ID: 1113459364

View in Genome Browser
Species Human (GRCh38)
Location 13:110471228-110471250
Sequence CACGGGGCTCCCCTGTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113459353_1113459364 2 Left 1113459353 13:110471203-110471225 CCCAGCCATGTGTGCGTGAACGC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1113459364 13:110471228-110471250 CACGGGGCTCCCCTGTAGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 148
1113459354_1113459364 1 Left 1113459354 13:110471204-110471226 CCAGCCATGTGTGCGTGAACGCC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1113459364 13:110471228-110471250 CACGGGGCTCCCCTGTAGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 148
1113459355_1113459364 -3 Left 1113459355 13:110471208-110471230 CCATGTGTGCGTGAACGCCACAC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1113459364 13:110471228-110471250 CACGGGGCTCCCCTGTAGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113459364 Original CRISPR CACGGGGCTCCCCTGTAGGG GGG Intronic
900590369 1:3456763-3456785 CACGGGGTTCCCCCAAAGGGTGG - Intronic
901811457 1:11769036-11769058 CCCTGGGCTCTCCTGGAGGGCGG - Intronic
902666268 1:17940993-17941015 CCTGGGGCTACCCTGCAGGGAGG - Intergenic
903228856 1:21909832-21909854 CACTGGGCCCTCCTGTAGGTGGG - Intronic
904246879 1:29194240-29194262 CACGGGGCTGCCCTATGGGCAGG + Intronic
904500602 1:30910588-30910610 GAAGGGGCTCCCCAGGAGGGAGG + Intergenic
907945730 1:59134956-59134978 CAAGGGTCTTCCCTGTAGGGTGG + Intergenic
913073785 1:115324087-115324109 CAAGGGGCTCACCTGGATGGAGG + Intronic
915910467 1:159911925-159911947 CATGGGGCTCCCCTGTGAGGTGG - Intergenic
922748376 1:228059737-228059759 GACGGGGCTCCCCTGGACAGAGG + Exonic
923862644 1:237906929-237906951 CACTGTGCTTCCCTGAAGGGAGG + Intergenic
1064808351 10:19163486-19163508 CACGGGGGTCTACTTTAGGGGGG + Intronic
1068370252 10:56103820-56103842 CACCGGGGTCTCCTGGAGGGTGG - Intergenic
1069101797 10:64331496-64331518 CACTGGGCTCTCCTTGAGGGTGG - Intergenic
1071125723 10:82332573-82332595 CATAGGGCTGCCATGTAGGGTGG - Intronic
1076342132 10:129756408-129756430 CTCGGGGCTGCCCTCTGGGGAGG + Intronic
1076681013 10:132171172-132171194 CACAGGGCTCCTCTGAAGCGAGG + Intronic
1076855920 10:133115610-133115632 CAGGTGGCTCCCCAGGAGGGAGG + Intronic
1077078092 11:710225-710247 AAGGGGGCTTCCCTGGAGGGAGG + Intronic
1077606792 11:3617670-3617692 CTCAGGGCTCCCCTGGAGTGGGG - Intergenic
1078356721 11:10637690-10637712 CAGTGGGCTCCCCTGGTGGGAGG + Intronic
1078830377 11:14972233-14972255 CTCGGGGCTCACCTGGCGGGAGG + Exonic
1084437782 11:69154421-69154443 CACGGAGCTCACCTGTGGAGAGG + Intergenic
1084488964 11:69467876-69467898 CTCGGGGCCTCCCTGAAGGGCGG - Intergenic
1085390421 11:76179322-76179344 CACAGGGCTCCTCTGAAGGCCGG - Intergenic
1089492194 11:118890850-118890872 CACAGGGTTCCCCTGGAGTGGGG - Intronic
1091294828 11:134466383-134466405 CACGGCGCTCCTCTGAGGGGTGG - Intergenic
1091634030 12:2183776-2183798 CACGGGGCTCTCCAGCAGGTAGG + Intronic
1095085766 12:38056349-38056371 CACGGGGCTCTACTTGAGGGAGG - Intergenic
1096110680 12:49027311-49027333 GGCGGGGCTCTCCTGTAGGAGGG + Exonic
1098568730 12:71964943-71964965 CACTGGGGTCTCCTGGAGGGTGG - Intronic
1101533676 12:105597697-105597719 CACGGGGGTCTCCTTGAGGGAGG + Intergenic
1105202900 13:18194742-18194764 CACCGGGCTCCCCAGGAGGCAGG - Intergenic
1105278238 13:18948487-18948509 GCCGGGCCTCCCCTGTAGGGGGG - Intergenic
1110300652 13:73922888-73922910 CCCAGGCCTCCTCTGTAGGGTGG + Intronic
1110891524 13:80704331-80704353 GGGGGGGGTCCCCTGTAGGGGGG + Intergenic
1111160100 13:84383879-84383901 CAAGGGGCTCTCCTGTAGCTAGG - Intergenic
1113459364 13:110471228-110471250 CACGGGGCTCCCCTGTAGGGGGG + Intronic
1113597324 13:111542847-111542869 CAGGGGGCTTCCCTGCACGGTGG - Intergenic
1113874692 13:113586795-113586817 CACTGGGGTCCCCTTTAGAGAGG + Intronic
1114066199 14:19061794-19061816 CACCGGGCTCCCCAGGAGGCAGG - Intergenic
1114096069 14:19338230-19338252 CACCGGGCTCCCCAGGAGGCAGG + Intergenic
1116937176 14:50752942-50752964 CAATGGGCTCCCCTGTAGAGTGG - Intronic
1117540494 14:56742158-56742180 CATGGAGCTCACCTGTACGGTGG + Intergenic
1119480788 14:74956298-74956320 CAGGGGGCTGCCCCGCAGGGAGG - Intergenic
1119772276 14:77227688-77227710 GACAAGGCTCCCCTCTAGGGTGG + Intronic
1120669266 14:87345305-87345327 CAGATGGCTCCCCTGGAGGGAGG + Intergenic
1121483045 14:94292971-94292993 CAAGGGGCTCCTCTGCAGGAAGG - Intronic
1123686550 15:22801914-22801936 CACTGAGCTTCCCTGGAGGGAGG + Intronic
1124212857 15:27777324-27777346 CAAGGGACTCCCTTCTAGGGAGG + Intronic
1124365975 15:29071905-29071927 CATGGGACTCCCCAGTACGGAGG - Intronic
1125513230 15:40303853-40303875 CCAGAGGCTCCCCTGTAGGCAGG - Intronic
1125577836 15:40767370-40767392 GACGGGGCACCCCTGTGGAGGGG + Exonic
1128290196 15:66472564-66472586 CAGGGGGCTGCCCTGTAGCCAGG + Intronic
1129302907 15:74636564-74636586 CACGGGGCAGCAATGTAGGGAGG + Intronic
1132111089 15:99102909-99102931 CAGGGGGCAGCCCTGCAGGGTGG - Intronic
1132554551 16:566758-566780 CATGGGGGACCCCTGGAGGGGGG + Intergenic
1135537129 16:23302848-23302870 CACAGGGCATCCCTGTGGGGTGG + Intronic
1135762551 16:25148785-25148807 CACAAGCCTCCCCTGCAGGGAGG + Intronic
1136631145 16:31489935-31489957 CACAGGGCAGCCATGTAGGGTGG + Exonic
1137720077 16:50622624-50622646 CACGTGCCTCGCCTGTAAGGTGG + Intronic
1139965946 16:70745453-70745475 CACGGACCTGCCCTGTTGGGAGG + Intronic
1142178026 16:88653897-88653919 CAGGGGCCTGCCCTGTGGGGTGG - Intronic
1142180754 16:88668397-88668419 CACGGGGGTCCACTTGAGGGGGG - Intergenic
1142366727 16:89654068-89654090 CTCGTGCCTCCCCTGTTGGGGGG - Intronic
1142375036 16:89702157-89702179 GGCGGGCCTCCCCTGTGGGGCGG + Intergenic
1142559022 17:799014-799036 GACTCGGCTCCCCTGGAGGGAGG + Intergenic
1145015125 17:19391616-19391638 GTGGGGGCTGCCCTGTAGGGAGG + Intergenic
1146176414 17:30668528-30668550 CAAGGGGCCCCGCTGGAGGGGGG - Intergenic
1146349874 17:32084642-32084664 CAAGGGGCCCCGCTGGAGGGGGG - Intergenic
1147332511 17:39707131-39707153 CACGGGCCTCACCTGCAGGAAGG - Exonic
1148683321 17:49486896-49486918 CCTGGGGCTCCCCAGTAGTGTGG + Intergenic
1151224857 17:72640547-72640569 CCCCGGGCTGCCCTGCAGGGCGG - Intergenic
1151569852 17:74920832-74920854 CCCTGGGCTCACCTGTTGGGTGG - Intronic
1152487541 17:80603988-80604010 CACGGGCCACCCCTGTAAGCAGG + Intronic
1159880335 18:73852925-73852947 GACAGGGCTGCCCTGTAGAGAGG - Intergenic
1160662653 19:308315-308337 TACGGGGCTCCCCAGCAGTGGGG + Intronic
1160798027 19:954709-954731 CGGGGGGCTCCCCTCCAGGGAGG + Intronic
1161300306 19:3539268-3539290 GGAGGGGCTCACCTGTAGGGAGG - Intronic
1162124781 19:8493599-8493621 CAGGGGGCTCCTCTGCAGGTGGG - Intronic
1162581812 19:11536034-11536056 CCCGGGGCTGCCCCGTTGGGGGG + Intergenic
1164671737 19:30076363-30076385 GAGGGGGCTCCCCTGTGGGCTGG - Intergenic
1165008945 19:32829163-32829185 CACGGGGCGCCACTGGACGGCGG - Intronic
1166753026 19:45173767-45173789 AACGGGGCTCCCCAGGAGGAAGG + Intronic
1167144470 19:47673480-47673502 CAGGGGGCTCCCCTGAAGGGAGG + Intronic
1167190604 19:47986387-47986409 CACGCGGCTCTCCTGTCTGGGGG - Intronic
925080068 2:1056522-1056544 CACGGCGCCCCGCTGTGGGGAGG + Intronic
925080091 2:1056594-1056616 CACGGCGCCCCGCTGTGGGGAGG + Intronic
925423367 2:3729267-3729289 CCCAGGGCTCCTCTGTGGGGAGG + Intronic
925906597 2:8543496-8543518 CATGGGGCTCCCCGGGAGAGGGG + Intergenic
926068809 2:9867406-9867428 CACAGGGCTTCCCTATAGGGAGG + Intronic
926120905 2:10240758-10240780 CACGCAGCTCCTCTGTGGGGAGG - Intergenic
934043182 2:88147141-88147163 CAAGGGGCTCTCCTGTAGCTAGG - Intergenic
935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG + Intergenic
947336603 2:229092230-229092252 CAAGGGTCTCCACTGTACGGTGG + Intronic
947750169 2:232527864-232527886 CCTGGGGCTTCCCTGTAGGGAGG - Intronic
948794875 2:240397396-240397418 CATGGGGCCCACCTGTAGGATGG - Intergenic
1171977518 20:31605029-31605051 CACTGGGCTCCTCTGGAAGGAGG - Intergenic
1172608734 20:36233381-36233403 CACTAGGCTCCCATGTAGGGGGG - Intergenic
1175281125 20:57804802-57804824 CAGGGGGCTCCCCTGGAAGGAGG - Intergenic
1175363694 20:58435494-58435516 CTCGGGGCTCCCCTTTGGGCGGG - Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1175648138 20:60693571-60693593 CGCGTGGCTCCACTTTAGGGTGG + Intergenic
1175962945 20:62646232-62646254 CACAGGGCTCTCCTGGAGGAGGG + Intronic
1176377083 21:6092088-6092110 CCCGGGGCTCCCTTGGAGGCAGG - Intergenic
1176715057 21:10343263-10343285 CACCGGGCTCCCCAGGAGGCAGG + Intergenic
1179277887 21:39908491-39908513 CACGGTTCTCCCCTGTAAGCTGG + Intronic
1179746392 21:43446156-43446178 CCCGGGGCTCCCTTGGAGGCAGG + Intergenic
1180484677 22:15784385-15784407 CACCGGGCTCCCCAGGAGGCAGG - Intergenic
1180603291 22:17036675-17036697 CACCGGGCTCCCCAGGAGGCAGG - Intergenic
1181031533 22:20150628-20150650 CAGGGGGCTCCCAGGCAGGGGGG - Exonic
1181511860 22:23392897-23392919 CAGGGGGCTCCCAGGCAGGGGGG + Intergenic
1184248220 22:43246259-43246281 AAGGGGGCTCCCCTGTGGGTGGG + Intronic
1184754331 22:46507770-46507792 CACAGTGCTCACCTGTAGTGGGG - Intronic
1185406761 22:50656558-50656580 CCCCAGGCTCCCCTGAAGGGAGG + Intergenic
954053177 3:47999680-47999702 CACTGGGGTCTCCTGGAGGGTGG + Intronic
954713836 3:52517449-52517471 CCCGGGCCTGCCCTGAAGGGAGG - Intronic
956859264 3:73306305-73306327 CGCAGGGCTACTCTGTAGGGAGG + Intergenic
958984139 3:100761034-100761056 CACTGGGGTCCACTGAAGGGTGG - Intronic
961600997 3:128062034-128062056 CACAGTGCTCTCCTGTAGGATGG - Intronic
963607260 3:147421750-147421772 CGCGGGGCTCCCCAGTGAGGCGG + Intronic
963609325 3:147445145-147445167 CACTGGGCTCCACTTGAGGGTGG - Intronic
968508289 4:982485-982507 CACCGGGCTCCCCAGCAGTGTGG - Intronic
968967618 4:3777069-3777091 CACAGGGCTCCCACTTAGGGTGG - Intergenic
972574383 4:40338557-40338579 CAGGGGGCTCCCCTGGGTGGAGG + Intronic
984639420 4:182145018-182145040 CCCGGGGCTCCCCAGTACGGGGG - Intronic
985871993 5:2564366-2564388 CGCCGTGCTCCCCTGCAGGGTGG - Intergenic
986176959 5:5360535-5360557 GAGTGGGCTCCCCTGCAGGGAGG + Intergenic
993333135 5:86624237-86624259 CAGGAGGATCCCCTGGAGGGTGG - Intergenic
997346570 5:133196616-133196638 CAGGAGGCCCCCCTGTAGTGAGG + Exonic
1002712486 5:181203909-181203931 CACGGGGCTTCCTGGTGGGGGGG - Intronic
1003336706 6:5180244-5180266 CCCGGGGCTACCATGTATGGTGG + Intronic
1007665032 6:43508902-43508924 CAGGGGGCTCCCATGCAGGCTGG + Exonic
1017447920 6:154526161-154526183 CTCTTAGCTCCCCTGTAGGGAGG - Intergenic
1019729334 7:2621928-2621950 CCAAGGGCTCCCCTCTAGGGTGG + Intergenic
1019925762 7:4191065-4191087 AACAGGGATCCCCTGAAGGGTGG - Intronic
1023706406 7:42946099-42946121 CACGGTCCACCCCTGCAGGGAGG + Intronic
1023878447 7:44305600-44305622 GACGGGGCACCCCTGTGAGGTGG + Intronic
1033832389 7:145269968-145269990 CACCAGGCGCCCCTGCAGGGCGG - Intergenic
1035337756 7:158141032-158141054 CACGACCCTCCACTGTAGGGGGG + Intronic
1041152139 8:54945422-54945444 CAAGCGACTCCCCTGAAGGGTGG + Intergenic
1047481418 8:125286979-125287001 AACGTGCCTCCTCTGTAGGGTGG + Intronic
1047732630 8:127738948-127738970 CTCGGGGCTGCCCTGCGGGGAGG - Exonic
1049003421 8:139840217-139840239 CCCTGGCCTCCCCTGCAGGGAGG + Intronic
1049247618 8:141571226-141571248 CCAGGGGCTCCCCAGTGGGGTGG + Intergenic
1049673834 8:143881012-143881034 CACTGGGCTCCCCTGATGGCAGG - Intergenic
1051106710 9:13588562-13588584 CACGGGGCTCCCAGGCAGTGTGG + Intergenic
1052331297 9:27271653-27271675 CATGGGGCTCCCCTGTGCAGAGG + Intergenic
1058991129 9:110256166-110256188 GACGAGGGTCCCCTGGAGGGCGG - Intronic
1060727721 9:126017031-126017053 CCCGGGACACCCCAGTAGGGTGG - Intergenic
1061326529 9:129867962-129867984 AACAGGGCTCCCCTGGAGGCAGG - Intronic
1061955547 9:133959507-133959529 CCCTGGGCTCCCTGGTAGGGAGG - Intronic
1062084795 9:134642876-134642898 CACTGGGGACCCCTGCAGGGTGG + Intronic
1062466961 9:136685797-136685819 CCCTGGGATCCCCTGTAGGCAGG - Intronic
1062589299 9:137266320-137266342 GTCGGGGCTGTCCTGTAGGGAGG - Exonic
1187915453 X:24149494-24149516 CACTGGGCTCCCCGGTCGCGGGG + Intronic
1191960997 X:66702420-66702442 CAAGGGTCTCTCCTGTAGGTAGG - Intergenic
1193052236 X:77113822-77113844 CTCAGTGCTCCCCTGTTGGGTGG - Intergenic
1193251796 X:79299360-79299382 CATGGGGCTCCCTTGTAGAGAGG - Intergenic
1196550163 X:117015121-117015143 CACGGGGGTCTCCTGGAGGTTGG + Intergenic