ID: 1113459649

View in Genome Browser
Species Human (GRCh38)
Location 13:110472986-110473008
Sequence TGGCAGGCCGATGGGACCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113459649_1113459665 5 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459665 13:110473014-110473036 AGATGGGCCCCCTGGGGAAAGGG 0: 1
1: 0
2: 2
3: 21
4: 263
1113459649_1113459662 -1 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459662 13:110473008-110473030 AGGGCCAGATGGGCCCCCTGGGG 0: 1
1: 0
2: 3
3: 28
4: 262
1113459649_1113459672 26 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459672 13:110473035-110473057 GGGCCTCCCTGGAGAAGTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 244
1113459649_1113459673 27 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459673 13:110473036-110473058 GGCCTCCCTGGAGAAGTCCTGGG 0: 1
1: 0
2: 1
3: 24
4: 251
1113459649_1113459661 -2 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459661 13:110473007-110473029 CAGGGCCAGATGGGCCCCCTGGG 0: 1
1: 0
2: 7
3: 29
4: 283
1113459649_1113459666 6 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459666 13:110473015-110473037 GATGGGCCCCCTGGGGAAAGGGG 0: 1
1: 1
2: 3
3: 37
4: 279
1113459649_1113459671 15 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459671 13:110473024-110473046 CCTGGGGAAAGGGGCCTCCCTGG 0: 1
1: 1
2: 3
3: 66
4: 506
1113459649_1113459660 -3 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459660 13:110473006-110473028 CCAGGGCCAGATGGGCCCCCTGG 0: 1
1: 2
2: 3
3: 50
4: 521
1113459649_1113459664 4 Left 1113459649 13:110472986-110473008 CCCCAGGTCCCATCGGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1113459664 13:110473013-110473035 CAGATGGGCCCCCTGGGGAAAGG 0: 1
1: 0
2: 2
3: 19
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113459649 Original CRISPR TGGCAGGCCGATGGGACCTG GGG (reversed) Exonic
900083426 1:875650-875672 GGGCATGCCTAGGGGACCTGGGG - Intergenic
900393291 1:2443158-2443180 TGGCCGCCCGATGGGAGCTAAGG + Intronic
901140670 1:7027379-7027401 TGGGAGGCCCACGAGACCTGGGG + Intronic
901199065 1:7456590-7456612 TGCCAGGCTGCTGGGATCTGCGG - Intronic
904596945 1:31652750-31652772 TGGCTGGCCCATGGGACCCGGGG + Exonic
905338658 1:37263121-37263143 TGTCAGGCCAATGGAAACTGAGG + Intergenic
907964926 1:59319753-59319775 TGGCAGGCAGAGGGAGCCTGTGG + Intronic
908682870 1:66682115-66682137 TGGGGGGCCTGTGGGACCTGGGG - Exonic
908766843 1:67561921-67561943 AGCCAGGCCGCTGGCACCTGAGG - Intergenic
922583638 1:226717735-226717757 GGGCAGCCCGGTGGGAGCTGTGG - Intronic
923059365 1:230456190-230456212 AGGCAGGCTGCTGGGACCAGGGG + Intergenic
1063118887 10:3090610-3090632 TGTCAGGGCGATGGCATCTGGGG + Intronic
1064007425 10:11709536-11709558 TGGAAGGGAGATGGGAGCTGGGG + Intergenic
1069993471 10:72328912-72328934 TGGCAGGAGGTTGGGCCCTGAGG + Intergenic
1073483006 10:103798731-103798753 TGGGAGCCCGCTGGGAGCTGGGG - Intronic
1076204509 10:128585997-128586019 TGGGTGGCCTCTGGGACCTGAGG + Intergenic
1076668140 10:132104492-132104514 TGGCGGGCAGATGGGCTCTGAGG + Intergenic
1077340280 11:2023346-2023368 TGGCGGGAAGATGGGACCTTGGG + Intergenic
1077563729 11:3282842-3282864 TGACAGGTCTCTGGGACCTGTGG - Intergenic
1077569619 11:3328659-3328681 TGACAGGTCTCTGGGACCTGTGG - Intergenic
1078064351 11:8068233-8068255 AGGCAAGCCCATGGGACCCGAGG - Intronic
1078877823 11:15415726-15415748 TGGCAAGCAGATGGGTCGTGGGG - Intergenic
1081607896 11:44538571-44538593 TGACGGTCCGATGAGACCTGAGG - Intergenic
1083812145 11:65112074-65112096 GGGCAGAGAGATGGGACCTGGGG + Intronic
1083841852 11:65309149-65309171 TAGCACCCCCATGGGACCTGGGG - Intergenic
1085775665 11:79364303-79364325 TGGCAGGCCCATTGGGCCGGGGG - Intronic
1086417722 11:86605929-86605951 TGGGAGGCCCATGGGACTTGGGG - Intronic
1089443594 11:118534501-118534523 TGGGAGGCGGATGAAACCTGCGG - Exonic
1091318449 11:134632600-134632622 TGGCAGGCCGAGGGCTGCTGGGG - Intergenic
1202823265 11_KI270721v1_random:78535-78557 TGGCGGGAAGATGGGACCTTGGG + Intergenic
1091400552 12:178174-178196 TGGCGGGCCGTGGGGACCGGTGG - Exonic
1091685323 12:2557438-2557460 TGGGAGGCAGATGGGGGCTGAGG - Intronic
1095103419 12:38205060-38205082 TGGTATGCCCAGGGGACCTGGGG - Intergenic
1099658654 12:85527516-85527538 TGGCAGGGCAATGGGACCCTGGG - Intergenic
1100844506 12:98644991-98645013 GCGCAGGCCGACGGGACCCGAGG + Exonic
1102762155 12:115397323-115397345 TGTCAGGCTAATGGGACATGTGG - Intergenic
1102898405 12:116616999-116617021 TGCCAGGCTGGGGGGACCTGGGG + Intergenic
1113459649 13:110472986-110473008 TGGCAGGCCGATGGGACCTGGGG - Exonic
1115149740 14:30270709-30270731 TGACAGGCTGAGGGGAGCTGGGG - Intergenic
1115409897 14:33062071-33062093 TGGCAGTCCTCTGGGATCTGAGG - Intronic
1117898330 14:60509707-60509729 TGGAAGACCCCTGGGACCTGTGG + Exonic
1118346951 14:64947706-64947728 AGGCAGGCCCATGGCACATGAGG + Exonic
1121094165 14:91204405-91204427 TGCCAGGCCCATGGGAGATGTGG - Intronic
1121185496 14:91964412-91964434 TGGCAGACCGATGGGAGGAGGGG - Intergenic
1122442224 14:101739944-101739966 AGGCAGGCCCATGGGGGCTGGGG + Intergenic
1128243461 15:66117250-66117272 TGGCAGGGAGATGGGATGTGTGG - Intronic
1128738767 15:70069237-70069259 TGGGAGGCGGTTGGCACCTGTGG - Intronic
1129805043 15:78448810-78448832 TGGCAGGCCTAGAGAACCTGTGG + Intronic
1131116764 15:89800791-89800813 TGGGAGGCCGAGGCGACCTGGGG - Intronic
1131912653 15:97224592-97224614 TGGGTGGTCGATGGGACCCGGGG - Intergenic
1132346333 15:101111336-101111358 TGAGAGGCCGATGGGGTCTGGGG - Intergenic
1132461299 16:56437-56459 ATGCAGTCCTATGGGACCTGGGG - Intronic
1132682863 16:1150776-1150798 TGGCAGGCCGGAGGGAGCCGGGG - Intergenic
1134286561 16:12867113-12867135 TGGCTGACCTAGGGGACCTGGGG - Intergenic
1134662385 16:15993899-15993921 TGGCAGACAGATGGAGCCTGAGG - Intronic
1136053020 16:27666648-27666670 TGGCAGGCCGAAGTCACTTGAGG - Intronic
1136251992 16:29011470-29011492 TGGAAAGCCAATGGGACGTGGGG + Intergenic
1138412916 16:56853860-56853882 AGCCAGGCCGAAGGGACCTGGGG - Intergenic
1139034045 16:62921650-62921672 TGGCAGGCAGATGAGTCCTACGG + Intergenic
1139958843 16:70706191-70706213 TGGCAGGCTGTTGGCAGCTGTGG + Intronic
1142121140 16:88387263-88387285 TGGACGGCCGATAGCACCTGAGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142408307 16:89903332-89903354 TGGCAGGCTGGTGGGAGCGGAGG - Intronic
1142636678 17:1261895-1261917 TGGCTGGCCTAGGGGACCTGAGG + Intergenic
1143478421 17:7215895-7215917 TGGCAGGCAGCTGGGGGCTGGGG - Intronic
1144438578 17:15262050-15262072 TGGCAGGAGGCTGGGAACTGGGG + Intronic
1147994037 17:44351659-44351681 TGGCAGGCTGAGGTGAGCTGGGG - Exonic
1148216796 17:45837721-45837743 GGGCAGGCAGATGGAGCCTGGGG + Intergenic
1148550827 17:48550130-48550152 TGGCAGGCAGATGGAACAAGGGG + Exonic
1149620347 17:58040091-58040113 GGGCAGGGAGAAGGGACCTGGGG + Intergenic
1151944480 17:77312021-77312043 TGGCAGCCTGTTGAGACCTGGGG - Intronic
1152219853 17:79057524-79057546 TGGGAGGCCGACGTCACCTGAGG + Intergenic
1152375400 17:79916146-79916168 TGGCTGGCAGGTGAGACCTGCGG - Intergenic
1152630392 17:81408374-81408396 TGGGAGGCAGGTGGGGCCTGGGG - Intronic
1152813407 17:82392871-82392893 TGGAAGGCCCATGAGAGCTGAGG - Intronic
1156491914 18:37501410-37501432 TGGCAGCCCTCTGGGGCCTGCGG + Intronic
1160732379 19:647122-647144 TGGCAAGGCGTGGGGACCTGCGG - Intergenic
1162824407 19:13242933-13242955 TGGCAGGAAGATGGGGCATGGGG - Intronic
1163238928 19:16046981-16047003 AGGCAGGCAGATGGCGCCTGAGG + Intergenic
1164477362 19:28585896-28585918 TGGCAGGGCGGTGGGAGCAGAGG - Intergenic
1164557692 19:29266301-29266323 TGGAAGGAGGATGAGACCTGGGG - Intergenic
1164870948 19:31642199-31642221 TGGCAGGCAGATTGGTGCTGAGG - Intergenic
1165553299 19:36606602-36606624 TGGCAGGCCGAGGGGGCGGGGGG - Intronic
1166995142 19:46716502-46716524 TGGCAGGCGGAGGGGACCTGAGG + Exonic
1168299075 19:55393117-55393139 TGGGAGGCCGGTGGGAGCTGGGG - Intronic
925597264 2:5568238-5568260 TGGCAGGCAGGTAGGAGCTGGGG - Intergenic
928632527 2:33208599-33208621 TGGCAGGCAGGGGGCACCTGAGG + Intronic
935726125 2:106025580-106025602 TGGCAGGACGATGGCACATTTGG + Intergenic
935996667 2:108781075-108781097 TGGGAGGCCGAGGTCACCTGAGG - Intronic
938438819 2:131306786-131306808 TGGCAGTCTGGTGGGACATGTGG - Intronic
942073338 2:172335083-172335105 TGGCATGCAAATGGGGCCTGGGG - Intergenic
948678254 2:239611784-239611806 TGGCAGGGCAATGGGATCTTCGG - Intergenic
1169005979 20:2207524-2207546 CGGGAGGCCGCAGGGACCTGAGG + Intergenic
1170004067 20:11646748-11646770 TGAGAGGCCGAGGGGGCCTGGGG - Intergenic
1171186706 20:23128181-23128203 TGGGAGGCCGAGGGGTCCAGGGG + Intergenic
1174189862 20:48732777-48732799 GTGCTGGCCGATGGGACGTGAGG + Intronic
1174810735 20:53643397-53643419 AGGCAGGCCGAGGGAACCTCTGG - Intergenic
1176145459 20:63563446-63563468 TGGCAGGCCGGCCGGGCCTGCGG - Exonic
1179504334 21:41830934-41830956 GGGCAGGGCGAGGGGACCTGGGG - Intronic
1179595545 21:42440662-42440684 TGGCAGGCACAGGCGACCTGGGG - Intronic
1180983186 22:19888985-19889007 TGGCGTCTCGATGGGACCTGAGG - Intronic
1181129418 22:20721603-20721625 TGGCTGGGGGCTGGGACCTGGGG + Intronic
1182516995 22:30864668-30864690 GGACAGGCCGGTGGGGCCTGGGG - Intronic
1183282516 22:36939273-36939295 GGGCAGGCTGGCGGGACCTGGGG + Exonic
1183348284 22:37319759-37319781 TGGCAGGCACCTGGGTCCTGGGG + Intergenic
1183720706 22:39559931-39559953 GGGGAGGCCGCAGGGACCTGCGG - Intergenic
1183830693 22:40417154-40417176 GGGCACGCCCATGGGTCCTGTGG - Intronic
1185085901 22:48740931-48740953 GAGGAGGCAGATGGGACCTGCGG - Intronic
950123686 3:10498513-10498535 TTGCAGGCCCAAGGGAGCTGTGG - Intronic
950488834 3:13289909-13289931 TGGCAGGCCTCTGGGAACTAGGG - Intergenic
953423372 3:42772468-42772490 TGGCAGGCCGATGGGGCAAGGGG - Intronic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
954635494 3:52068703-52068725 TGGCTGGCCGATGAGATGTGGGG - Intergenic
955067895 3:55548142-55548164 TGCCAGGCTGAAGTGACCTGTGG + Intronic
957209380 3:77240106-77240128 TGGGAGGTCGATGGGACTGGGGG + Intronic
961735801 3:129001573-129001595 TGGCGGGGCGAAGGGACCGGAGG + Intronic
963744208 3:149109702-149109724 TGGGTGGTCGATGGGACCGGTGG - Intergenic
966881724 3:184354518-184354540 CCCAAGGCCGATGGGACCTGAGG + Intronic
966943534 3:184761705-184761727 TGGCAGGAGGAGGGGACGTGTGG + Intergenic
968618744 4:1594084-1594106 TGGCAGCCTGGGGGGACCTGGGG - Intergenic
968880299 4:3295092-3295114 GGCCAGGCCGAGGAGACCTGTGG + Intronic
969287064 4:6209451-6209473 GGGCAGGGAGATGGGACCAGGGG + Intergenic
969354111 4:6615061-6615083 TGCCAGGCCTTGGGGACCTGAGG - Intronic
970373815 4:15435904-15435926 TGGAAGGCCGATGCGACCATGGG - Exonic
978954595 4:114598719-114598741 TGGCCGCCCGCTGGGAGCTGCGG + Exonic
984221982 4:176989568-176989590 TGGCAGTCAGATAGGGCCTGAGG + Intergenic
986818937 5:11444787-11444809 TTGCTGGCCCCTGGGACCTGTGG + Intronic
986871325 5:12050022-12050044 TTGCAGGCAGATGTCACCTGTGG + Intergenic
987598006 5:20026240-20026262 TGCCAGGCAGATGAGATCTGTGG + Intronic
992418361 5:76575326-76575348 TCTCAGGCCCATGGGACCTCTGG + Intronic
997866904 5:137471892-137471914 TCACATGCCCATGGGACCTGAGG + Intronic
998459465 5:142298916-142298938 GTGCAGGCCGATGGGAGGTGAGG - Intergenic
1000607708 5:163342335-163342357 AGGCAGGCAGATAGTACCTGTGG - Intergenic
1002661072 5:180791550-180791572 AGGCAGGCCGATGCAGCCTGGGG + Exonic
1003573239 6:7269673-7269695 TGCCAGGCCCATAGGAGCTGGGG + Intronic
1003904325 6:10684898-10684920 TGGCAGGCAGATGGCACAGGGGG + Intronic
1005920667 6:30397873-30397895 TGCCAGGCCCAGGGGCCCTGGGG + Intergenic
1007252790 6:40507584-40507606 GGGCAGGCCGTTGGGACCCTTGG + Intronic
1008169705 6:48187836-48187858 TGGCAGGGCGAGGGGAGCTGAGG - Intergenic
1010984098 6:82402537-82402559 TGGGAGGCCGAGGGCACCTCAGG - Intergenic
1011879879 6:92011760-92011782 TGGGCGGTCGATGGGACCCGGGG + Intergenic
1017788706 6:157776695-157776717 TAAGAGGCCCATGGGACCTGGGG - Intronic
1017951230 6:159136976-159136998 TGGTTGGCCGATGGGAGCTAGGG + Intergenic
1018043853 6:159949160-159949182 TGTCAGGTGGATGGGAGCTGAGG - Intergenic
1019216802 6:170449032-170449054 TGGCAGGCTGCAGAGACCTGTGG - Intergenic
1019989873 7:4683301-4683323 GTCCAGGCCGATGGGAGCTGGGG - Intronic
1021359354 7:19692264-19692286 TGGGTGGTCGATGGGACCAGGGG + Intergenic
1021510141 7:21426189-21426211 TGGGAGGAGGAGGGGACCTGAGG + Intergenic
1023352662 7:39335857-39335879 GGGCAGGGCGTTGGGAACTGTGG - Intronic
1026911083 7:74092454-74092476 CTGCAGGCCCATGGGACCTCTGG + Intronic
1029622515 7:101698913-101698935 CAGCTGACCGATGGGACCTGTGG + Intergenic
1031150851 7:118052539-118052561 AGGCAGGCTGATGAGAGCTGCGG - Intergenic
1034129300 7:148699866-148699888 CGCCAGGCCGCTGGGACTTGGGG + Intronic
1034974465 7:155439778-155439800 CTGCAGGCCCATGGGTCCTGCGG - Intergenic
1037803423 8:22047140-22047162 TGGCAAGCCACTGGGATCTGTGG + Intronic
1038423707 8:27451299-27451321 TGGGAGGCCGAGGGGCCCTGGGG - Intronic
1040334530 8:46409332-46409354 TGGCAGGCCGATGGGATTCAAGG + Intergenic
1042253599 8:66781041-66781063 TGGCAGATGGATGGGGCCTGCGG - Intronic
1044806959 8:96018177-96018199 TGGCAGGGCTATGAGTCCTGAGG + Intergenic
1046558107 8:115801932-115801954 TGTCAGGGAGATGGAACCTGTGG - Intronic
1047204711 8:122793829-122793851 TGGCAGGGCCATGGGACCAATGG + Intronic
1047918495 8:129608467-129608489 GGGCAAGCCAAAGGGACCTGGGG - Intergenic
1050669813 9:7983153-7983175 TGGCAGTCAGATGGGAGCTGAGG + Intergenic
1052743980 9:32421614-32421636 AGGCAGGCAGATCTGACCTGAGG + Intronic
1053592141 9:39525327-39525349 TGGGAGGCCGAGGGGGCGTGGGG - Intergenic
1054462868 9:65475034-65475056 TGGCAGGCCTCTGAGAGCTGGGG - Intergenic
1054574162 9:66839958-66839980 TGGGAGGCCGAGGGGGCGTGGGG + Intergenic
1055654140 9:78436781-78436803 GGGCTGGCCGGTGGGACCCGGGG + Intergenic
1060212750 9:121720546-121720568 TGGCTGACAGATGTGACCTGAGG - Intronic
1060508652 9:124216596-124216618 TGGCAGGGCGAAGGGACTTCAGG + Intergenic
1062079982 9:134618698-134618720 TGGGAGTCAGATGGGACTTGAGG + Intergenic
1062369783 9:136231936-136231958 AGCCTGGCAGATGGGACCTGCGG - Intronic
1186920375 X:14272025-14272047 GGGTAGACAGATGGGACCTGAGG - Intergenic
1197745964 X:129932390-129932412 GGGCGGGGCGCTGGGACCTGGGG - Intergenic
1197751021 X:129963569-129963591 TGGGAGGCCGAGGGGAGGTGTGG + Intergenic
1200082047 X:153582043-153582065 TGGGAGACAGTTGGGACCTGAGG + Exonic
1201369486 Y:13246184-13246206 AGGCAGGCCGAAGTCACCTGTGG - Intergenic