ID: 1113460772

View in Genome Browser
Species Human (GRCh38)
Location 13:110480342-110480364
Sequence CCTGGATTTAAAGGAATTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113460767_1113460772 -10 Left 1113460767 13:110480329-110480351 CCATCCAGGAAGCCCTGGATTTA 0: 1
1: 0
2: 0
3: 24
4: 170
Right 1113460772 13:110480342-110480364 CCTGGATTTAAAGGAATTGATGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113460772 Original CRISPR CCTGGATTTAAAGGAATTGA TGG Exonic