ID: 1113461900

View in Genome Browser
Species Human (GRCh38)
Location 13:110488006-110488028
Sequence CAAAACAAAAGCTCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113461900_1113461903 25 Left 1113461900 13:110488006-110488028 CCCACAAAGGAGCTTTTGTTTTG 0: 1
1: 0
2: 0
3: 39
4: 290
Right 1113461903 13:110488054-110488076 TCTCACTCTGTCACCCAGGCTGG 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
1113461900_1113461902 21 Left 1113461900 13:110488006-110488028 CCCACAAAGGAGCTTTTGTTTTG 0: 1
1: 0
2: 0
3: 39
4: 290
Right 1113461902 13:110488050-110488072 AGAGTCTCACTCTGTCACCCAGG 0: 9650
1: 44791
2: 100947
3: 156345
4: 155285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113461900 Original CRISPR CAAAACAAAAGCTCCTTTGT GGG (reversed) Intronic
900531785 1:3157432-3157454 AAAAAAAAAAACACCTTTGTGGG + Intronic
902833475 1:19032818-19032840 CAAACCAAAAGCACCCATGTTGG + Intergenic
903487876 1:23704913-23704935 CAAAAAACAAGCTCCTTAATAGG - Intergenic
903925951 1:26830738-26830760 AAAAACATAAGCTCCTCTGTGGG - Intronic
906577721 1:46905735-46905757 CAAAACAATTGCTCCTGTGGTGG + Intergenic
907229860 1:52986544-52986566 AAAAACAAAAGTTCCTCTGTTGG - Intronic
907616137 1:55928787-55928809 CAAAGGAAAAAATCCTTTGTAGG + Intergenic
908139006 1:61163715-61163737 CAAAACAGAAAATACTTTGTTGG + Intronic
909073925 1:71030016-71030038 CAAAACAGCAGATGCTTTGTAGG + Intronic
909244163 1:73255830-73255852 CAAAACAAAAACCATTTTGTGGG - Intergenic
910451559 1:87351770-87351792 CACAGCAAAAGCACCTGTGTGGG - Intergenic
910566052 1:88643995-88644017 AAAAATAAAAGTTCCTTTTTTGG - Intergenic
911219015 1:95227701-95227723 CAAAACAATAACCCCTTTGTGGG - Intronic
913317372 1:117564363-117564385 CAAGAGAAAAGCACCTTTGAGGG - Intergenic
914246838 1:145892516-145892538 CCAAACAAAAGCCCCAGTGTTGG + Exonic
915231840 1:154451540-154451562 AAAAACAAAAGCTGCTATGGAGG + Intronic
915759713 1:158298260-158298282 GATAACATAAGCTTCTTTGTGGG - Intergenic
917104495 1:171478691-171478713 CAAAACAAAAACACTTTTATAGG - Intergenic
917652237 1:177089330-177089352 AATAACAAAAGCTCCTGTGAGGG + Intronic
919081194 1:192868346-192868368 CATAAGAAAAGCTACTTTGCTGG - Intergenic
920248949 1:204609501-204609523 CAAAGCAAAGCCTCCTATGTCGG - Intergenic
921979999 1:221246336-221246358 CAAAAAATAAGCTTTTTTGTAGG + Intergenic
922320845 1:224485340-224485362 TAGAAGAGAAGCTCCTTTGTAGG + Intronic
922951725 1:229563306-229563328 CAAAACAAAGGCTCTCTGGTCGG + Intergenic
923310938 1:232734962-232734984 AAAAAAAAAAACTCCTCTGTAGG - Intergenic
924507573 1:244700292-244700314 CAAAACAAAAACTATTTTGTGGG - Intronic
924849598 1:247812181-247812203 TAAAACAAAATCTGCTTCGTTGG - Intergenic
1062808401 10:442497-442519 CAAAACAAAAAGTGATTTGTGGG - Intronic
1063125744 10:3135507-3135529 AAAAACAAAAGCTGCTTTCCAGG + Intronic
1063144215 10:3282014-3282036 CAAAACAAAGGCATCATTGTAGG - Intergenic
1066192819 10:33071371-33071393 CACAACCAAAGATGCTTTGTTGG + Intergenic
1066564606 10:36708033-36708055 TAAAACAAAAGCTACTGTGAAGG + Intergenic
1067658400 10:48215195-48215217 CAAAACATAAGCCCCTTAGGAGG + Intronic
1068003411 10:51363986-51364008 CAAATCAAATGCACCTTTTTTGG - Intronic
1068206677 10:53864073-53864095 CAAAGCAAAAGCTCATTTGGAGG + Intronic
1068495440 10:57779812-57779834 CACAACAAAACCTCATCTGTAGG + Intergenic
1069367271 10:67706913-67706935 AAAATCAAGAGCTCCTTTTTGGG - Intergenic
1070941808 10:80355045-80355067 TAAAAAAAAAGCTTCTTTGGGGG + Intronic
1071209285 10:83318615-83318637 CTAAACTATATCTCCTTTGTGGG - Intergenic
1071851274 10:89573019-89573041 CAAAAAAAAAGCTACCATGTGGG - Intergenic
1071981346 10:91007146-91007168 CACACCACAAACTCCTTTGTTGG - Intergenic
1072057466 10:91774362-91774384 CAAAACAAAACCACCTTGCTGGG + Intergenic
1073296285 10:102441038-102441060 AAAAAAAAAAGCTCATTGGTTGG + Intergenic
1074044018 10:109820281-109820303 AAAAACAAAAGCCTCTTGGTGGG - Intergenic
1074790809 10:116885916-116885938 CAAAACAGAAGCTTCTTTGGGGG + Exonic
1075563506 10:123486097-123486119 CATAACAGAAACTCCTTTGGGGG + Intergenic
1078531486 11:12139852-12139874 CAAAACAAAAATTCATTTGAGGG - Intronic
1078956155 11:16197373-16197395 AAAAACATAATCTCCCTTGTCGG - Intronic
1079445809 11:20555345-20555367 CAAAACAATAGGTCCCATGTAGG + Intergenic
1080403516 11:31958277-31958299 GAAAACAAAAGCTCCGGAGTAGG + Intronic
1082173479 11:49034496-49034518 CATAACTAATGCTACTTTGTTGG + Intronic
1082196957 11:49317900-49317922 GAAAACAAAAACTCCCTTGGGGG - Intergenic
1085194878 11:74663109-74663131 CATAAGAAAAGCACCTTTATAGG - Intronic
1085437358 11:76519573-76519595 AAAAACAATAGCTCCTTTCCTGG - Intronic
1086658867 11:89390285-89390307 GAAAACAAAAACTCCCTTGGGGG + Intronic
1086692287 11:89801560-89801582 CATAACTAATGCTACTTTGTTGG - Intronic
1086696090 11:89847649-89847671 CATAACTAATGCTACTTTGTTGG + Intergenic
1086710066 11:89996840-89996862 CATAACTAATGCTACTTTGTTGG - Intergenic
1086713512 11:90038099-90038121 CATAACTAATGCTACTTTGTTGG + Intronic
1086947882 11:92861349-92861371 CAAATCACAAGCTCCATTTTAGG - Intronic
1089140453 11:116280086-116280108 CAAAACCATTGCTCCTTTCTGGG - Intergenic
1089746112 11:120618427-120618449 CAAAAGAAAAGCCCATTTTTAGG + Intronic
1089854423 11:121530150-121530172 AAAAACAAACACTGCTTTGTGGG - Intronic
1090930863 11:131297067-131297089 CCAAACAAATGCTCCTTTCAGGG + Intergenic
1091523585 12:1273406-1273428 CTAAACAAAAGTTACTTTTTTGG + Intronic
1093096536 12:14978191-14978213 CAAAACAAAAGCAGTCTTGTGGG - Intronic
1093840744 12:23896842-23896864 CAAAACAAAATATCCTTCTTTGG - Intronic
1095992698 12:48047683-48047705 CAAATCAAAGGCACCTCTGTGGG + Intronic
1099189790 12:79550576-79550598 CAAAACAAAAGTTCCTTTACTGG - Intergenic
1099726973 12:86443514-86443536 GAAAACAATAGCCCCTGTGTAGG + Intronic
1099880089 12:88457227-88457249 AAAAACAAAAGTTCCTGTGTTGG + Intergenic
1101534163 12:105602160-105602182 CACAAGAAAAGCTGCTTTGGGGG - Intergenic
1102243128 12:111338045-111338067 AAAAAAAAAAGCTCTTTTGTTGG + Intronic
1102694235 12:114785677-114785699 CAAAACCAAAGCTCTTGGGTTGG - Intergenic
1104196477 12:126543848-126543870 CAGAACAAGATCACCTTTGTTGG - Intergenic
1104268104 12:127256506-127256528 AAAAACAAAATCTCATTTCTAGG + Intergenic
1106354139 13:28963604-28963626 CAAAACCAAAACCCCTTTCTTGG + Intronic
1106511925 13:30420283-30420305 CAAAAAAAAACATCCTTAGTGGG + Intergenic
1107266254 13:38559078-38559100 CAAAACACAGCCTCCTTTTTTGG - Intergenic
1108795014 13:54020305-54020327 GCAAACAAAAGCTCCTTTTGCGG - Intergenic
1109486307 13:63025656-63025678 CTAAAGAAAAGCTTCTTTGTAGG - Intergenic
1109844872 13:67975700-67975722 TAAAACAAAGGTTCCTTTCTTGG - Intergenic
1110960032 13:81609688-81609710 CAAAACAAATGCTCAGTTTTAGG - Intergenic
1112676540 13:101708582-101708604 CAAAACAAAAGCTACTGTTTAGG - Intronic
1113180682 13:107621985-107622007 GAAAAAAAAAACTGCTTTGTGGG - Intronic
1113461900 13:110488006-110488028 CAAAACAAAAGCTCCTTTGTGGG - Intronic
1114240951 14:20867457-20867479 CAAAACAAATGCACTTTAGTGGG - Intergenic
1114593836 14:23894189-23894211 CACAAGAAGAGCTCCTTTCTAGG - Intergenic
1115882118 14:37931251-37931273 GAAAACAAAAGAACCTATGTAGG - Intronic
1117044760 14:51802104-51802126 CACAACAAATGCTCTTTTATGGG + Intergenic
1117467037 14:56004071-56004093 CAAAACAAAAGGGGCTTTCTGGG - Intergenic
1117761873 14:59037674-59037696 CAAAACAAAAGCATCTTTTTTGG - Intergenic
1118997332 14:70848580-70848602 CAAAAAAAAACCTCTCTTGTAGG + Intergenic
1119135274 14:72212754-72212776 CACAACATAACCTCCTTTGTAGG + Intronic
1120265076 14:82238387-82238409 GAAAACAGAACCTCCTTTGCAGG + Intergenic
1120529395 14:85613987-85614009 AACAACAAAAGCTCCTGTGCCGG - Intronic
1121074149 14:91052845-91052867 AAAAAAAAAAGCTCTTTAGTTGG + Intronic
1121292605 14:92789093-92789115 GGAAACATAAGCTCCTTTTTGGG - Intergenic
1121627731 14:95398880-95398902 CAAAATTAAAGCTATTTTGTTGG + Intergenic
1122699000 14:103574460-103574482 CAGAAGAAAAGCTGCTTTGGAGG - Intronic
1125082230 15:35688242-35688264 CAAAACTGATGCTCCTTTCTAGG + Intergenic
1127888313 15:63223801-63223823 CAAAAGAAAAACTCCTTTTTTGG - Intronic
1129420488 15:75421989-75422011 TAAAACACATGCTCCTTTTTGGG - Intronic
1129438686 15:75562832-75562854 CAAAACAATACCTGCTTCGTAGG + Intronic
1130453867 15:84084533-84084555 CACAGCAAAAGATTCTTTGTAGG + Intergenic
1131577747 15:93608711-93608733 AAAAAAAAAGGCTCATTTGTTGG - Intergenic
1131758544 15:95593688-95593710 AAAAACAACAGCCCCTGTGTTGG + Intergenic
1131828371 15:96337826-96337848 AAAAAAAAAAACTCCTGTGTCGG + Exonic
1134025741 16:10951968-10951990 TAAAACAAAAGCACTTTTTTTGG - Intronic
1134328976 16:13232996-13233018 CAAAAAAAAAGTTTTTTTGTGGG - Intronic
1134651381 16:15911599-15911621 ACAAACAAAATCTCCTTTTTCGG + Intergenic
1137050470 16:35708140-35708162 TAAAATACAGGCTCCTTTGTGGG - Intergenic
1137379355 16:47983145-47983167 CATAACAAAGGCTCCTCTTTGGG - Intergenic
1138667300 16:58582304-58582326 AAAAACAAAAGTTCCATTCTAGG + Intronic
1139117464 16:63974407-63974429 CAAAACAAAACTTCCTTTTATGG + Intergenic
1140695236 16:77525932-77525954 CACACCAAAATCTCATTTGTAGG + Intergenic
1143069020 17:4274531-4274553 CATACCAAAAGCTCTGTTGTGGG + Intronic
1144179937 17:12742302-12742324 GAAAACAAAAGAGCCTTTGGGGG + Intronic
1144708889 17:17387690-17387712 CAAACCAAATGGTCCTTGGTTGG + Intergenic
1145769309 17:27480991-27481013 CAAAACAAAACTACCTTTGATGG + Intronic
1146244295 17:31265614-31265636 GAAAACAAAAGATTCTTTGTGGG - Intronic
1146618290 17:34374264-34374286 AAAAAGAAATGCTCCTTTGCAGG - Intergenic
1146691755 17:34881636-34881658 CACAACGACAGCTCCTTTCTGGG - Intergenic
1149286648 17:55172431-55172453 AAAAACAAAAGTTACTTTCTTGG + Intergenic
1151206068 17:72507923-72507945 CAAAACAAAAACTCCTATGAAGG + Intergenic
1151871363 17:76839127-76839149 AAAAAAAAAAGCACCTCTGTTGG - Intergenic
1152573082 17:81128973-81128995 CGCACCAAAGGCTCCTTTGTTGG + Intronic
1153186314 18:2490399-2490421 CAATACAAAAATGCCTTTGTAGG + Intergenic
1155333523 18:24741793-24741815 CAAAAAAAAAACTCCTTTTTTGG - Intergenic
1158382471 18:56948416-56948438 AAAAAAAAAAGATCCTTTGTTGG + Intronic
1161578745 19:5069042-5069064 CCAATCCAAAGCACCTTTGTGGG - Intronic
1161731155 19:5961430-5961452 CAAAACAAAAACTGCAGTGTCGG + Intronic
1162241959 19:9362541-9362563 CCAAACAGGATCTCCTTTGTTGG + Intronic
1162712347 19:12604851-12604873 TAAAATAAAATATCCTTTGTAGG + Intronic
1162955653 19:14096567-14096589 CCAACCAAAAGCTCCTGTGTAGG + Intronic
1166881475 19:45933067-45933089 CAAGACAAAAGCCTGTTTGTGGG + Intergenic
1167062330 19:47157369-47157391 GAGTACAAAAGCTGCTTTGTGGG + Intronic
1167497133 19:49826340-49826362 AAAAACAAAAGCTGTTTTGATGG + Intronic
925989763 2:9245198-9245220 CAAACCAGAAGCTCCTGTGTGGG - Intronic
926074652 2:9932335-9932357 CACAACAAAACCTCATCTGTAGG - Intronic
928091115 2:28375667-28375689 CAACACAAAAGTTCCTTTTATGG - Intergenic
929628127 2:43431379-43431401 CAAATCAGAGGTTCCTTTGTGGG - Intronic
930068542 2:47346754-47346776 CAAAACAAAGGTACCTTTGATGG + Intronic
930467570 2:51774211-51774233 CAAACCAAAACCCCATTTGTAGG - Intergenic
931097595 2:58958767-58958789 CCAAATAAAAGCTCTTTTATTGG + Intergenic
935038943 2:99407068-99407090 AAAAAAAAAAGAACCTTTGTAGG - Intronic
937288150 2:120765996-120766018 CTAAACAAAAGTCCCTCTGTGGG + Intronic
937650526 2:124314009-124314031 CACATCAAAAGCTACTTTGAAGG - Intronic
938225207 2:129609900-129609922 TAAAATAAAAGCGACTTTGTGGG + Intergenic
942219150 2:173752549-173752571 AAAAACAAAAACTTCTTTGGGGG - Intergenic
942417315 2:175772752-175772774 AAAACAAAAAACTCCTTTGTGGG - Intergenic
943581028 2:189683726-189683748 GAAAACAGCAGCTCCTCTGTTGG + Intronic
943914036 2:193605150-193605172 CAATACAATAGGTCCTTTTTTGG + Intergenic
943974416 2:194454038-194454060 CAAAACAAAAGCTACTGTTTTGG - Intergenic
944871669 2:203918407-203918429 CAAAACCACAGCTCCTTTCAGGG - Intergenic
945591853 2:211742971-211742993 CAAAAGAAAAGTTCTTTTGATGG - Intronic
946447631 2:219753299-219753321 AAAAACAAAAGCTGCTTTTGTGG - Intergenic
946491555 2:220153698-220153720 CAAAACAAAAAATCCTGTATTGG - Intergenic
946524445 2:220503541-220503563 CAGCACAAAATCTCCTTTGCAGG + Intergenic
1169323325 20:4653885-4653907 CAAAAATAAAGCTCCCTTGCAGG - Intergenic
1170696120 20:18660520-18660542 CTAAATAAAAGCTTCTTTTTTGG - Intronic
1170919767 20:20666826-20666848 CAAATTAAAAGCTCCTGTGGAGG - Intronic
1172528232 20:35613840-35613862 CAAAACAAAAGCACATTCCTGGG + Intergenic
1173318283 20:41964367-41964389 CAAAATCAAAGCTCTTTTGAAGG - Intergenic
1173723032 20:45276823-45276845 TAAACCACAAGCTCCTGTGTAGG + Intergenic
1173998236 20:47356352-47356374 AAAAAAAAAAGCTTCTTTTTTGG + Intronic
1174021842 20:47536469-47536491 CAAAAAATAAGCTCCTTTTTGGG - Intronic
1174397597 20:50257440-50257462 TAAAACAAAACCTCCTTCATGGG + Intergenic
1174514525 20:51081681-51081703 CAAAACAGAAACTTTTTTGTGGG - Intergenic
1175628660 20:60512230-60512252 TAAATCAAAAGCTCCTTCTTGGG - Intergenic
1176205587 20:63886353-63886375 AAAAAAAAAAGCTCCTTTTCAGG - Intronic
1178159252 21:29892822-29892844 CAAAACAAAAAATACTTTGCTGG - Intronic
1178451824 21:32708797-32708819 GAAAAGAAAAACTTCTTTGTGGG + Intronic
1179026765 21:37685295-37685317 GAAATCAAATGATCCTTTGTAGG + Intronic
1182048352 22:27294429-27294451 CAAAACAAAATCTCTCTTGTTGG - Intergenic
1183867550 22:40715832-40715854 AAAAAAAAAAGCTCCTTAGAAGG - Intergenic
954224768 3:49174500-49174522 CAAAACAAGAGAAGCTTTGTTGG + Intronic
954805971 3:53220806-53220828 CAAAACAAAAACTCTCTGGTTGG + Intergenic
954964712 3:54600079-54600101 CAAGACAACAGCTCCTTCCTGGG - Intronic
956562265 3:70592775-70592797 AAAAATAAAAGCTACTTTGTTGG - Intergenic
958169777 3:89924256-89924278 CAAAAAAAAAAATCCTTTTTGGG - Intergenic
958449442 3:94255732-94255754 CAAAAAAAAAGATTCTTTTTTGG - Intergenic
959024817 3:101229144-101229166 AAAAAAAAAAGCGCCATTGTGGG + Intronic
959508686 3:107184207-107184229 GAAAAAAAAAGATCCTATGTGGG - Intergenic
960594953 3:119399810-119399832 CAAACCACAATATCCTTTGTTGG + Intronic
961669174 3:128516511-128516533 AAAAAGAAAAACTCCTTTATTGG - Intergenic
962068076 3:132004257-132004279 CAAAACAAAAGTGCATTTTTCGG + Intronic
962291538 3:134140842-134140864 CACACCAAAACCTCATTTGTAGG + Intronic
963578779 3:147097909-147097931 CAAAAATAAAGCTCCTGTGAAGG + Intergenic
964896939 3:161609508-161609530 AAAATCAAAAGCTGCTTTGGAGG + Intergenic
966141797 3:176766093-176766115 CAAAAAAAAAGCACCTTTATAGG + Intergenic
966149574 3:176851932-176851954 CAAACTCAAAGCTCCTTTTTTGG - Intergenic
967022265 3:185533056-185533078 CCAAACAAAGACTCCTTTGCTGG - Intronic
967296746 3:187972878-187972900 AAAAAAAAAAGCTGCTTTTTGGG - Intergenic
967715166 3:192754211-192754233 CAGTACAAAAGCTCTTTTGATGG - Intronic
967917372 3:194588711-194588733 CCAAACAAAAGCTCCAATCTTGG + Intronic
970245916 4:14063272-14063294 AAAAAAAAAAAGTCCTTTGTTGG - Intergenic
971628003 4:28948958-28948980 CAAAAATAAATCTTCTTTGTTGG - Intergenic
972218717 4:36927390-36927412 CAAAACAAAATCTCCTGTAGAGG + Intergenic
972438637 4:39061266-39061288 AAAAACAAAAACTACTTTGGAGG - Intronic
972517853 4:39825996-39826018 GAAAACAAAAACTTCTTTATTGG - Intronic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974862243 4:67536684-67536706 CAAAACAACAGAGACTTTGTAGG - Intronic
976234624 4:82883119-82883141 CAAAAAAAAAGTTACTTTGATGG + Intronic
977488040 4:97674186-97674208 CAGATCAAAAGCTCTTTTGAGGG + Intronic
979077647 4:116294360-116294382 TAAAAAAAAAGCTCCTCTTTGGG + Intergenic
979298378 4:119057973-119057995 TAAAAAAAACGCTCCTTTGTAGG + Exonic
981247034 4:142552931-142552953 CAAAACAAAAGCTATTTTGGTGG - Intronic
982224677 4:153154553-153154575 TAAAAGAAAAGCTGCTTGGTGGG - Intronic
982648796 4:158059665-158059687 CATAATAAAAGATCCTTTGAAGG + Intergenic
982661485 4:158212346-158212368 CAAAAAAAATTCTCCTGTGTAGG - Intronic
982718378 4:158833317-158833339 GAAAACAAAAGCTATTTTGGAGG - Intronic
984907871 4:184647182-184647204 CAAAATAAAGACTGCTTTGTAGG + Intronic
987100159 5:14583881-14583903 CAAAAAAAAACCTCTTCTGTGGG - Intronic
990443743 5:55872679-55872701 AGAAACAAAAGCTATTTTGTGGG + Intronic
990547116 5:56834014-56834036 TAAAAGATAATCTCCTTTGTTGG - Intronic
991688316 5:69202177-69202199 CAAAACAAAAGCAGCTTGTTAGG + Intronic
992092857 5:73334387-73334409 CAAAACAAAACCTTCTATTTTGG + Intergenic
992944551 5:81797097-81797119 CAAAACAAAAGCCACTATTTTGG - Intergenic
993237657 5:85334304-85334326 CAAAACAATAGCTCCTTACTTGG - Intergenic
995367563 5:111380795-111380817 CAAAAGAAAATCTCCTTTTTTGG - Intronic
995694005 5:114859399-114859421 CAAAGCAAAAACTCCTCTGCTGG + Intergenic
996982087 5:129510563-129510585 CAAAAGAAAAGCTTCTGTATTGG + Intronic
997004503 5:129802890-129802912 CACACCAAAACCTCATTTGTAGG - Intergenic
997120501 5:131168131-131168153 AAAAAAAAAAGCTCCATTATTGG + Intronic
997455096 5:134010798-134010820 CAAAACAAAAACTACTTCATTGG + Intergenic
997566878 5:134894764-134894786 CAAATCAGATGCTCCTTAGTAGG + Intronic
998748251 5:145286685-145286707 AAAAACAAAAACTTCTATGTTGG - Intergenic
998967929 5:147560812-147560834 CAACACAAAGGCTCCTTTCCAGG + Intergenic
1000007205 5:157198026-157198048 AAAAAGAAAAGCTCCTTGGGAGG + Intronic
1000365277 5:160484954-160484976 CAAAACAAAAACTAATCTGTAGG - Intergenic
1000374988 5:160572053-160572075 CAAAACAAAAGTTCATTTTTGGG + Intronic
1000422801 5:161057437-161057459 CAGAACTATAGCTCCTTTCTGGG - Intergenic
1000721683 5:164715813-164715835 CAAAACAAGATGTCTTTTGTGGG + Intergenic
1006674343 6:35751514-35751536 CAAAAGAAAAGCTCAGTAGTAGG - Intergenic
1010033760 6:71297338-71297360 AAAAACAAAAACTCATTTTTGGG + Intronic
1010928775 6:81775812-81775834 CATAACAGAAGCTCGTTTCTTGG + Intergenic
1011350831 6:86421878-86421900 CAAAAGAAAAACTTCTTTGGGGG + Intergenic
1013107747 6:107040329-107040351 CACAATAAAAGGACCTTTGTAGG + Intronic
1013751071 6:113406736-113406758 CAAAACAACAGTTCCCTTCTAGG - Intergenic
1014128399 6:117804083-117804105 CACACCAAAACCTCATTTGTAGG - Intergenic
1014221155 6:118800059-118800081 CAGCACAATATCTCCTTTGTCGG - Intergenic
1014248700 6:119094538-119094560 GAAAACAAAAGCTCCATTGCTGG - Intronic
1014733516 6:125063998-125064020 CAACACAAAAGCTATTTTTTTGG + Intronic
1015335067 6:132027600-132027622 CCAAACAAAAGCTCCCTTTTAGG + Intergenic
1016743834 6:147557308-147557330 GAAAACATAGGCTCCTTTGCAGG - Intronic
1016824467 6:148375744-148375766 AACAAGAAAAGTTCCTTTGTAGG + Intronic
1019755164 7:2763397-2763419 CATAGGAAGAGCTCCTTTGTGGG - Intronic
1020215763 7:6188989-6189011 CCAGACAATAGCTCCTTTCTAGG - Intronic
1020912220 7:14145250-14145272 CAAAATAAAAGCTCTTTTACAGG + Exonic
1021607936 7:22428005-22428027 CCCTACAGAAGCTCCTTTGTAGG - Intronic
1022657150 7:32330087-32330109 CCAAACAAAATCTCCATTTTGGG - Intergenic
1024340604 7:48254615-48254637 CAAAACTAAAGCACCTCTGGAGG - Intronic
1025100506 7:56130891-56130913 CAAGACAACAGCTCCTTTTTGGG - Intergenic
1025147848 7:56520409-56520431 CAAGGCAACAGCTCCTTTTTGGG - Intergenic
1025863863 7:65361533-65361555 TAGACCAAAAGCACCTTTGTGGG + Intergenic
1026318548 7:69248910-69248932 CAAGACAACAGCTCCTTTTTGGG + Intergenic
1027952376 7:84833814-84833836 CAAAACAAGAGCTCCTCCTTAGG - Intergenic
1029152086 7:98487879-98487901 CAAAACAAAAACAACTTTGTGGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1030949030 7:115766207-115766229 TAAAATAAAAGCTGCTTTGGAGG + Intergenic
1031306786 7:120138555-120138577 CTTAACAAAAGCCCATTTGTTGG + Intergenic
1033804632 7:144939735-144939757 AAAAACAAAAGTCCCTTTGGTGG + Intergenic
1033959460 7:146895714-146895736 CAAAAGAGAAACTCCTTTTTCGG - Intronic
1034551764 7:151825218-151825240 AAAAACAGAAGGTCATTTGTTGG + Intronic
1034756046 7:153620397-153620419 CAGAACCAAAGTTCCATTGTGGG + Intergenic
1036392766 8:8338906-8338928 AAAAACAAGAGTTCCTTTTTAGG + Intronic
1037074660 8:14699596-14699618 CAAAACAAAAACAGATTTGTGGG + Intronic
1037128692 8:15382067-15382089 CCAAAGAAAACCTCCTTTTTTGG + Intergenic
1037289843 8:17338715-17338737 AAAAAAAATAGCTCCTTTGCTGG - Intronic
1037625795 8:20605737-20605759 CAAGACAAATGCCCCTTAGTAGG - Intergenic
1037657350 8:20896550-20896572 CAAAAGTAAAACTGCTTTGTGGG + Intergenic
1038375880 8:27039666-27039688 CAAAACAAAAAATCTTTTATGGG - Intergenic
1038660833 8:29495230-29495252 TAAAACCACAGCTCCATTGTAGG - Intergenic
1040357799 8:46636587-46636609 CATATCAAAACCTCCTTTATGGG - Intergenic
1041109572 8:54471766-54471788 CAAAACACAAGCTCCTAAGAGGG - Intergenic
1042158733 8:65870488-65870510 CAAAACAAAATCCTCTTTGAGGG - Intergenic
1042299715 8:67264094-67264116 TAAAACCAAAGCTGCTTTGAAGG - Intronic
1043296928 8:78676815-78676837 CAAAAAAAAAGTGCCTTTTTTGG + Intronic
1043581265 8:81718891-81718913 CAAAACCAAAGCTCTTTTATTGG + Intronic
1045418948 8:101994928-101994950 AAAAATAACAGCTACTTTGTAGG + Intronic
1045696932 8:104819678-104819700 AAAAACAAAAACTCCTTTCTGGG - Intronic
1045983239 8:108217165-108217187 GAAAACAAAAGCCCATTTGAGGG + Intronic
1050407769 9:5327886-5327908 CACAACAAAACCCCATTTGTAGG + Intergenic
1051734376 9:20183535-20183557 GACAACAGAAGCTCCTTTTTAGG + Intergenic
1052558578 9:30052437-30052459 CAACAAAAAATCTCATTTGTGGG - Intergenic
1052758731 9:32567926-32567948 CATATCAAAAGCTACTTGGTAGG + Exonic
1052983645 9:34468483-34468505 CAAAACAAAACCTTCTTGGCCGG - Intronic
1053271760 9:36754853-36754875 GAAAACAAAATCTCCCCTGTAGG + Intergenic
1053525827 9:38829715-38829737 CAAAACAAAAAAACCTTTATAGG - Intergenic
1054198059 9:62054145-62054167 CAAAACAAAAAAACCTTTATAGG - Intergenic
1054261670 9:62872030-62872052 CAAAAAAAAGGCTGCTTTGCAGG + Intergenic
1054640295 9:67534225-67534247 CAAAACAAAAAAACCTTTATAGG + Intergenic
1055468894 9:76592122-76592144 AAATACAAAACCCCCTTTGTGGG - Intergenic
1055586861 9:77763883-77763905 AACAAGAAAAGCTCTTTTGTGGG - Intronic
1055628047 9:78194686-78194708 CAAGAGAATAGTTCCTTTGTGGG + Intergenic
1055713083 9:79086840-79086862 CAAAACAAAAGATGAATTGTTGG + Intergenic
1057480611 9:95442240-95442262 CAAAACACATGCTCCTCTGTGGG - Intergenic
1057667826 9:97060244-97060266 TAAAAAAAAAGGTCCTTTTTAGG - Intergenic
1058829556 9:108803302-108803324 CAAAACAACACTGCCTTTGTGGG + Intergenic
1059640122 9:116208437-116208459 CAAAAGAAAAGCACCCTTGTGGG + Intronic
1060435662 9:123590617-123590639 AAAAACAAATGATCTTTTGTGGG + Intronic
1185544410 X:930739-930761 CAAAAGAAAGGATCCTTTCTAGG - Intergenic
1186499919 X:10042970-10042992 CAAAACCAGAACTCCTGTGTTGG - Intronic
1186539891 X:10389702-10389724 CAAAACATCAGCTTCCTTGTGGG + Intergenic
1187349890 X:18503726-18503748 CAAAACAAAAACATCCTTGTGGG - Intronic
1188408917 X:29846993-29847015 CAAAAGAAAATCTCAGTTGTGGG + Intronic
1190850361 X:54234371-54234393 CAAAATAAAAGATCCTTTCCAGG + Intronic
1191237597 X:58147369-58147391 CAAAACACAAGTTCCATTCTGGG - Intergenic
1191239515 X:58172492-58172514 CAAAACACAATTTCCTTTCTGGG - Intergenic
1192556639 X:72095293-72095315 CATAACAAAAGCTGTTTTCTGGG - Intergenic
1193244457 X:79211918-79211940 CAACACAAAATAGCCTTTGTAGG - Intergenic
1193930501 X:87546076-87546098 CAAAACAAAACCTACTTGCTAGG + Intronic
1194345333 X:92756576-92756598 CAAAACAAAATCCCCCATGTTGG + Intergenic
1195832860 X:109078624-109078646 CAAAAGAGAACCTCCCTTGTGGG - Intergenic
1196409836 X:115406583-115406605 CAAAATAAAATCTCCTTGGATGG - Intergenic
1197354496 X:125420359-125420381 TAAAACAAAAGCTGTTTTTTTGG + Intergenic
1197578585 X:128254528-128254550 CCAAACAAAGCTTCCTTTGTTGG + Intergenic
1198570186 X:137946613-137946635 CAAAACAATACCTACCTTGTAGG - Intergenic
1198727157 X:139690327-139690349 AAAAAAAAAAACTCCTTTGGAGG - Intronic
1199495698 X:148449890-148449912 TAGAACATAAGCTCTTTTGTTGG + Intergenic
1199730412 X:150626606-150626628 CAAAATAAAACATCCTATGTTGG - Intronic
1200653676 Y:5873226-5873248 CAAAACAAAATCCCCCATGTTGG + Intergenic
1200861161 Y:7994197-7994219 CAAAACAATTGCTCCTCTGGTGG - Intergenic
1200869100 Y:8077879-8077901 CACAATAAAATCTCATTTGTAGG + Intergenic
1200896805 Y:8384484-8384506 CATATCAAAATCTCCTCTGTGGG + Intergenic
1200936494 Y:8742934-8742956 TAGAACAAAAGCTTCCTTGTTGG + Intergenic
1202248198 Y:22841284-22841306 CATATCAAAAACTCCTCTGTGGG - Intergenic
1202401186 Y:24475032-24475054 CATATCAAAAACTCCTCTGTGGG - Intergenic
1202469594 Y:25195054-25195076 CATATCAAAAACTCCTCTGTGGG + Intergenic