ID: 1113462400

View in Genome Browser
Species Human (GRCh38)
Location 13:110491357-110491379
Sequence CCTGCCTGAGGAAGGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113462400_1113462409 5 Left 1113462400 13:110491357-110491379 CCACACAGCCTTCCTCAGGCAGG 0: 1
1: 0
2: 1
3: 42
4: 381
Right 1113462409 13:110491385-110491407 CGGAGACCCCAGAACAAAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 159
1113462400_1113462407 2 Left 1113462400 13:110491357-110491379 CCACACAGCCTTCCTCAGGCAGG 0: 1
1: 0
2: 1
3: 42
4: 381
Right 1113462407 13:110491382-110491404 CTCCGGAGACCCCAGAACAAAGG 0: 1
1: 0
2: 1
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113462400 Original CRISPR CCTGCCTGAGGAAGGCTGTG TGG (reversed) Intronic
900300164 1:1973169-1973191 CCTCCCCAAGGGAGGCTGTGCGG - Intronic
900300511 1:1974507-1974529 CCAGCCTGAGGAAGGCCTTCAGG + Intronic
900403041 1:2480480-2480502 CCTGCCTGCCATAGGCTGTGGGG - Intronic
900431644 1:2605667-2605689 CCTGCCTCAGCCAGGCTGCGGGG - Intronic
900641637 1:3690469-3690491 CCTGCCTGGGGAAGGCTCGGGGG - Intronic
901625608 1:10623151-10623173 GCTGCTTGGAGAAGGCTGTGAGG - Intronic
901769527 1:11523179-11523201 ACAGCCTCAGGATGGCTGTGAGG + Intronic
902223692 1:14982925-14982947 CCAGCCAGAGGATGCCTGTGCGG - Intronic
903022562 1:20404422-20404444 CATGCCTGGGGAAAGCTGTTTGG - Intergenic
903320552 1:22540634-22540656 CCTGCTTGAGGATGCCTGGGAGG + Intergenic
903363531 1:22792262-22792284 GCTGACTGGGGAAGGGTGTGAGG + Intronic
903404504 1:23085196-23085218 CCTGCCTGAGCAAGTAGGTGTGG + Exonic
903999859 1:27332771-27332793 CCTGCCGGAGGAAGCCAGAGAGG - Intronic
904013509 1:27403752-27403774 CCTGCCTGAGGAAGGCGAGGGGG - Intergenic
905166983 1:36088614-36088636 CTCGCCTGCGGAAGGCAGTGTGG + Intergenic
905391202 1:37636387-37636409 CCTGCCTGAGGAAAAGTCTGTGG + Intergenic
906048408 1:42850994-42851016 CCTGCCTGAGGAAGGGGAAGGGG + Exonic
906273742 1:44501029-44501051 CCAGGCTGCAGAAGGCTGTGGGG + Intronic
907305872 1:53512965-53512987 CCTCCCTGAGGAAGGTGGTGAGG - Intronic
908169307 1:61488783-61488805 CTGTCCTCAGGAAGGCTGTGGGG + Intergenic
910164300 1:84308057-84308079 ACTGCCTGAAGAAGGCTTTTAGG - Intronic
910986321 1:93008197-93008219 CCAGGCTGTGGAAGGCTCTGTGG - Intergenic
912323766 1:108738657-108738679 CCTGCCAGTGGAAGGGGGTGTGG - Intronic
912435737 1:109659857-109659879 TCTGCATGAGGCAGGGTGTGAGG + Intronic
912437677 1:109673262-109673284 TCTGCATGAGGCAGGGTGTGAGG + Intronic
912443476 1:109715988-109716010 TCTGCATGAGGCAGGGTGTGAGG + Intronic
912713891 1:111968531-111968553 GGTTCCTCAGGAAGGCTGTGAGG + Intronic
913223626 1:116679530-116679552 CTTGCCTGAGGACAGCTGTGGGG + Intergenic
913451874 1:118998158-118998180 ATTTCCTGAGGAAGACTGTGGGG + Intergenic
915243709 1:154541726-154541748 CCTGTCTGGGGAAGGCTGCTGGG + Intronic
915282137 1:154829831-154829853 CCAGCCTCGGGAAGGGTGTGGGG - Intronic
915682548 1:157595629-157595651 CTTGTCTCAGGAAGGGTGTGTGG + Intronic
916423593 1:164659864-164659886 GCTGCCAGAGGAAGCCTGTTAGG - Intronic
916558379 1:165911932-165911954 CCAGCCTAAGGAAGGCAATGGGG - Intergenic
917380193 1:174397870-174397892 CAAACCTGAGGAAGTCTGTGAGG - Intronic
917575949 1:176322003-176322025 CCTGGCTGAGAGAGGCTATGAGG - Intergenic
919741597 1:200984418-200984440 CCTGCCTGAGGAAGGCAATTTGG + Intronic
920267452 1:204734643-204734665 CCTCCCTAAGGAAGGATGTAAGG + Intergenic
920370785 1:205477956-205477978 GCTGCCTGGGGAGGGGTGTGAGG - Intergenic
920558541 1:206922295-206922317 CCTGCCTGAGAAAGGCTGTATGG + Intronic
920933226 1:210408100-210408122 CCTCCCTCAGGATTGCTGTGAGG + Intronic
921551920 1:216547323-216547345 ACTGCATGAGGAAGGTTTTGAGG - Intronic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
922915854 1:229257109-229257131 CCTGCCTCAGGATCCCTGTGAGG - Intergenic
922928815 1:229373101-229373123 CCTGTCTGAGGAGTGCTGTGGGG + Intergenic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
924415022 1:243849940-243849962 CCCGCCTGAGGGAGGCAGGGAGG + Intronic
1063119192 10:3092858-3092880 CCTGTCTGAGGAAAGGGGTGTGG + Intronic
1065045173 10:21740917-21740939 CCTGTTAGAGGAAGGCTATGGGG + Intronic
1069613198 10:69789164-69789186 TCTGTGTGGGGAAGGCTGTGGGG + Intergenic
1069707750 10:70469290-70469312 TCTGGCTGAGGAGGGCTGGGCGG + Intergenic
1070792605 10:79198427-79198449 CCTGCCTGGGGAAGGAGGAGGGG - Intronic
1070820945 10:79353960-79353982 TGTGCCTGAGGAAGGCTGCTAGG + Exonic
1072609006 10:97004397-97004419 ACTCCCTGGGGAAGGCTGAGAGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1074366542 10:112862056-112862078 AGAGCCTGAGCAAGGCTGTGAGG + Intergenic
1075122168 10:119672304-119672326 CCTGCCGGAGGAAGGCAGGCTGG - Exonic
1075309117 10:121397002-121397024 CCTGCCTGAGGTAGTTTGTCAGG - Intergenic
1075436887 10:122451111-122451133 CCTGACTGAGGAAGACAATGTGG + Intergenic
1075464737 10:122642905-122642927 GCTGCCTAAGGATGGCGGTGAGG + Intronic
1075597265 10:123741293-123741315 CCTCTCTGAGCAAGGCTGAGTGG - Intronic
1076160769 10:128242831-128242853 CCTGCCTTGGGAAGGCAGTTGGG + Intergenic
1076204123 10:128581745-128581767 CCTGAAAGTGGAAGGCTGTGGGG - Intergenic
1076672837 10:132132675-132132697 TCTGCCTGAAGACAGCTGTGCGG + Intronic
1076910873 10:133388715-133388737 GCTGCCTGAGGGACGCTCTGTGG + Intronic
1077014735 11:394515-394537 ACTGCCAGAGGTAGGCGGTGGGG + Exonic
1077156117 11:1092482-1092504 CCATCCTGGGGAAGCCTGTGGGG + Intergenic
1077217763 11:1402155-1402177 GCAGCCTGGGGAAGGCTGGGGGG + Intronic
1077251528 11:1562979-1563001 CCAGCCTGAGGGCGACTGTGGGG - Intronic
1077462015 11:2715455-2715477 CCTGCCTGAGCCAGGCTGCAGGG - Intronic
1078528849 11:12120919-12120941 CTGGACTGAGGAGGGCTGTGGGG + Intronic
1079035011 11:17013800-17013822 CCTCCGAGAGGAAGGCGGTGGGG - Intronic
1079328280 11:19512781-19512803 CATGCCTGTGAAGGGCTGTGTGG - Intronic
1081672430 11:44949688-44949710 CCTACCCGGGGGAGGCTGTGTGG - Intronic
1081725797 11:45328238-45328260 CCAGCCTGGGGAAGGTGGTGTGG + Intergenic
1081826358 11:46057303-46057325 CCTGGCTGAGGAAGGCTGATGGG - Intronic
1082883468 11:58060471-58060493 CCTGCCTAAGGAAAGCTGGGAGG + Intronic
1083619564 11:64042238-64042260 CCAGCCTGAGCCAGGCTCTGAGG + Intronic
1083654108 11:64220736-64220758 CTTTCCTGAGGAAGGCTCTGTGG - Intronic
1083783655 11:64931631-64931653 CCCGCCAGAGGGAGGCTGGGAGG + Intronic
1085694046 11:78688863-78688885 CATACCTGAGCAAAGCTGTGGGG - Intronic
1085699638 11:78734688-78734710 TCTGACTGGGTAAGGCTGTGTGG - Intronic
1086946064 11:92845099-92845121 CTTGCATGAGGAAGGCTTAGGGG + Intronic
1087563618 11:99823166-99823188 CCTGACCCACGAAGGCTGTGAGG + Intronic
1088817504 11:113431896-113431918 CCTGCCTGGGGCAGCCTGGGTGG - Intronic
1089556289 11:119317330-119317352 CCTGGCTTGGGAAGGCTGAGGGG + Intronic
1089682315 11:120125552-120125574 ACGGCCTGAGGAAGGGTGGGTGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1090179373 11:124682241-124682263 GCTGGTTGAGAAAGGCTGTGTGG + Intronic
1090227792 11:125082036-125082058 CCTGCTTGGGGAGGGCAGTGTGG + Intronic
1091037530 11:132247034-132247056 GCTGCCTCTGGAAGGATGTGAGG - Intronic
1091653376 12:2325987-2326009 GCCCCCTGAGGACGGCTGTGAGG + Intronic
1093203207 12:16214810-16214832 CATACCTGAGGGAGTCTGTGGGG + Intronic
1093690263 12:22101998-22102020 CCTGCCTGGTGAAGAGTGTGGGG + Intronic
1095646936 12:44558589-44558611 CCTCCCTAAGGGAAGCTGTGAGG + Intronic
1096292957 12:50357776-50357798 CCAGAGTGAGGCAGGCTGTGGGG + Intronic
1096732545 12:53626121-53626143 CCTGTCTGAGGAAGAGGGTGGGG - Intronic
1098164303 12:67677826-67677848 CCTGCCTCAGGGATGTTGTGAGG + Intergenic
1100455279 12:94745664-94745686 GCTGCCTGAGAAAGGCAATGAGG + Intergenic
1102455648 12:113069403-113069425 GCTGCCTAAGGAAGGCTGAAGGG - Intronic
1104833348 12:131770293-131770315 CCTGGGTGAGGAAGCCTGCGTGG + Intronic
1104934751 12:132358483-132358505 CCTGCATGAGGCAGGCAGTGCGG - Intergenic
1105303804 13:19155727-19155749 CCTGCCCAAGGTGGGCTGTGTGG - Intergenic
1105349320 13:19601798-19601820 CCTGCCCTAGGAAAGCTGTGGGG - Intergenic
1105483562 13:20803425-20803447 CCTGCCTGACTCAGGCTGAGTGG - Intronic
1106258271 13:28041187-28041209 CCGACCTCAGGAAGGCAGTGTGG + Intronic
1107951442 13:45465407-45465429 TCTGCCTGGGGACGGCTGTGGGG + Intronic
1108400418 13:50036289-50036311 CCTCTCTGAGGGTGGCTGTGAGG + Intergenic
1111818497 13:93184895-93184917 CTTTCCTAAGGAAGGCTTTGTGG - Intergenic
1112006581 13:95258932-95258954 CCTGCCTGCGGGAGGCTGCTGGG + Intronic
1112192761 13:97193846-97193868 TCTGCCCTTGGAAGGCTGTGAGG - Intergenic
1112918298 13:104578317-104578339 CCTGCCTGAGACAGGTTCTGTGG - Intergenic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1114212712 14:20628998-20629020 CCTTGATGAGGGAGGCTGTGGGG - Intergenic
1114271153 14:21101069-21101091 CCTGGCAGAGGAAGGCTGTCAGG - Exonic
1114525451 14:23365038-23365060 CTGGCCTGAGGCAGGCTGCGCGG - Exonic
1115468146 14:33738616-33738638 CTTTCCTGAGGAAGGGGGTGTGG - Intronic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1118165391 14:63331198-63331220 GCTTCCTGAGAAAGGGTGTGTGG - Intergenic
1119971194 14:78972550-78972572 ACTCCCTGAGGTTGGCTGTGTGG + Intronic
1121002251 14:90460257-90460279 CCAGACTGTGGAAGCCTGTGAGG + Intergenic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1122088080 14:99320740-99320762 CCTGACTGTTGAAGGCTGTCAGG - Intergenic
1122108574 14:99480214-99480236 GCTGCTCGGGGAAGGCTGTGCGG - Intronic
1122693503 14:103542276-103542298 TCTGCCTGGGGAAGGCAGGGAGG + Intergenic
1122856395 14:104562264-104562286 CCTGCCTGGGTCAGACTGTGCGG + Intronic
1122860868 14:104581861-104581883 TCTGCCCCTGGAAGGCTGTGAGG + Intronic
1122903158 14:104790261-104790283 CCTGCAGGAGCAAGGCTGGGGGG + Intronic
1123755488 15:23394671-23394693 CCTGCAGGAGGAAGGGTGGGGGG + Intergenic
1125423320 15:39526053-39526075 CCTGGCTGGGGAAGGTTGGGTGG + Intergenic
1125821788 15:42638054-42638076 CCTACAGGAGGAAGGCAGTGAGG - Exonic
1126800002 15:52289648-52289670 CCTGGCTGAGGAAGCCTCCGGGG - Intronic
1128520993 15:68374809-68374831 CCTTGCAGAGGGAGGCTGTGAGG - Intronic
1128768430 15:70265070-70265092 CCTGGCTGAGGATAGGTGTGTGG + Intergenic
1128795553 15:70463853-70463875 CATGTCTGAGGAAGGCTGGTGGG - Intergenic
1129068610 15:72932492-72932514 GCACCCTGAGGAAGGCTTTGTGG + Intergenic
1129079654 15:73027524-73027546 CCTTCCTGAGGAAGGCTCTAGGG - Intergenic
1129117854 15:73375213-73375235 ACTGCCTGGGCAAGGCTGGGTGG - Intergenic
1130450529 15:84047066-84047088 CCTGTCAGGGGAAGGCGGTGGGG - Intergenic
1132359510 15:101200999-101201021 CCTGCCTGAGCCAGGGTCTGTGG + Intronic
1132546153 16:534347-534369 CCTGGCTGAGGATAGCGGTGGGG - Intronic
1132584190 16:699196-699218 GCTGGCTGAGGAAGGCCATGCGG + Intronic
1133124553 16:3637535-3637557 CCTGCCTGTGGAAGGCTTAGGGG + Intronic
1134688663 16:16176275-16176297 ACTGCTTGAGCAAGGCTGTTGGG - Intronic
1135631431 16:24038739-24038761 CCTGCCTGAGGAAGGAAGCATGG - Intronic
1136082398 16:27860710-27860732 CCTCCCTGCAGAAGGCTGTTTGG - Intronic
1136092245 16:27928822-27928844 CCAGCCAGAGGAAGGCTAAGGGG + Intronic
1136186901 16:28593604-28593626 CTGGCCTGGGGCAGGCTGTGTGG - Intronic
1136278048 16:29191177-29191199 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1136396703 16:29996398-29996420 GCTGCCGCGGGAAGGCTGTGGGG + Exonic
1136576652 16:31129292-31129314 CCTTCCTGAGCATGGCTGTGTGG + Intronic
1137443015 16:48511999-48512021 CCTCCAAGAGGAAGGCAGTGTGG + Intergenic
1137458113 16:48633804-48633826 CAGGCCTGAGGAATGTTGTGGGG + Intergenic
1138626651 16:58257450-58257472 CCAGCCTGAGCAACGCAGTGAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139747092 16:69083387-69083409 CCTGCCTGAGGAGATCTGTGAGG - Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141401357 16:83749880-83749902 CCTGCGTGATGAAGGATATGTGG + Intronic
1141556257 16:84838636-84838658 CCTCCCTGGGGATGGCTCTGCGG - Exonic
1142078800 16:88136201-88136223 TCTGCGTGGGGGAGGCTGTGAGG + Intergenic
1142082424 16:88157217-88157239 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1142146762 16:88496039-88496061 CCTGCCCAAGGATGGCCGTGGGG - Intronic
1142382011 16:89738238-89738260 CCCACCTGAGGACGGCAGTGAGG + Exonic
1142605248 17:1077883-1077905 CCTGCCTGTGGCAGGGAGTGGGG - Intronic
1142664773 17:1456277-1456299 CCTGCCCGAGGGAGGCTGCCGGG + Intronic
1142698549 17:1646411-1646433 TCTGGCTGTGGAAGGATGTGTGG - Exonic
1143264532 17:5626138-5626160 ACTGTCTTAGGAAGGCTTTGGGG + Intergenic
1145993846 17:29094574-29094596 CATGCCTGAGGCTGGCTGTGGGG + Intronic
1146458613 17:33025999-33026021 CCTGCCTGAGTAACTCTGTCTGG - Intronic
1146467450 17:33097309-33097331 CCTGCCTCAGGACAGCTGGGAGG - Intronic
1147116475 17:38304041-38304063 GCTGCCTGAGAAAGGCTGCATGG + Intronic
1147262013 17:39214298-39214320 CCACCCTGCGGAAGGATGTGGGG - Exonic
1148193624 17:45697838-45697860 CCTAGCAGAAGAAGGCTGTGTGG - Intergenic
1148383828 17:47220326-47220348 AGTGTCTGAGGAAGGCTGAGTGG + Intronic
1148413207 17:47485574-47485596 GCTGCCTGAGAAAGGCTGCATGG - Intergenic
1148682787 17:49484265-49484287 CCTGCCTGCAGGGGGCTGTGAGG + Intergenic
1148853280 17:50565062-50565084 CCTGGCTGAGGCAGGCAGGGCGG - Intronic
1148870998 17:50658718-50658740 CCTGCATCTGGCAGGCTGTGGGG + Intronic
1149570420 17:57668205-57668227 CCGACCTGAGAAAGGCTTTGTGG - Intronic
1149681268 17:58508915-58508937 ACAGCCACAGGAAGGCTGTGAGG + Intronic
1151830610 17:76547200-76547222 CCTTCCTGAGGAAGACTGAGGGG - Intronic
1152088301 17:78233327-78233349 CCTGCCTGAGGGACTCTGAGGGG + Intronic
1152534730 17:80943872-80943894 TCTGGCTGAGGAAGGCTTGGGGG + Intronic
1152648097 17:81479502-81479524 GCTGCCTGTGGGGGGCTGTGAGG - Intergenic
1152680443 17:81665233-81665255 CCATCCTGAGGAAGGCCTTGAGG + Exonic
1152901196 17:82941994-82942016 CCTGCCGGAAGGAGGCTGAGAGG - Intronic
1153403534 18:4708146-4708168 CAGGCCTGAGGATGGCTCTGAGG + Intergenic
1154000259 18:10476709-10476731 ACAGCCTGGGGAAGGCTGTCTGG - Intronic
1154041163 18:10857689-10857711 CCTGACTGTGGAAGGATGAGTGG + Intronic
1155245466 18:23904504-23904526 GCTGGCAGAGGAAGGCTGTGGGG + Intronic
1156780860 18:40848880-40848902 CCTATCTTAGGAATGCTGTGAGG + Intergenic
1159889157 18:73938532-73938554 CCTTACTGAGGAAGGGTGGGTGG - Intergenic
1160010884 18:75106421-75106443 CCTGGCTGAGGCAGGGTGAGGGG + Intergenic
1160314510 18:77829106-77829128 CCATCTTGAAGAAGGCTGTGAGG + Intergenic
1161080816 19:2309109-2309131 CCTGTTTGAGGAAGGCTGAGGGG - Intronic
1161087468 19:2341625-2341647 GCTGCCTCAGGAAGGCTGGGAGG - Intronic
1161209078 19:3056975-3056997 CCTGCCTGAGGAAGACTATATGG - Intronic
1161499341 19:4604952-4604974 CAGGCCTGATGAAGGCTGGGAGG + Intergenic
1161703399 19:5806500-5806522 CCGGGCTGAGGAAGCCTGGGTGG + Intergenic
1162458935 19:10802984-10803006 CCTGCCTGAGGCAGGCCGGGTGG + Intronic
1163032137 19:14551701-14551723 CCTGGCTGTGTGAGGCTGTGGGG + Intronic
1163263937 19:16207139-16207161 CCTGGCCGAGGTGGGCTGTGGGG + Intronic
1165050654 19:33139374-33139396 CCAGGCTGCAGAAGGCTGTGTGG + Intronic
1165930511 19:39355415-39355437 GCTTGCTGAGGAGGGCTGTGGGG - Intronic
1167146053 19:47681228-47681250 CCTGAGTGAGGATGGCCGTGGGG - Exonic
1167396361 19:49232020-49232042 CCTCCCTGATCAAGGCTCTGTGG - Intergenic
1167757425 19:51421488-51421510 CCTGTCTGACCAAGGCTGGGAGG - Intergenic
1168289141 19:55348504-55348526 CCTGGCTGAGTGAGGGTGTGGGG + Intergenic
925235118 2:2271286-2271308 CCCACCTGAGGAAGGCTTTATGG + Intronic
925617610 2:5758677-5758699 CCTGGCTGAGGTAGGATGAGAGG + Intergenic
925746123 2:7045249-7045271 CCTTCATGATAAAGGCTGTGTGG + Intronic
926692395 2:15746394-15746416 CCTGCCTGAGGCAGGCTTAAGGG + Intergenic
927053904 2:19353160-19353182 CTTGCCTCCGGAAGGCTTTGTGG + Exonic
927077738 2:19597016-19597038 CCAGCCTGTGGAATGCTTTGGGG - Intergenic
927522668 2:23709381-23709403 CATGACTGAAGAAGGCAGTGAGG - Intergenic
927648850 2:24898729-24898751 CTTGCCTGGGGAAGCCTGGGAGG + Intronic
927673706 2:25089698-25089720 CCTGCCTGAGAAAAGGTGTTGGG - Intronic
928143739 2:28752424-28752446 CCCGCCGGCCGAAGGCTGTGCGG + Intronic
930021471 2:47004432-47004454 CCTGCCCAAGGGAAGCTGTGAGG + Intronic
930378984 2:50603339-50603361 GCTGGCTCAGAAAGGCTGTGGGG + Intronic
930381694 2:50637789-50637811 CATGCCAGAGAATGGCTGTGAGG + Intronic
932411067 2:71548170-71548192 CCTCGCTGAGGAGGGCTGAGGGG + Intronic
932495056 2:72142098-72142120 CCCGCCTCAGGAATGCGGTGGGG - Intronic
937023785 2:118681006-118681028 TCTGTCTGCAGAAGGCTGTGGGG - Intergenic
937341744 2:121095707-121095729 CCTGCCTGACTAAGGGTGAGGGG + Intergenic
937383879 2:121407701-121407723 CCTGTCAGAAGAAGCCTGTGAGG - Exonic
940516039 2:154685036-154685058 CCTGCCTGAGGAATTAAGTGTGG + Intergenic
942619624 2:177833537-177833559 TCTGCCTTAAGAAAGCTGTGTGG + Intronic
944662648 2:201934169-201934191 CCTGACATATGAAGGCTGTGAGG - Intergenic
947671817 2:231941797-231941819 TGTGAATGAGGAAGGCTGTGCGG + Intergenic
947752709 2:232541162-232541184 GGTGCCTGAGGAAGTCTGTCTGG + Intronic
947799743 2:232921325-232921347 CCTGCCTGCTGCAGGCTGGGAGG + Intronic
948662140 2:239514216-239514238 CATGCCTGAGGAGGGCTGCGGGG - Intergenic
1170682707 20:18540658-18540680 CCAGCCTGGGCAATGCTGTGAGG + Intronic
1170740634 20:19053057-19053079 CCTATCTCAGGATGGCTGTGGGG - Intergenic
1171486710 20:25490970-25490992 CCTGCCCGAGGCTGGCTTTGTGG - Intronic
1172195597 20:33089579-33089601 CCAGCCTGGGGAAGGCACTGAGG + Intronic
1172777463 20:37415766-37415788 CCTGTCTGAGGGAGGGTCTGCGG + Intergenic
1173334314 20:42100607-42100629 CCTGGATGAGGAAGGCAGGGAGG + Intronic
1173669905 20:44791663-44791685 GCTGGCTGAGGAGGGCTGAGAGG + Intronic
1174193731 20:48758212-48758234 ACTCCCTGAGGGTGGCTGTGAGG - Intronic
1174483249 20:50845603-50845625 CCTGCCTCAGGGGGGCAGTGGGG - Intronic
1175211035 20:57355145-57355167 CATGCCTGAGGAACACTGTCAGG - Intronic
1175708799 20:61202704-61202726 CCTGACTGCAGAAGGATGTGAGG - Intergenic
1175749403 20:61484835-61484857 TAAGCCTGAGGAGGGCTGTGGGG - Intronic
1175778412 20:61667205-61667227 CCACCCTCAGGAAGGCTGAGAGG + Intronic
1175802372 20:61808135-61808157 ACAGCCTGGGGAAGGCTGCGGGG + Intronic
1176131407 20:63498297-63498319 CCTGCCTGAGGAGGGGAGTGGGG - Intronic
1176546226 21:8201494-8201516 CCTACCTGAGGGAGGACGTGTGG + Intergenic
1176565177 21:8384540-8384562 CCTACCTGAGGGAGGACGTGTGG + Intergenic
1177250875 21:18589186-18589208 AATGACTGAGGAAGGATGTGAGG + Intergenic
1178412007 21:32372151-32372173 CCTGCGTCAGGACTGCTGTGAGG + Intronic
1178514636 21:33236330-33236352 CCAGCCTGGGGCAGGCTCTGTGG + Intronic
1179605401 21:42512940-42512962 CGTGCCTGGGGAAGGGTGCGAGG + Intronic
1179885294 21:44311678-44311700 CCTGGCTGAGGCTGGCTATGAGG + Intronic
1180061228 21:45386063-45386085 CCTCCCTGTGGAGGGCTCTGAGG + Intergenic
1180061266 21:45386209-45386231 CCTCCCTGTGGAGGGCTCTGAGG + Intergenic
1180883251 22:19221559-19221581 CCAGATTCAGGAAGGCTGTGAGG - Exonic
1180998021 22:19975132-19975154 CCAGCCGCAGGAGGGCTGTGGGG - Intronic
1181023264 22:20114227-20114249 ACTGCTGCAGGAAGGCTGTGGGG - Intronic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1182432584 22:30309011-30309033 GTTCCCTGGGGAAGGCTGTGGGG + Intronic
1183441140 22:37823783-37823805 CCTGGCTGGGCAGGGCTGTGGGG + Intronic
1183700744 22:39449609-39449631 GCTGCCTGGGGAAGGCAGAGGGG + Intergenic
1184398927 22:44262328-44262350 CCTGGCAGATGAAGGCTTTGTGG - Intronic
1184737143 22:46405978-46406000 CCTCCCTGTGGAAGTCTGGGTGG - Intronic
1184744986 22:46450994-46451016 CCTGTCTCAGGAAGGCAGTGAGG - Intronic
1185087112 22:48746878-48746900 GCTGCCTGAGGATGGCTGCCGGG - Intronic
1185122138 22:48977662-48977684 CAGGCCTGAGGAAGCCTGAGTGG - Intergenic
1185305419 22:50112742-50112764 CTTGCCACGGGAAGGCTGTGGGG - Intronic
1203251098 22_KI270733v1_random:117731-117753 CCTACCTGAGGGAGGACGTGTGG + Intergenic
950088176 3:10276138-10276160 CCTGCCTCAGGGTGGTTGTGAGG + Intronic
950157052 3:10729498-10729520 CCTGCCTGAGGAAGGGAAAGAGG + Intergenic
950682749 3:14596176-14596198 GCTGCCTGAGAAAGGCTCTGAGG + Intergenic
952968635 3:38636887-38636909 CCTGGCTGTGGAAGGTTGTAGGG + Intronic
953026247 3:39146847-39146869 CCTGCCTGTGGAGCTCTGTGTGG + Intronic
953457368 3:43053842-43053864 TGTGCCTGAGGAGGGGTGTGGGG + Intronic
953570699 3:44069142-44069164 CCTACCTAAGGCAGACTGTGAGG + Intergenic
953610259 3:44441814-44441836 CCTGCCTTAGGAAGGCAGAATGG + Exonic
953881268 3:46692644-46692666 GCTGCCTGAGGACAGCTGTGAGG - Intronic
953953539 3:47212322-47212344 TGTGCCTGAGGAAGGCTATCAGG - Intergenic
955960648 3:64337931-64337953 CCTGCATGAAGGAGGCTGAGAGG + Intronic
955971815 3:64444754-64444776 CCTGCTTGGGGAAGGGTGCGCGG + Intronic
956301971 3:67781842-67781864 CCTGCCCGAGGGAAACTGTGAGG - Intergenic
957576117 3:82010502-82010524 CCTGTGCTAGGAAGGCTGTGGGG + Intergenic
957924145 3:86787178-86787200 GGTGCATGAGGAGGGCTGTGAGG - Intergenic
958975942 3:100668010-100668032 CCTACCCAAGGAAAGCTGTGAGG - Intronic
959505548 3:107152601-107152623 CCTGGCTGAGGGAAGCTTTGGGG + Intergenic
959740204 3:109710174-109710196 CCTGCCTAGCAAAGGCTGTGAGG - Intergenic
961064378 3:123862071-123862093 CCTTCCTAAGGAAGGCTCTAAGG + Intronic
962043970 3:131736092-131736114 CATGCCTGAACAAAGCTGTGTGG - Intronic
963580315 3:147118026-147118048 CCTGACTGAGGAAGTTTGAGGGG - Intergenic
967094303 3:186164033-186164055 CCTTTCTGAGGAATGCAGTGTGG + Intronic
968808305 4:2788803-2788825 ACTCCCTGGGGGAGGCTGTGTGG - Intergenic
969254445 4:5992727-5992749 CCTGCCTCATGCAGGCTATGTGG - Intergenic
969427384 4:7133266-7133288 CCTGTCTGACTCAGGCTGTGGGG + Intergenic
971546850 4:27896922-27896944 CATGCCTGAGAATTGCTGTGTGG + Intergenic
973216734 4:47677786-47677808 CCTGGCTGACTAGGGCTGTGAGG + Intronic
973886486 4:55327402-55327424 CCAGCCTGAGTAAGACAGTGAGG - Intergenic
975392141 4:73832973-73832995 ATTGGCTGAGGAAGGCTGGGTGG - Intergenic
975800714 4:78057259-78057281 CCTGGGTGAGGAGGGCTGCGGGG - Intergenic
976218739 4:82739234-82739256 CATGCCAGGGGAAGGCAGTGGGG + Intronic
977179680 4:93857891-93857913 TCTGCCAGAAGCAGGCTGTGGGG - Intergenic
977650046 4:99459001-99459023 CATTCCTAAGGAACGCTGTGAGG + Intergenic
981719522 4:147787485-147787507 CCAGACTGTGGAAGGCTGTGAGG + Intronic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
982229076 4:153192127-153192149 GATGCCTGGGGAAGGGTGTGGGG - Intronic
986602221 5:9483916-9483938 TCTGCCTGACACAGGCTGTGTGG + Intronic
987101302 5:14593491-14593513 CCAGGCTGAGGAGGCCTGTGTGG + Intronic
988054178 5:26071916-26071938 CATGCCTGAGAAATGATGTGGGG - Intergenic
988508185 5:31842465-31842487 AGTGCCTTTGGAAGGCTGTGTGG - Intronic
990562303 5:56995459-56995481 CATGCCTGGGGAAGACTGTTGGG - Intergenic
990567344 5:57042767-57042789 CCTGCATTAGGAAGGCTGGCAGG - Intergenic
993884262 5:93397845-93397867 GCTGCTTGAGGAAGCCAGTGTGG + Intergenic
994014980 5:94955181-94955203 CCTACCCAAGGAAAGCTGTGAGG + Intronic
995375732 5:111472310-111472332 GCTGCTTGAGGAAGGCCTTGGGG - Intronic
996871809 5:128200776-128200798 CCTGGCTCAGGAAGGTGGTGGGG + Intergenic
998328249 5:141301521-141301543 GCTGGCGCAGGAAGGCTGTGTGG + Intergenic
999218147 5:149953293-149953315 CCTCCCTATGGAAGTCTGTGAGG - Intergenic
999393811 5:151213920-151213942 CCTGGCTGAGGAAGGCTTACGGG + Intronic
999644620 5:153705372-153705394 CCTGCCAGAGGAAGGGAGTGGGG + Intronic
999695825 5:154188379-154188401 CCTGCCTGAGGGATGCTCTGAGG + Intronic
1000575984 5:162975819-162975841 CCTTGATAAGGAAGGCTGTGTGG - Intergenic
1001057928 5:168464721-168464743 CTTGACCGAGGAAGGCTGTGGGG - Exonic
1001484749 5:172111411-172111433 CGTGCCTGAGGGAGGCCCTGGGG - Intronic
1001504545 5:172266930-172266952 CCTGCCTCAGGCAGCCTCTGGGG - Intronic
1001691190 5:173633766-173633788 CCTGCCTGAAGCAGGCTGATGGG - Intergenic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1002648384 5:180673706-180673728 CCTGCCTGAGGCGGGCTGGGGGG + Intergenic
1002870754 6:1165629-1165651 CCTGGCTCAAGAAGGCTGGGAGG - Intergenic
1002972167 6:2034937-2034959 CCAGCCTGAGGATGGTTGGGGGG + Intronic
1002979733 6:2124686-2124708 CCTGCTGGAGAAAGGCTATGAGG - Exonic
1003037948 6:2661613-2661635 TCTGTCTGAGCAAGGCTGAGTGG + Intergenic
1003301060 6:4883285-4883307 CATCCCTGAGGAAGGCTCTAGGG - Intronic
1003523158 6:6875881-6875903 CCAGCCTGAGGAAGGAAGAGGGG + Intergenic
1003630404 6:7781459-7781481 CCTGGCTGTGGGAGGCAGTGTGG + Intronic
1004005386 6:11633179-11633201 CCTGCCTGGGGCTGACTGTGTGG - Intergenic
1005081027 6:21956769-21956791 CCTGCCTGGGGATGGATGAGGGG - Intergenic
1005257430 6:24018267-24018289 CCTGCCTGATGTGGGCTGTTAGG - Intergenic
1005486083 6:26301049-26301071 AATGCTTGAGGGAGGCTGTGGGG - Intergenic
1005719292 6:28585378-28585400 ACAGCCAGAGGAAGGATGTGGGG + Intronic
1005886270 6:30100352-30100374 CCTGCCTGGGGAAGGCTTCCCGG + Intergenic
1006808447 6:36804578-36804600 CCTGCTAGAGGGATGCTGTGAGG - Intronic
1007046688 6:38782737-38782759 AATGCCTGGGGCAGGCTGTGGGG + Intronic
1007980938 6:46157626-46157648 CCTGCCTGAGGAAAGCAGAAGGG + Intergenic
1008580548 6:52903030-52903052 CTTGGATGGGGAAGGCTGTGTGG + Intronic
1009905827 6:69868374-69868396 CCTTCCTGAGGAGGGCTGACAGG + Intronic
1010006164 6:70997908-70997930 CCTACCTAAGGGAAGCTGTGAGG + Intergenic
1013056875 6:106591380-106591402 ACTGGCTGAGAAAGGCTGGGCGG + Intronic
1013442937 6:110190180-110190202 CCTGCCTCAGGAAAACTGTTGGG - Intronic
1015878843 6:137850769-137850791 ACTGACTGAAGCAGGCTGTGAGG - Intergenic
1016958283 6:149648265-149648287 CCTACCTGAGGAATCCTGTCAGG - Intronic
1017395928 6:154000026-154000048 CCTGCCTGAAGAAAGTTTTGAGG - Intergenic
1017774442 6:157669834-157669856 CCGGCCTGCTGGAGGCTGTGCGG + Intronic
1017827890 6:158095893-158095915 CCTGCAGGTGGAAGGCTGCGGGG - Exonic
1018448771 6:163885452-163885474 ACTTCCTGGGAAAGGCTGTGTGG - Intergenic
1019266490 7:120067-120089 CCTGGCTGAGGAATTCTCTGTGG - Intergenic
1019294652 7:267332-267354 CCGGGCTGAGGGAGGCGGTGGGG - Intergenic
1019544151 7:1565155-1565177 CCTGCCCGAGGGAGGTTGGGTGG + Intergenic
1019937161 7:4264370-4264392 CCTGAGTGAGGGAGGCCGTGTGG + Intronic
1021634396 7:22677311-22677333 GCTTCCTGAGAAAGGCTGTGTGG + Intergenic
1023018203 7:35986467-35986489 GCAGTCTGAGGAAGGCAGTGAGG + Intergenic
1023082170 7:36536042-36536064 CCTGGCTGAGGAGGGATGCGAGG + Intronic
1023987606 7:45105932-45105954 CGAGGCTGAGCAAGGCTGTGAGG - Intronic
1026846420 7:73701232-73701254 CATGCCTGAGGATGGGGGTGTGG - Intronic
1027656251 7:80934254-80934276 GCTTCCTAAGAAAGGCTGTGTGG + Intergenic
1028268292 7:88756172-88756194 TGTGCCTGAGGAACACTGTGAGG + Intergenic
1031632547 7:124062193-124062215 ACTTCCTAAGGAAGGGTGTGTGG + Intergenic
1032584401 7:133132835-133132857 CCTCCCAGAGGAAGCATGTGAGG + Intergenic
1032634692 7:133693747-133693769 CCTGGCAGAGAAAGGCTGTAAGG + Intronic
1035115075 7:156517396-156517418 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035115140 7:156517717-156517739 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035277098 7:157754168-157754190 CCTTCCCGAGGAAGCCTGTGGGG + Intronic
1035344986 7:158191939-158191961 CCTGACTGAGGTAGACTGAGGGG - Intronic
1035470804 7:159107516-159107538 GCTGCTTGGGGAAAGCTGTGAGG - Intronic
1035891569 8:3349419-3349441 CCTCCATGTGGAAGGGTGTGAGG + Intronic
1036749699 8:11436023-11436045 CCGCCCTGAGCCAGGCTGTGAGG - Intronic
1036970423 8:13348864-13348886 CCTTCTTGAGGAGGGCAGTGGGG + Intronic
1038432363 8:27510478-27510500 CCTGCCGGTGGAAGGCTATTAGG + Intronic
1040469638 8:47726629-47726651 GCTTCCTGAGGAAGGGAGTGAGG - Intronic
1040532448 8:48276624-48276646 CGTGCCTAAGGAAGGTTGTGGGG + Intergenic
1041110287 8:54476952-54476974 CCGGCCTGAGGGAGGAAGTGGGG - Intergenic
1041567390 8:59294764-59294786 GATGGCTGGGGAAGGCTGTGGGG - Intergenic
1043147774 8:76678253-76678275 CCAGCGTGAGGAGGGCTGTTGGG - Intergenic
1043614682 8:82111268-82111290 TCTGAGTAAGGAAGGCTGTGAGG + Intergenic
1044499731 8:92939686-92939708 CCTGCCTGAGTAGGGTTGTAGGG - Intronic
1047291753 8:123537939-123537961 GGTTGCTGAGGAAGGCTGTGCGG + Intronic
1048765756 8:137842797-137842819 CTTGCTTGAGGGCGGCTGTGGGG + Intergenic
1049327583 8:142031379-142031401 CCTGCCCCAGGAAAGTTGTGAGG - Intergenic
1049418844 8:142507939-142507961 CGTGCCTGGGGATGGGTGTGCGG - Intronic
1049584382 8:143426154-143426176 CCTGGCTGAGGGAGGTTGTGTGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049814207 8:144590660-144590682 CCAGCCTGCAGAAGGCTGGGGGG + Intronic
1050464780 9:5910650-5910672 ACTGTCTGAGGAACTCTGTGAGG - Intronic
1051353846 9:16223296-16223318 CCTACCGGAGGGAAGCTGTGAGG + Intronic
1052277266 9:26691411-26691433 CCTGCCTGAGAAATGCTGACTGG - Intergenic
1056316999 9:85399832-85399854 ACTGACTGAGAAAAGCTGTGCGG + Intergenic
1057802626 9:98199342-98199364 CAAGGGTGAGGAAGGCTGTGGGG + Exonic
1058947194 9:109868853-109868875 CCTCCCTCAGGAATGTTGTGGGG - Intronic
1059280998 9:113134032-113134054 CCTGTCTGAGGCAGCCAGTGTGG + Intergenic
1059540425 9:115124913-115124935 CCTACCATTGGAAGGCTGTGGGG - Intergenic
1060432622 9:123563357-123563379 ACTGCCTGAGGAGTGCAGTGGGG - Intronic
1061003872 9:127917308-127917330 CCTGCCTGGGCGAGGCTGTCGGG + Intergenic
1061260670 9:129479184-129479206 CCTGCCTGAGGCAGAGGGTGTGG - Intergenic
1061502034 9:131009484-131009506 CCTGGCTGTGGAAGTCGGTGAGG - Exonic
1061550825 9:131333849-131333871 CCTGCCTCTGCAGGGCTGTGTGG + Intergenic
1062097131 9:134709298-134709320 CCTGGCTGAGGAGGGGTGGGGGG + Intronic
1062108564 9:134769247-134769269 TCGGCCTGAGGGATGCTGTGTGG - Intronic
1062326055 9:136013124-136013146 CCAGCCTGAGGAGGACTGGGTGG - Intronic
1203467503 Un_GL000220v1:100998-101020 CCTACCTGAGGGAGGACGTGTGG + Intergenic
1192360509 X:70435812-70435834 CCATCCTTATGAAGGCTGTGGGG - Intergenic
1193056521 X:77157886-77157908 CCTGTCAGAGGAGGGCAGTGGGG + Intergenic
1194753770 X:97713357-97713379 CCTACCTCAGGATTGCTGTGAGG - Intergenic
1195062579 X:101210689-101210711 CCTGCCTAAGGGAGGCCTTGGGG - Intergenic
1196387183 X:115170298-115170320 CCTGTCTGTGAGAGGCTGTGAGG + Exonic
1197996967 X:132387706-132387728 CCTGCGTGAGGTAGGTCGTGGGG - Intronic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1199296564 X:146165517-146165539 CCTACCTGAGGAAAGGTGGGAGG + Intergenic
1199875330 X:151923694-151923716 CAAGCCTGAGGAAGGCGTTGAGG + Exonic
1199948057 X:152683056-152683078 CATGCCTGAGGAAGGCCTTGAGG + Intergenic
1199955157 X:152736191-152736213 CAAGCCTGAGGAAGGCCTTGAGG + Exonic
1199961622 X:152785398-152785420 CATGCCTGAGGAAGGCCTTGAGG - Intergenic
1200206971 X:154323549-154323571 CCTGACTGAGACAGGCTGTCAGG - Intronic
1201289777 Y:12411918-12411940 CCTGCCTGAGAAATGGTATGTGG - Intergenic