ID: 1113462857

View in Genome Browser
Species Human (GRCh38)
Location 13:110493852-110493874
Sequence AGCGGGTGCTCTCCCTCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113462857_1113462865 18 Left 1113462857 13:110493852-110493874 CCTCACGAGGGAGAGCACCCGCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1113462865 13:110493893-110493915 TAAGGGCAGTAACCCCATCTTGG 0: 1
1: 0
2: 7
3: 69
4: 365
1113462857_1113462866 19 Left 1113462857 13:110493852-110493874 CCTCACGAGGGAGAGCACCCGCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1113462866 13:110493894-110493916 AAGGGCAGTAACCCCATCTTGGG 0: 1
1: 0
2: 4
3: 55
4: 308
1113462857_1113462867 20 Left 1113462857 13:110493852-110493874 CCTCACGAGGGAGAGCACCCGCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1113462867 13:110493895-110493917 AGGGCAGTAACCCCATCTTGGGG 0: 1
1: 0
2: 13
3: 146
4: 516
1113462857_1113462861 1 Left 1113462857 13:110493852-110493874 CCTCACGAGGGAGAGCACCCGCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1113462861 13:110493876-110493898 TCCCCTGTCACTTCTTATAAGGG 0: 1
1: 0
2: 18
3: 70
4: 417
1113462857_1113462860 0 Left 1113462857 13:110493852-110493874 CCTCACGAGGGAGAGCACCCGCT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1113462860 13:110493875-110493897 CTCCCCTGTCACTTCTTATAAGG 0: 1
1: 0
2: 19
3: 84
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113462857 Original CRISPR AGCGGGTGCTCTCCCTCGTG AGG (reversed) Intronic
900351656 1:2237952-2237974 AGAGGCTGATCACCCTCGTGTGG + Intronic
900402795 1:2479474-2479496 GGTGGATGCTCTCCCTCGTGGGG + Intronic
900700927 1:4048250-4048272 AGCGGGTGCCTGCCCACGTGCGG + Intergenic
901090200 1:6635804-6635826 AGCGGGTGCTCTGCCTCGCCTGG - Intronic
902534788 1:17113441-17113463 AGCGGGTGCTTGCCCTCTAGGGG - Intronic
910761950 1:90741564-90741586 AGCGGGTCCTCTGCCTGGAGGGG - Intergenic
918582322 1:186145785-186145807 AGCCAGTGCTCTGCCTCCTGTGG + Exonic
1062927222 10:1326441-1326463 ACAGGGTCATCTCCCTCGTGGGG - Intronic
1067216986 10:44311231-44311253 GGCGCGTGCTCCCCCTCCTGTGG - Intergenic
1075849938 10:125578765-125578787 AGAGGTTGCTCTCACTCCTGTGG - Intronic
1076679694 10:132165357-132165379 AGCGCTTGTTCTCCCACGTGGGG + Intronic
1079093110 11:17494449-17494471 AGTGGGTACTCCCCCTTGTGGGG - Intronic
1083228536 11:61300255-61300277 AGAGGGTGCTCTCCCACAGGTGG + Intronic
1083999774 11:66289707-66289729 CGCGGGTGCTGTCCGTCGTCCGG + Intergenic
1091681119 12:2527771-2527793 AGCAGATGCTCTCCCCTGTGGGG - Intronic
1094373103 12:29759668-29759690 AGCTGGTGTTCTCTTTCGTGGGG - Intronic
1098101107 12:67018147-67018169 AGTGGGTTCTGTCCCTTGTGTGG + Intergenic
1105980874 13:25515028-25515050 AGCAGGTGGACTCCCTAGTGTGG + Intronic
1107168907 13:37316833-37316855 AGCAGGTGCTTACCCTCGAGGGG - Intergenic
1113462857 13:110493852-110493874 AGCGGGTGCTCTCCCTCGTGAGG - Intronic
1122557876 14:102591597-102591619 ACCCCGTGTTCTCCCTCGTGGGG + Intergenic
1131815498 15:96217316-96217338 AGGGGGTGCTCTCTCTCGGGTGG + Intergenic
1142250462 16:88989562-88989584 AGCGGGGGCGCTGCCTGGTGGGG + Intergenic
1142351238 16:89581457-89581479 AGCGCGTGTTCTCCCTGCTGTGG + Intronic
1143102097 17:4510105-4510127 AGCGGGATCTCACCCTCCTGTGG + Intronic
1146063305 17:29618133-29618155 AGCGGGCGGGCGCCCTCGTGAGG + Intronic
1148860813 17:50603520-50603542 AGCTGCGGCTCTCCCTTGTGTGG + Intronic
1150639461 17:66939677-66939699 AAGGGGTGCTCTCCCTCCTGCGG - Intergenic
1152617871 17:81346108-81346130 CTCGGGTGCCTTCCCTCGTGGGG - Intergenic
1152825920 17:82464687-82464709 AGCGGGGCCTCTGCCTGGTGAGG + Intronic
1155605555 18:27601726-27601748 AGCAGATGCTCTCCCTAATGTGG + Intergenic
1157529753 18:48410328-48410350 AGCGGCTGCTCCCCGGCGTGTGG - Intronic
1161057256 19:2196862-2196884 TGTGGATGCTCTCCCTCGGGTGG + Intronic
1162786144 19:13036195-13036217 GGCGAGGGCTCTCCTTCGTGTGG + Intronic
929922825 2:46184683-46184705 TGAGGCTGCTCTCCCTCCTGAGG - Intronic
932046640 2:68356811-68356833 AGGGAGTGCTGTCCCTAGTGGGG + Intergenic
934616486 2:95774550-95774572 AGTGGGAGCTCTGCCTCCTGTGG + Intergenic
934644407 2:96050010-96050032 AGTGGGAGCTCTGCCTCCTGTGG - Intergenic
934837823 2:97606100-97606122 AGTGGGAGCTCTGCCTCCTGTGG - Intergenic
937765671 2:125658126-125658148 AGCGAGTGCTGTCCTTAGTGAGG + Intergenic
947148007 2:227086315-227086337 ATGGGGTGCTCTCGCTCTTGGGG - Intronic
948578104 2:238966845-238966867 TGCAGGTGCTCTCTCCCGTGGGG - Intergenic
949070121 2:242019419-242019441 ACCGGGTGCTCTTCCACCTGAGG + Intergenic
1175835418 20:61990695-61990717 AGCAGGTTCTCTCCTGCGTGAGG - Intronic
1179408215 21:41142644-41142666 ACATGGTGCTCTCCCTCCTGTGG + Intergenic
1181281918 22:21726544-21726566 AGAGGGTCCCCTCCCTCCTGGGG - Intronic
950859592 3:16135920-16135942 AGCTTGTGCTCCCACTCGTGCGG - Intergenic
968150928 3:196335950-196335972 AGCGGGTGCTCTAGATCATGGGG + Intronic
979421471 4:120509848-120509870 AGCTGGAGCTCTCCTTCATGAGG - Intergenic
992674502 5:79092247-79092269 AGCAGGTCCTCTCCCTTGTTGGG + Intronic
997602221 5:135148486-135148508 GGGGGGTACTCTCCCTCATGAGG + Intronic
1004424123 6:15496388-15496410 AACAGGTGCTATCCCTCGGGGGG + Exonic
1007984112 6:46190111-46190133 AATGGGAGCCCTCCCTCGTGAGG - Intergenic
1009880579 6:69561196-69561218 AGCCGGTGCTCTCCCGTATGAGG - Intergenic
1019124320 6:169828921-169828943 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124331 6:169828953-169828975 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124342 6:169828985-169829007 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124353 6:169829017-169829039 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124364 6:169829049-169829071 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124375 6:169829081-169829103 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124386 6:169829113-169829135 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124397 6:169829145-169829167 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124408 6:169829177-169829199 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124419 6:169829209-169829231 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124430 6:169829241-169829263 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124441 6:169829273-169829295 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1019124452 6:169829305-169829327 GGAGGGTGCTCACCCTGGTGGGG + Intergenic
1020143256 7:5623929-5623951 AGGGGGTGCTGTCCCTCAGGTGG - Intronic
1026146841 7:67753933-67753955 GGCTGGTGCTCTCCCTCCTCAGG - Intergenic
1026529739 7:71186425-71186447 AGCGGGGCCTCTGCCTCCTGGGG + Intronic
1031252346 7:119402248-119402270 AGCGTGTGATCTCGCTTGTGTGG + Intergenic
1034222214 7:149455467-149455489 AGCGGGTGATCTCTGCCGTGGGG + Exonic
1044080239 8:87873979-87874001 GGCGGATGTTCTCCCTCCTGAGG + Exonic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1051581443 9:18680331-18680353 ACCGCGTGCTCCTCCTCGTGTGG + Exonic
1058518883 9:105800407-105800429 AGGGGGTGTACACCCTCGTGAGG - Intergenic
1059337022 9:113575355-113575377 AGTGGGTGCACTCCCTGCTGTGG + Intronic
1059635693 9:116168601-116168623 AGTGTGTGCTCTGCCTTGTGTGG + Intronic
1061071577 9:128314031-128314053 AGCTGGTGCCCTTCCTCCTGGGG - Intronic
1190914385 X:54799490-54799512 AGCTAGGACTCTCCCTCGTGAGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic