ID: 1113458841

View in Genome Browser
Species Human (GRCh38)
Location 13:110467716-110467738
Sequence CTGCACTCCAGGGTCTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113458830_1113458841 16 Left 1113458830 13:110467677-110467699 CCACCACTGCCGTCCCGCCTGCG 0: 1
1: 0
2: 3
3: 194
4: 6834
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
1113458829_1113458841 25 Left 1113458829 13:110467668-110467690 CCTGGCTGGCCACCACTGCCGTC 0: 1
1: 0
2: 2
3: 39
4: 389
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
1113458834_1113458841 2 Left 1113458834 13:110467691-110467713 CCGCCTGCGCTGCGATTCTGCTG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
1113458835_1113458841 -1 Left 1113458835 13:110467694-110467716 CCTGCGCTGCGATTCTGCTGCCC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
1113458832_1113458841 7 Left 1113458832 13:110467686-110467708 CCGTCCCGCCTGCGCTGCGATTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
1113458831_1113458841 13 Left 1113458831 13:110467680-110467702 CCACTGCCGTCCCGCCTGCGCTG 0: 1
1: 0
2: 0
3: 38
4: 862
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137
1113458833_1113458841 3 Left 1113458833 13:110467690-110467712 CCCGCCTGCGCTGCGATTCTGCT 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113458841 Original CRISPR CTGCACTCCAGGGTCTCCGT GGG Intronic
900111523 1:1008091-1008113 CTGTTCTCCAGTGTCTCCTTTGG + Intergenic
902379683 1:16046842-16046864 CTGCTTTCCAGGGGCTCCGCTGG + Intronic
902799515 1:18820544-18820566 GTGCACACACGGGTCTCCGTGGG + Intergenic
903994903 1:27299660-27299682 CTGCATTCCAAGCTCTCCCTAGG - Intronic
907569558 1:55470357-55470379 GAGCACTCCAGGATCTCCTTGGG + Intergenic
907899312 1:58722834-58722856 CTCCACACCAGGATCTCAGTTGG - Intergenic
911065763 1:93786450-93786472 CTGCTCTCCATGGTCTCAGCTGG - Intronic
912526325 1:110286021-110286043 CTGCACTCCTTGGTTTCCTTGGG - Intergenic
913030489 1:114897684-114897706 CTGAACTCCTGGGACTCCTTTGG - Intronic
917222866 1:172749823-172749845 CTACACCACAGGGTCTCCTTGGG + Intergenic
918047521 1:180950524-180950546 CGGCACTTCTGGGTCACCGTGGG - Exonic
923020943 1:230163308-230163330 CTGAATTCCATGGACTCCGTGGG + Intronic
923238406 1:232057385-232057407 CTCCTCTCCAGGATCCCCGTGGG + Intergenic
923437188 1:233978570-233978592 CTGCAATCCAGGATCCCTGTGGG + Intronic
923925004 1:238616446-238616468 CTTCACTCCAGGGCCTCCAATGG + Intergenic
1063242362 10:4184215-4184237 CTACATTCCAGGGACTCCCTAGG + Intergenic
1063470611 10:6281757-6281779 CTGCACTCCAGGATCCTCCTAGG + Intergenic
1067433607 10:46262481-46262503 CTGCACCCCAGGCCCTCAGTGGG + Intergenic
1067440077 10:46303824-46303846 CTGCACCCCAGGCCCTCAGTGGG - Intronic
1067460687 10:46456074-46456096 CTCCACTCCAGTGACTCCTTTGG + Intergenic
1067626504 10:47928526-47928548 CTCCACTCCAGTGACTCCTTTGG - Intergenic
1070163590 10:73881188-73881210 CTGCACTCCAGGGACTCTGGGGG + Intergenic
1070780771 10:79136267-79136289 CCACCCTCCAGGGTCTCCTTGGG + Intronic
1071675284 10:87650058-87650080 CTGCACTCCAGCTTGTCCGATGG - Intergenic
1075949412 10:126463825-126463847 CTGCCCTCTAGGCTCTCCGTTGG - Intronic
1076919268 10:133442842-133442864 CTGCATGCCAGGCTGTCCGTGGG - Intergenic
1079611028 11:22432738-22432760 GTTCACTCCAGGGTCTGCGGCGG + Intergenic
1080395748 11:31888383-31888405 CTGCTCAGCAGGGTCTCAGTGGG - Intronic
1083667599 11:64284418-64284440 CTGCCTTCCAGGGCCACCGTTGG - Exonic
1086243227 11:84720901-84720923 CTGCAATCCAGAGTCACTGTGGG + Intronic
1096817377 12:54210131-54210153 CTTCCCTCCAGAGTCTCCCTGGG - Intergenic
1101957356 12:109222993-109223015 CTGCCCTCCAGGTGCTCAGTGGG + Intronic
1104767659 12:131340883-131340905 CTGCTGTCTAGGGTCTCTGTCGG - Intergenic
1104812051 12:131625199-131625221 CTGCTGTCTAGGGTCTCTGTCGG + Intergenic
1108186948 13:47897562-47897584 CTGCATTCCAGGCTCAGCGTGGG - Intergenic
1112655940 13:101452703-101452725 CTGCAAGCCTGGGTGTCCGTGGG + Exonic
1113420669 13:110169638-110169660 CTGGAATCCAGGGTCTCCCTTGG + Exonic
1113458841 13:110467716-110467738 CTGCACTCCAGGGTCTCCGTGGG + Intronic
1114145596 14:19973412-19973434 CAGCACCGGAGGGTCTCCGTAGG + Intergenic
1114634380 14:24179088-24179110 CTGGGCTCCAGGGCCTCCCTCGG - Exonic
1115467479 14:33731491-33731513 ATTCTCTCCAGGGTCTCTGTAGG - Intronic
1116186313 14:41605355-41605377 CGGGACTTCAGGGTCTCCGCGGG - Intergenic
1117455488 14:55892978-55893000 CTGCACTTCTGGGTGTCTGTTGG + Intergenic
1117475913 14:56095022-56095044 CTGAACTTCAGGCTCTCCATTGG + Intergenic
1119051990 14:71377946-71377968 CTGCTTTCCACGGTCTCCCTCGG - Intronic
1119656865 14:76423529-76423551 CTGGACCCCAGGGGCTCTGTGGG + Intronic
1121260137 14:92559854-92559876 CTGCTCTCCAGGGTTCCGGTAGG - Intronic
1123020527 14:105395862-105395884 CTGCACTGTGGGGTCTCCATAGG + Exonic
1128232995 15:66048460-66048482 CTGCAGCCCAGGGGCTCTGTGGG + Intronic
1129035367 15:72645776-72645798 GTGCCCTGCAGGGTCTCCCTTGG + Intergenic
1129214517 15:74091440-74091462 GTGCCCTGCAGGGTCTCCCTTGG - Intergenic
1130994642 15:88897093-88897115 CTCCACTCCAGGGTCCCAGGAGG + Intergenic
1131611170 15:93965802-93965824 CTGACCTCCAGGGTCCCCGCAGG + Intergenic
1133051437 16:3119468-3119490 CGGTACTCCTGGGGCTCCGTGGG - Exonic
1133459778 16:5977368-5977390 CTGCCCTCCATGGTCACTGTGGG + Intergenic
1138312921 16:56043307-56043329 CTGCCCTCAAGGGACTCCATGGG + Intergenic
1140030006 16:71328155-71328177 CTGCACTGCAGGTTGTCCTTGGG - Intergenic
1141867536 16:86761024-86761046 CCGTGCTCCAGGGTCTCCTTCGG - Intergenic
1142197138 16:88744155-88744177 CTGTACAGCAGGGTCACCGTGGG + Intronic
1142543018 17:676105-676127 TTGGACTCCAGGGTCTCCTCTGG - Intronic
1142728740 17:1836146-1836168 CTGCACTCCAGGGTGACAGGAGG - Intronic
1149657471 17:58318018-58318040 CAGCACTCCAGAGCCTCCCTGGG + Intronic
1150940497 17:69688020-69688042 CTGCACTGCAGGGTCTGAGGTGG + Intergenic
1151876628 17:76870680-76870702 CTTCACCCCAGGGTCTCCCTGGG + Intronic
1152230184 17:79110438-79110460 CTGCTGTCCAGGGTCTGCCTAGG - Intronic
1153503300 18:5770343-5770365 CTGCACTCCAGAGTCTGGGCAGG - Intergenic
1159113705 18:64089497-64089519 CTGCTCTCTAGGCTCTCTGTTGG + Intergenic
1161062728 19:2223171-2223193 CTGCACCCCAGGGTCTCCTGAGG - Intronic
1161073222 19:2272634-2272656 CTCTACTCCAGGGTCCCCCTGGG - Intronic
1161575056 19:5050500-5050522 CTGTATTCCAGGGTCTTCCTGGG + Intronic
1165902261 19:39174365-39174387 CTCCACTCCTGGGTGTCCCTCGG + Intronic
1166571827 19:43802101-43802123 CTGGACTCCTGGGTCTTGGTGGG - Intronic
1166751958 19:45168485-45168507 GTGAGCTCCCGGGTCTCCGTGGG - Intronic
1167250504 19:48396373-48396395 CTGCCCTCCTGGGCCTCAGTAGG + Intronic
1167333188 19:48868827-48868849 CTGCACTCCAGGGCCCCCGTGGG + Intergenic
1167489204 19:49782118-49782140 CTGGACTCCTGGGTCTGCGGGGG + Intronic
1167695931 19:51015689-51015711 CTGGACTCCTGGGTCTAAGTGGG - Intronic
925637940 2:5960005-5960027 CTGCACTCCAGGTTCTCGCTGGG + Intergenic
926203711 2:10820029-10820051 CTGGACTTCAGTGTCTCCCTCGG - Intronic
926218034 2:10917283-10917305 CTGGAATCGGGGGTCTCCGTGGG - Intergenic
926561496 2:14422487-14422509 CTACCGTCCAGGGTCTCTGTTGG - Intergenic
926814826 2:16789878-16789900 CTCTACTTCAGGGTCTCTGTAGG - Intergenic
928805043 2:35140439-35140461 CTGCACTCCTGTGTGTTCGTGGG + Intergenic
932910097 2:75797271-75797293 TTGCACTACAGGGTCTCTGGAGG - Intergenic
933280785 2:80330689-80330711 CTGCCTTCCAGGGTCTCCACAGG + Intronic
933528394 2:83473442-83473464 CTACAACCCAGGGTCTCCATGGG + Intergenic
942194360 2:173502945-173502967 CTGCCCTCCAGGGGCTCCCAAGG - Intergenic
948056371 2:235011901-235011923 CTGCATTCCAGGCTCTGGGTGGG + Intronic
948560617 2:238848907-238848929 CTGCACTCAGGGGTGTCCCTGGG - Intronic
1169405206 20:5316455-5316477 CTGCAGTCCCGGGACTCAGTCGG - Intergenic
1170932813 20:20784089-20784111 CTTCTCTCCAGGGTCCCCTTGGG - Intergenic
1171464411 20:25317653-25317675 CGGCACTTCAGGGCCTCCCTGGG - Intronic
1171520660 20:25772186-25772208 CTGAAGTCCAGTGTCTACGTGGG - Intronic
1171556260 20:26084307-26084329 CTGAAGTCCAGTGTCTACGTGGG + Intergenic
1172997698 20:39083339-39083361 CTGCTCTGCAGGGTCCCTGTGGG - Intergenic
1175841650 20:62031796-62031818 CTGCACCCCGGCGTCTCCCTGGG - Intronic
1176811792 21:13547331-13547353 CAGCACTGGAGGGTCTCCATAGG - Intergenic
1179627023 21:42654365-42654387 CTGCCCCCCAGGCTCTCCGCGGG - Intronic
1180155962 21:45977572-45977594 CTGCACTGCAGGGTCTGGCTGGG - Intergenic
1182146771 22:28001525-28001547 ATGCACTCCAGCGGCCCCGTGGG - Exonic
1182150986 22:28026961-28026983 CTGGACTACAGGGACTGCGTTGG - Intronic
1183523906 22:38312604-38312626 CTGAGCTCCAGGGTGTCCATAGG + Intronic
1184689195 22:46109830-46109852 CTGCACTCCAGGATGCCCGGTGG - Intronic
1185233900 22:49700063-49700085 CTGACCTCCAGGGTCTCCCTGGG - Intergenic
953057114 3:39396840-39396862 CTACACCACAGGGTCTCCTTGGG + Exonic
954135795 3:48581573-48581595 CCGGTCTCCAGGGTCTCCCTTGG + Exonic
954579648 3:51696347-51696369 CTGCTCTCCAAGGGCTCCCTGGG + Intronic
956151604 3:66249329-66249351 GTCCATTCCAGGGTCTCCTTTGG + Intronic
959708870 3:109364345-109364367 CTGCTCTCCAGGGTAGCTGTGGG + Intergenic
960271232 3:115676568-115676590 CTGCTCTCCCCAGTCTCCGTTGG - Exonic
961381062 3:126496927-126496949 CTTTACTCCAGGGTCTTCGTGGG + Intronic
961408836 3:126704029-126704051 CTCCACTCCAGGGCCTCCGCCGG + Intergenic
962344912 3:134611707-134611729 CTGCAGTCCAGGGTGTTGGTGGG + Intronic
968021051 3:195389849-195389871 CTGCACTTCAGGATCCGCGTTGG - Intronic
969520870 4:7677194-7677216 CTGCCCTCCTGGGTCCCCCTCGG + Intronic
971194763 4:24462120-24462142 CTGCACTCCAGCCTGTGCGTTGG - Intergenic
973204940 4:47549893-47549915 CTGCACACCATGTTCTCCCTTGG - Intronic
975040056 4:69735411-69735433 CTCCACACCCGGGTCTCTGTAGG + Intronic
991614368 5:68480739-68480761 CTGCACCCCAGTGGCTCCCTGGG - Intergenic
991693192 5:69245376-69245398 CTGCACTCCAGGGCCTGGGTAGG - Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1000038329 5:157465976-157465998 CTCCACTGCAGGGTCTCCCTCGG - Intronic
1001419787 5:171577987-171578009 CTACACTCCAGGGCCTCCCACGG + Intergenic
1002522436 5:179799175-179799197 CTGCACTGCACGCTCTCCCTAGG - Intronic
1010356273 6:74937574-74937596 CTGCGCTCCAGAGTTTCCATAGG - Intergenic
1010593464 6:77736778-77736800 CTGGACTACAGGGTCTCATTGGG - Intronic
1016055359 6:139572844-139572866 CTGCACTCCAGGCTCAACTTAGG + Intergenic
1017995866 6:159531244-159531266 CTGCCCTCCACTGTCTCCATGGG - Intergenic
1019064727 6:169287760-169287782 GTTCCCTCCAGAGTCTCCGTGGG + Intergenic
1019064735 6:169287790-169287812 GTTCCCTCCAGAGTCTCCGTGGG + Intergenic
1020081990 7:5291216-5291238 CTGCACACCAGGATCACCGCAGG + Exonic
1022133543 7:27425832-27425854 CTCCCCTCCAGGGTCTGAGTGGG - Intergenic
1027180987 7:75939137-75939159 CTGCACTCCAGGAACTGTGTGGG - Intronic
1028382037 7:90211161-90211183 CTGCAGTCCAGGGTCTGTGAGGG + Intronic
1029100827 7:98128691-98128713 CTGTGCTCCAGGGGCTCCCTGGG + Intronic
1031602946 7:123734659-123734681 CTGCAGTGCAGGGTATCTGTAGG + Intronic
1035238579 7:157515907-157515929 CTCCACTCCAGGGGCCCCGAGGG - Intergenic
1035245418 7:157559688-157559710 CTGCCCTCCAAGGTTCCCGTTGG - Intronic
1035462275 7:159049428-159049450 GGGCCCTCCAGGGCCTCCGTGGG + Intronic
1045840376 8:106572931-106572953 CAGCTCTCCTGGGTCTCCATTGG - Intronic
1048480671 8:134789405-134789427 CTGCATTCCAGGATTTCCCTTGG + Intergenic
1048865850 8:138760950-138760972 CTGCCCTCCAGGCCCTCCCTGGG - Intronic
1056790177 9:89620147-89620169 CTTGACTTCAGGGTCTCCTTGGG + Intergenic
1057022025 9:91706810-91706832 CTGAGGTCCAGGGTCTCAGTTGG + Intronic
1058861778 9:109123520-109123542 CTGCTCTCAAGGGGCTCTGTAGG - Intergenic
1062696877 9:137880151-137880173 CTGCACTCCTGGGCCTGCGGTGG - Intronic
1189921606 X:45908348-45908370 CTGCACTCCAGGCTGGACGTGGG - Intergenic
1190140084 X:47835559-47835581 CTGCACACCAGGGGCACCATGGG - Intergenic
1192368789 X:70496752-70496774 CTGTACTTCAGGGGCTCTGTTGG + Intronic
1200404387 Y:2795247-2795269 CTGCACTTTAGGTTCTCCATGGG - Intergenic