGGGTCTCCCTGG + Intronic
1152031391 17:77845616-77845638 CCTGCCCTGCAGGGTGTCGGGGG + Intergenic
1152286512 17:79416058-79416080 CCTGCACTCCAGGGTCCATGTGG + Intronic
1152288989 17:79428255-79428277 CCCTCACTGCAGGGGCTCCGGGG - Intronic
1152326636 17:79645390-79645412 CCAGAACTGCAAGGTCTCCGTGG - Intergenic
1152603904 17:81279190-81279212 CCTGACCTCCAGGGCCTCCTGGG + Intronic
1152690519 17:81715846-81715868 CCAGGACACCAGGGTCTCAGTGG - Intronic
1152896591 17:82914728-82914750 CCTGCAGGCCAGAGTCTCCTGGG - Intronic
1155228925 18:23755279-23755301 CCAGTTCTCCAGGGTCTCCAGGG - Intronic
1155963942 18:32018916-32018938 CCTGCGCTCCAGGGCCCGCGCGG - Exonic
1156488476 18:37481758-37481780 CCTGCACTCCATGGTCATCCTGG + Intronic
1157486017 18:48087755-48087777 ACTGCACTCCAGGCTCACCTGGG + Intronic
1157604056 18:48914701-48914723 CCAGCTCTCCCAGGTCTCCGTGG + Intergenic
1157831124 18:50857854-50857876 CCTGCCCTCCTGGGCCTCCCAGG + Intergenic
1159022559 18:63155513-63155535 CCTGCACTCCTGGGCCCCTGTGG - Intronic
1160415255 18:78705411-78705433 CCAGCAATCCTGGGTCCCCGTGG - Intergenic
1160797793 19:953740-953762 CCCCCACCCCAGGGCCTCCGCGG - Intronic
1160842574 19:1152785-1152807 CCAGGACTCCAGGGTCTCCTGGG - Intronic
1161501921 19:4620930-4620952 CCTGCTGTCCAGGGTCTGGGGGG + Intergenic
1161575055 19:5050499-5050521 CCTGTATTCCAGGGTCTTCCTGG + Intronic
1164548447 19:29188111-29188133 CCAGCGCCCCAGGGTCTCCATGG + Intergenic
1164590982 19:29506759-29506781 CCTGCACACCAGGCCCTCCAGGG + Intergenic
1164638014 19:29805637-29805659 CCTGCCCTCCAGGAGCTCCCAGG - Intergenic
1165408649 19:35645075-35645097 CCCGCACTTCAGGGTCTTCAGGG - Intergenic
1166571828 19:43802102-43802124 CCTGGACTCCTGGGTCTTGGTGG - Intronic
1166695880 19:44851249-44851271 CCTGGACTCCTGGGTCTGAGAGG - Intronic
1166739110 19:45103488-45103510 CCCTCTCTCCACGGTCTCCGAGG + Intronic
1166740096 19:45109397-45109419 CCTACACTGCAGGGCCTCCAAGG - Intronic
1167321347 19:48799012-48799034 CCTGCTCTCCTGGGTCTCCCAGG - Intronic
1167333187 19:48868826-48868848 CCTGCACTCCAGGGCCCCCGTGG + Intergenic
1167426949 19:49434339-49434361 CCCGCACTCCTGGGTCTGAGAGG - Intronic
1167489203 19:49782117-49782139 CCTGGACTCCTGGGTCTGCGGGG + Intronic
1167690165 19:50980209-50980231 CCTGCACTCCTGGGTCACTGAGG + Intronic
1167690661 19:50982529-50982551 CCTGGACTCCTGGGTCTGTGGGG - Intronic
1167695932 19:51015690-51015712 CCTGGACTCCTGGGTCTAAGTGG - Intronic
1167792219 19:51689618-51689640 CCCGCACTCCTGGGTCCCTGAGG + Intergenic
1167792380 19:51690124-51690146 CCTGGAATCCCGGGTCCCCGAGG - Intergenic
1167798585 19:51726505-51726527 CCTGGACTCCTGGGTCTTAGAGG - Intergenic
1168254594 19:55158436-55158458 CCTGGACTCCTGGGTCTGAGGGG - Intronic
1168255962 19:55165513-55165535 CCTGCTCTCCTGGGTCTCCTAGG - Intronic
925637939 2:5960004-5960026 GCTGCACTCCAGGTTCTCGCTGG + Intergenic
926019985 2:9486254-9486276 CCAGTACTCCAGGGTTTCAGAGG - Intronic
926218035 2:10917284-10917306 CCTGGAATCGGGGGTCTCCGTGG - Intergenic
926225253 2:10962346-10962368 CCTGCACTGCAGCGTCACTGAGG + Intergenic
937061326 2:118982353-118982375 CCTGGACTCCCGGGGCTCCCTGG - Exonic
937356345 2:121200329-121200351 CCTGCACAGCAGGGTCCCCACGG - Intergenic
937976474 2:127584961-127584983 CCTGCTTTCCACGGTCTCCCTGG - Intronic
940460585 2:153958856-153958878 CCTGCAATTCAGGGCCTCTGAGG - Intronic
943153158 2:184138945-184138967 CCTGGACCCCAGTGACTCCGGGG - Intergenic
943266516 2:185738968-185738990 TCTGCACTGCTGGGTGTCCGCGG - Exonic
943525005 2:189005401-189005423 CCTGGACCCCAGGGTCTTCCTGG + Exonic
947815638 2:233034552-233034574 CTGGCACTCCAGGGTGTCCTGGG - Exonic
947942398 2:234069650-234069672 CCTGCCCTCCAGGGCATCCATGG + Intronic
947944970 2:234093523-234093545 CCTGCCCTCCAGGGTTTATGAGG - Intergenic
948683788 2:239658214-239658236 CCTGCCCGCAAGGGTCTCAGAGG + Intergenic
948753035 2:240143452-240143474 CAAGCACTCCAGGGACTCTGAGG - Intronic
948899259 2:240947880-240947902 CCTCCAGTCCAGGGTCTCAATGG + Intronic
949046946 2:241876712-241876734 CCTGGACTCCAGTTTCTCCTGGG - Intergenic
1168965629 20:1896247-1896269 CCTGCAGTTCAGGTGCTCCGCGG + Intronic
1170030107 20:11935683-11935705 CCTGCACTCCAGGCCCTACTTGG - Intergenic
1170420274 20:16185758-16185780 CCAGCATTCCAGGGTCTACTTGG - Intergenic
1170932814 20:20784090-20784112 CCTTCTCTCCAGGGTCCCCTTGG - Intergenic
1171464412 20:25317654-25317676 CCGGCACTTCAGGGCCTCCCTGG - Intronic
1171520661 20:25772187-25772209 CCTGAAGTCCAGTGTCTACGTGG - Intronic
1171556259 20:26084306-26084328 CCTGAAGTCCAGTGTCTACGTGG + Intergenic
1172997699 20:39083340-39083362 CCTGCTCTGCAGGGTCCCTGTGG - Intergenic
1173452694 20:43179138-43179160 CCTTCACTGCAGGATCTCCTGGG + Intronic
1173822376 20:46028085-46028107 CCTGGACTCTAGGGGCTCTGAGG + Intronic
1173985798 20:47260353-47260375 CATCCACACCAGGGTCTACGAGG + Intronic
1175153639 20:56954736-56954758 CCTGCCATCCAGGGGCTTCGTGG - Intergenic
1175445002 20:59013819-59013841 CCTGCCCTCCAGGGACTTAGAGG - Intergenic
1175841651 20:62031797-62031819 CCTGCACCCCGGCGTCTCCCTGG - Intronic
1179627024 21:42654366-42654388 GCTGCCCCCCAGGCTCTCCGCGG - Intronic
1180207076 21:46267492-46267514 CTGGCATTCCATGGTCTCCGGGG - Intronic
1180290722 22:10850389-10850411 CATGGACGCCAGGGTCGCCGGGG - Intergenic
1180493523 22:15879811-15879833 CATGGACGCCAGGGTCGCCGGGG - Intergenic
1181974729 22:26720867-26720889 CCTGCCTGCCAGGGTCTCTGAGG - Intergenic
1183364697 22:37400654-37400676 CCTTCCCTCCAGGGGCTCAGGGG - Intronic
1183700165 22:39446506-39446528 GCTGCACTCCAGAGTCTGTGAGG - Intergenic
1183979145 22:41529585-41529607 CCTGCCCTCCAGGGCCACCTAGG + Intronic
1185145562 22:49133755-49133777 CCTGCTCTCCAGGGCCCCAGGGG + Intergenic
1185233901 22:49700064-49700086 CCTGACCTCCAGGGTCTCCCTGG - Intergenic
950017680 3:9765797-9765819 CTTGCCCTCCAGGGCCTCCTTGG + Exonic
950028252 3:9835097-9835119 CCTGCTCTCCTGTGCCTCCGAGG + Exonic
950199014 3:11029509-11029531 CCTGCCCTCCAGAGGCTCCCAGG + Intronic
951208393 3:19947557-19947579 CCTGGACCCCAGGTTATCCGCGG + Intronic
953057113 3:39396839-39396861 CCTACACCACAGGGTCTCCTTGG + Exonic
954676021 3:52315843-52315865 CCTGTTCTCCTGGGTCTCAGGGG - Intergenic
954909297 3:54089102-54089124 CCTGGACTCCATGAGCTCCGTGG + Intergenic
955412042 3:58661989-58662011 CCTGCCCTCCAGTGTCTGAGGGG + Intronic
960467465 3:118014744-118014766 CCTGAACACCAGTGTCTCCTGGG + Intergenic
961106421 3:124246341-124246363 CCTGCTCTGCAGGGCCTCCCAGG + Intronic
961381061 3:126496926-126496948 TCTTTACTCCAGGGTCTTCGTGG + Intronic
961568161 3:127778577-127778599 TCTGCACTCCAGGGTGTCGCTGG - Intronic
964037345 3:152215421-152215443 CCTGCACTCGAGGGACTCCTGGG - Intergenic
964847839 3:161062841-161062863 CCTGTACTCCAGGGGATCCAAGG - Intronic
964852030 3:161105199-161105221 GCGGCCCTGCAGGGTCTCCGAGG - Intronic
966980966 3:185134912-185134934 CCTCATCTCCAGGGTGTCCGTGG + Intronic
968339809 3:197945843-197945865 CCTGCACTCCATGATGTCGGAGG - Intronic
968361431 3:198149383-198149405 CCTGCTCTCCAGTGTCCCCAAGG - Intergenic
968568185 4:1326021-1326043 CCTGCCTTCCAGGGGCTCAGAGG - Intronic
968987067 4:3881223-3881245 GCTGCACTGAAGGGTGTCCGGGG - Intergenic
969306071 4:6326998-6327020 CCTGCCTTCCAGGGCCTCAGAGG - Intronic
969728763 4:8940920-8940942 GCTGCACTGAAGGGTCTCCGGGG + Intergenic
970173076 4:13308454-13308476 CCTGCCCTCCAGGCTCTCACTGG - Intergenic
971243996 4:24912630-24912652 CCTGCACTTTCGGGTCTGCGCGG - Intronic
974816023 4:67004215-67004237 CCTGTCCTCCAAGGTCTCTGGGG + Intergenic
982068037 4:151671899-151671921 CCTGCTCTGCAGCGTCTCCAAGG + Intronic
984709869 4:182876098-182876120 CCTGAGCTCCAGAGACTCCGAGG - Intergenic
985474644 5:72782-72804 CCTGTGTTCCAGGGCCTCCGGGG - Intergenic
985474660 5:72831-72853 CCTGTGTTCCAGGGCCTCCGGGG - Intergenic
985474916 5:73664-73686 CCTGTGTTCCAGGGCCTCCGGGG - Intergenic
985474932 5:73713-73735 CCTGTGTTCCAGGGCCTCCGGGG - Intergenic
985730799 5:1547441-1547463 CTTGCCCTTCAGGGTCTCTGGGG + Intergenic
985930722 5:3055417-3055439 TCTGCATTCCAGGGGCTCAGTGG + Intergenic
986116481 5:4780257-4780279 CAGGTACTCCAGGCTCTCCGTGG - Intergenic
986199620 5:5569460-5569482 CCTGCTCTCCCCGGTCTCTGTGG + Intergenic
989390320 5:40893941-40893963 CCTTAAGTCCAGGGTCTCCTTGG + Intergenic
990166094 5:52994961-52994983 ACTGTACTCCAGGATCTCTGAGG - Intronic
990488074 5:56278612-56278634 CGTGCATTCCAGGGTCTTGGAGG + Intergenic
995807696 5:116072024-116072046 CCTGCACTACAAGGTGTCCCAGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
999202490 5:149826258-149826280 CCTGGACCCCAGGGTCTGAGGGG + Intronic
1001473880 5:172035587-172035609 CCTGCTCTCCATGGTCACCAGGG + Intergenic
1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG + Intergenic
1003168651 6:3703078-3703100 CCTGCAGCCCAGGGGCTCCTTGG + Intergenic
1005758620 6:28947791-28947813 CCTGCCCTCCAGGTTCCCAGGGG + Intergenic
1007627621 6:43255231-43255253 CCTCCAGCCCAGGGTCTCTGGGG - Intronic
1009726811 6:67545243-67545265 CCTGCACTGCTGGGTGTCCTAGG + Intergenic
1012253754 6:97008696-97008718 CCTGGGCTCCAGCGTCTCCTGGG - Intronic
1013195064 6:107837645-107837667 CCTGCACTCCAGAATCCCTGAGG - Intergenic
1015244817 6:131063436-131063458 CCTCCACCCCCGGGTCTCCGCGG - Intergenic
1018879305 6:167860780-167860802 CCTGCTCACGAGGGACTCCGAGG - Intronic
1018927003 6:168213410-168213432 CCTGTCCTCCAGGGTCCACGAGG - Intergenic
1019159812 6:170062421-170062443 CCTGCACTCCAGGGCCTCTTTGG - Intergenic
1019254259 7:39337-39359 CCTGCTCTCCAGTGTCCCCAAGG + Intergenic
1019505417 7:1388120-1388142 CCTGCTCTCCGGAGCCTCCGAGG - Intergenic
1019636219 7:2077434-2077456 ACTGACCTCCAGGGTCTCCAGGG + Intronic
1019636521 7:2078902-2078924 ACTGACCTCCAGGGTCTCCAGGG + Intronic
1020066315 7:5190665-5190687 CCAGCACCCGAGGGTCTCCCTGG - Intronic
1022133544 7:27425833-27425855 CCTCCCCTCCAGGGTCTGAGTGG - Intergenic
1024157185 7:46637951-46637973 CCTGCAGGCCAGGGCCTCAGGGG + Intergenic
1025201470 7:56964549-56964571 GCTCCACCCCAGGGTCTACGTGG - Intergenic
1025670475 7:63612383-63612405 GCTCCACCCCAGGGTCTACGTGG + Intergenic
1026950501 7:74343383-74343405 CCTGTCCTTCAGGATCTCCGGGG + Intronic
1028382036 7:90211160-90211182 TCTGCAGTCCAGGGTCTGTGAGG + Intronic
1028566706 7:92240992-92241014 CCTGCAAACCAGGGTATCAGAGG - Exonic
1029100826 7:98128690-98128712 CCTGTGCTCCAGGGGCTCCCTGG + Intronic
1029207282 7:98877613-98877635 CCTCCCCTCCAGGGTATCCACGG + Intergenic
1029216364 7:98953328-98953350 CCTGCTCTCCAAGGCCTGCGTGG + Exonic
1032858301 7:135855093-135855115 CCTGCACTGAAGGGTTTCCCAGG + Intergenic
1034976649 7:155453195-155453217 CCTGCACTCTGGAGTCTCCCGGG - Intergenic
1034979756 7:155468134-155468156 TCTTCCCTCCTGGGTCTCCGTGG - Intergenic
1035097213 7:156365405-156365427 CCTGCAGACCAGATTCTCCGTGG + Intergenic
1035238580 7:157515908-157515930 TCTCCACTCCAGGGGCCCCGAGG - Intergenic
1036398403 8:8387068-8387090 CCTGCAGTCCAGGGACTGAGCGG - Intergenic
1036656110 8:10678531-10678553 CCTGCAGTGCAGGGTCACTGGGG - Intronic
1037803967 8:22049292-22049314 CCTGTCCTCCCGGGTCCCCGCGG + Intronic
1038412457 8:27368848-27368870 TCTTCTTTCCAGGGTCTCCGGGG - Intronic
1038963478 8:32548000-32548022 CCTGGGTTCCCGGGTCTCCGGGG + Intronic
1041148576 8:54907312-54907334 CCTGCAGTCCAGTGTGTGCGGGG + Intergenic
1044748598 8:95394931-95394953 CCAGCCCTGCAGGGTCTCTGGGG - Intergenic
1045331481 8:101159250-101159272 CCTGCTCTCCTGGTTCTCCTTGG - Intergenic
1048027432 8:130599473-130599495 CCTGCCTTCAAGGGTCTCCAAGG - Intergenic
1048857609 8:138697741-138697763 CCTGCACTGCAGGGGCTCAAAGG + Intronic
1048997541 8:139803725-139803747 CCTGCCTTCCAGTGACTCCGGGG - Intronic
1049035416 8:140071646-140071668 CCTGCCCCACAGGGTCTCTGGGG + Intronic
1049192077 8:141294128-141294150 TCTGTAGACCAGGGTCTCCGTGG + Intronic
1049425419 8:142535905-142535927 CCTGGAAACCAGGGTCTCAGTGG - Intronic
1049820801 8:144632043-144632065 CCTGCCCTCCTGGGTCTGCCAGG + Intergenic
1050667586 9:7958691-7958713 ACTGAACTTCAGGGTCTCCCTGG - Intergenic
1051235085 9:14991101-14991123 CCTGCAAACCAGGATCACCGAGG - Intergenic
1053323444 9:37120509-37120531 CCTTCCCTCCCGGGTCTGCGCGG + Intergenic
1054877722 9:70113814-70113836 CCTCGACTCCAAGGTCTCCACGG + Intronic
1056790176 9:89620146-89620168 CCTTGACTTCAGGGTCTCCTTGG + Intergenic
1059354490 9:113688130-113688152 CCGGCTCTCCAGGGTTCCCGCGG - Intergenic
1060052650 9:120388191-120388213 TCTGCTCTCCAGGGGCTCAGAGG + Intergenic
1061318924 9:129815571-129815593 CCGTCACTCCTGGGTCTGCGTGG - Intronic
1061360266 9:130137181-130137203 CCTGCTCGGAAGGGTCTCCGTGG + Exonic
1061915731 9:133752464-133752486 CCTGCACTCCAAGGTCCTAGGGG + Intergenic
1062358260 9:136175299-136175321 CCTGCTCCCCATGTTCTCCGTGG + Intergenic
1062551578 9:137089900-137089922 CCTGCCCACCAAGGTCTCCATGG - Intronic
1062558304 9:137127280-137127302 CCTGCCCACCAAGGTCTCCATGG + Intergenic
1062586169 9:137251005-137251027 CCTGCACCCTGGGGTCTCCTGGG - Intergenic
1062746143 9:138213204-138213226 CCTGCTCTCCAGTGTCCCCAAGG - Intergenic
1203772244 EBV:55447-55469 CCTGGACCCCATGGTCTCAGAGG - Intergenic
1186378446 X:9033290-9033312 CCTGAACTCCACGGCCTCTGCGG + Intronic
1187105825 X:16240431-16240453 CCTGCATTCCAGGTTCTGCTAGG - Intergenic
1190248723 X:48707024-48707046 CCTGCCCTTGAGGGTCTCAGAGG - Intronic
1192758519 X:74070674-74070696 CCTGGGCCCCAGGGTCTCCATGG - Intergenic
1198275602 X:135095439-135095461 CCTGCAGTCGGGGGTCTCTGAGG + Intergenic