ID: 1113463131

View in Genome Browser
Species Human (GRCh38)
Location 13:110495718-110495740
Sequence GAGGATCTGATGGGGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113463131_1113463143 25 Left 1113463131 13:110495718-110495740 CCTAGAGACCCCATCAGATCCTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1113463143 13:110495766-110495788 CCTTGCCATAACAAGCACTCTGG 0: 1
1: 0
2: 0
3: 7
4: 89
1113463131_1113463139 -4 Left 1113463131 13:110495718-110495740 CCTAGAGACCCCATCAGATCCTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1113463139 13:110495737-110495759 CCTCTGTGCGCCTGGGGCACTGG 0: 1
1: 0
2: 2
3: 25
4: 274
1113463131_1113463140 2 Left 1113463131 13:110495718-110495740 CCTAGAGACCCCATCAGATCCTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1113463140 13:110495743-110495765 TGCGCCTGGGGCACTGGCACAGG 0: 1
1: 0
2: 4
3: 14
4: 223
1113463131_1113463137 -10 Left 1113463131 13:110495718-110495740 CCTAGAGACCCCATCAGATCCTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1113463137 13:110495731-110495753 TCAGATCCTCTGTGCGCCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1113463131_1113463144 26 Left 1113463131 13:110495718-110495740 CCTAGAGACCCCATCAGATCCTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1113463144 13:110495767-110495789 CTTGCCATAACAAGCACTCTGGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113463131 Original CRISPR GAGGATCTGATGGGGTCTCT AGG (reversed) Intronic
900473318 1:2864916-2864938 GAGGCTTTGTGGGGGTCTCTTGG - Intergenic
901532671 1:9863465-9863487 GATGATCTGCTGGGGTTTCTGGG - Intronic
902118104 1:14138548-14138570 GACGATCTCGTGGGGGCTCTAGG - Intergenic
902295525 1:15464264-15464286 GAGGGTCTGATGAGGGCTCCAGG - Intronic
902298416 1:15484165-15484187 GAGGGTCTGATGAGGGCTCCAGG - Intronic
903970899 1:27118213-27118235 TAGGCCCTGATGGGCTCTCTGGG + Intronic
904333041 1:29777733-29777755 AAGGATGTGCTGGGGTTTCTTGG + Intergenic
904710332 1:32425394-32425416 GAGGCTCAGCTGGGGTCCCTTGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906949389 1:50322245-50322267 AAGGAGCTGATAGGGTCTGTGGG - Intergenic
909345785 1:74584680-74584702 AAGCATGTGATGGGGTATCTGGG - Intronic
909353333 1:74678886-74678908 GAGGCTTTGATGGGGAGTCTTGG - Intergenic
909971678 1:81998224-81998246 GTGGAACTCCTGGGGTCTCTAGG - Intergenic
911139412 1:94482651-94482673 GAGGATATGATGGGGTTCCAGGG + Intronic
915068772 1:153248163-153248185 GAGGATCTGAGGCGGAATCTTGG - Intergenic
915724313 1:158006987-158007009 GAGGAGGGGATGGGGTCTGTGGG + Intronic
917130727 1:171739634-171739656 CAGGATCTGATGCTATCTCTAGG + Intronic
918718759 1:187825661-187825683 GAGGATCTGGTGTGATCTTTTGG + Intergenic
919678779 1:200412141-200412163 GGGGATCTGATGCTGTCTCCAGG + Intergenic
1062844877 10:696213-696235 GAGGATCTTGTGTGATCTCTGGG + Intergenic
1063486568 10:6425926-6425948 GGGGTCCTGTTGGGGTCTCTGGG + Intergenic
1068512560 10:57984669-57984691 TAAGATCTGATGGGGTCCTTAGG - Intergenic
1072977784 10:100074291-100074313 GAGAACCTGATGGGTCCTCTCGG + Intronic
1074374672 10:112929470-112929492 GAGGAGCTCATGGTGTCGCTGGG + Intergenic
1075944579 10:126421395-126421417 GGGGATCTGATGGAATCTCAAGG + Intergenic
1078430715 11:11286193-11286215 GAGGATCTGATGAAATCTCAGGG - Intronic
1079430460 11:20384733-20384755 GAGGATATGTTGAGGCCTCTGGG + Intergenic
1081633125 11:44702827-44702849 GGGCATGCGATGGGGTCTCTTGG - Intergenic
1083737625 11:64690671-64690693 ATGAATCTGATGGGGTCTGTGGG - Intronic
1084162403 11:67356861-67356883 GTGGAAAGGATGGGGTCTCTGGG + Intronic
1084647067 11:70464797-70464819 GAGGCTGTGAGGGGGCCTCTAGG + Intergenic
1084861327 11:72020185-72020207 AGAGATCTGATGGGGCCTCTTGG + Intronic
1086871210 11:92039069-92039091 AAGGATGTGATAGGGTTTCTTGG + Intergenic
1087887877 11:103501474-103501496 GACCTTCAGATGGGGTCTCTGGG - Intergenic
1089339935 11:117750440-117750462 GAGGAGCTGATGGGTTCTCCAGG - Intronic
1089599377 11:119604198-119604220 GAGGAGCTGATGCGGGCACTGGG + Intergenic
1090340499 11:126015462-126015484 CAGGATCAGATAGTGTCTCTGGG - Exonic
1092006960 12:5078010-5078032 GTGGATCTGTTGGGGTCCCCCGG + Intergenic
1093138847 12:15483354-15483376 GAGGATCTGCTGGTGTCTAGGGG - Intronic
1093927180 12:24920691-24920713 GTGGATCTGATGCTATCTCTGGG - Intronic
1094398251 12:30032253-30032275 GAGGATCTCATGTAGTCTCAGGG - Intergenic
1096085982 12:48865397-48865419 GGGGATCTGATGGGTCCTCTGGG + Intronic
1097615418 12:61879403-61879425 GAGGAGCTGATGGGGGCACCGGG - Intronic
1101273135 12:103169342-103169364 GAGGTTCGGAATGGGTCTCTCGG - Intergenic
1103385048 12:120525406-120525428 GAGCATCTTTTGGGGTGTCTGGG + Intronic
1103996469 12:124833610-124833632 GAGGATGCTCTGGGGTCTCTGGG - Intronic
1106534158 13:30624124-30624146 TAGGATCTGACATGGTCTCTAGG + Intronic
1106995782 13:35478441-35478463 GAGGATGTGCAGTGGTCTCTGGG + Intronic
1108503388 13:51087844-51087866 GAGGATGGGCTGGGGGCTCTGGG - Intergenic
1113463131 13:110495718-110495740 GAGGATCTGATGGGGTCTCTAGG - Intronic
1114532630 14:23405166-23405188 GAGGATCTGGGTGGGTGTCTGGG + Intronic
1115754960 14:36520496-36520518 GAGGATGGGAAGGGGTCTCACGG + Intronic
1115951481 14:38727123-38727145 GAGGAGCTGATGAGGGCACTGGG - Intergenic
1118837467 14:69486911-69486933 GAGGAGAAGATGGAGTCTCTGGG - Intronic
1121694696 14:95903438-95903460 GGTGATCTCAAGGGGTCTCTGGG - Intergenic
1122255610 14:100473515-100473537 GAGGATAACATGGGGCCTCTGGG + Intronic
1123166003 14:106325222-106325244 CAGGAACTGATGGGGACTTTGGG + Intergenic
1123208742 14:106738548-106738570 CAGGAACTGATGGGGACTTTGGG + Intergenic
1123480240 15:20624393-20624415 CAGGAACTGATGGGGACTTTGGG + Intergenic
1123637766 15:22375970-22375992 CAGGAACTGATGGGGACTTTGGG - Intergenic
1124376950 15:29134460-29134482 GAGGATGTGCTGGGGGCTCACGG + Intronic
1124405114 15:29385056-29385078 GGGGATCTGATGGGCCCCCTGGG - Intronic
1125956721 15:43795488-43795510 GAGGAGCTGGAGGGGTTTCTTGG + Exonic
1126427797 15:48548222-48548244 GACAATCACATGGGGTCTCTTGG + Intronic
1127278759 15:57470734-57470756 GAGGATCTTATGTGGTCTTGTGG + Intronic
1128245521 15:66130056-66130078 GAGGTGCTCATTGGGTCTCTGGG - Intronic
1129762465 15:78138099-78138121 GTGGGTCTCCTGGGGTCTCTGGG + Intronic
1131090545 15:89621775-89621797 GAGGATCTCATCTGTTCTCTTGG + Intronic
1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG + Intronic
1132233504 15:100201783-100201805 AAGGATGTGATGTGGTTTCTCGG + Intronic
1132693919 16:1193802-1193824 GATGAGCTGCTGGGGTCCCTGGG + Intronic
1132896301 16:2230882-2230904 TAGGTTCTGGCGGGGTCTCTGGG + Intronic
1133207483 16:4242076-4242098 GAGGAGCAGCTGGGCTCTCTTGG - Exonic
1134598277 16:15513052-15513074 GATGATGTGATGGTGTCTCAGGG + Intronic
1135691148 16:24539220-24539242 GAGGAGCTGACGGGGCCTGTGGG + Intronic
1136561723 16:31042966-31042988 TGGGATCTGATAGAGTCTCTCGG + Intronic
1140462479 16:75150747-75150769 GAGGATATGATGATCTCTCTGGG + Intronic
1141627661 16:85269761-85269783 GCAGGTCTGCTGGGGTCTCTGGG + Intergenic
1143491295 17:7286671-7286693 GAGGAAAGGAAGGGGTCTCTGGG - Exonic
1143705747 17:8696772-8696794 GAGTTTCTGGTGGGGTTTCTGGG + Intergenic
1144203835 17:12965137-12965159 GACGTTTTGATGGGGTCTGTGGG - Intronic
1146969627 17:37062212-37062234 GATGATTTGAAGGGGTCCCTGGG - Intergenic
1147314139 17:39611666-39611688 GAGGAACAGATGGCATCTCTGGG - Intergenic
1147558776 17:41496534-41496556 GAGTATGAGATGGGGTGTCTGGG - Intergenic
1149329711 17:55568187-55568209 TAGGCTCTGATGAGGACTCTGGG - Intergenic
1152604319 17:81281390-81281412 GAGGGTGTGCTGGGGGCTCTGGG + Intronic
1152722566 17:81930059-81930081 GAGGAACCGATGGGGTCTTAAGG - Intergenic
1153803496 18:8692063-8692085 AAGGATGTGATAGGGTTTCTTGG - Intergenic
1154384552 18:13881094-13881116 TAGGAACTGCTGGGGCCTCTAGG - Intergenic
1159428098 18:68315115-68315137 GAGGACTTGCAGGGGTCTCTGGG + Intergenic
1160418605 18:78728770-78728792 GTGGATCTGATGCTGTCTCCAGG + Intergenic
1161093726 19:2376781-2376803 GAGAATCTGACAGTGTCTCTGGG - Intergenic
1163002380 19:14376199-14376221 GGGGGTCAGATGGGGTCTCCGGG - Intergenic
1164744556 19:30601570-30601592 GAGGAGCTGATGGCATCTATAGG - Intronic
1165073563 19:33268955-33268977 GAGGAGCTGTGGGAGTCTCTTGG - Intergenic
1165181842 19:33978488-33978510 TAGGATCTGATGCTATCTCTAGG - Intergenic
1166795478 19:45423195-45423217 GAGGATAGGATGGGGCCTGTGGG - Intronic
1168050610 19:53826881-53826903 GAAGCTCAGATGGGGTCTGTAGG - Intergenic
1168081327 19:54012449-54012471 GGGGACCTGATGGGGTAGCTGGG + Exonic
1168240190 19:55085021-55085043 GAGGAGATCATAGGGTCTCTGGG + Intronic
925593638 2:5534209-5534231 CAAGATCTGATGGTGTCTCGTGG + Intergenic
925852648 2:8097915-8097937 GAGGAGGGGATGGAGTCTCTTGG + Intergenic
926748805 2:16181869-16181891 GCGGATGTGGTGGGGTCTCAAGG + Intergenic
927141705 2:20135413-20135435 GAGCATCTGATGGAGGCTCTGGG + Intergenic
930675798 2:54199048-54199070 GAGGATATTATAGGGTTTCTTGG + Intronic
931117005 2:59175673-59175695 GGTGATCTGATGGACTCTCTGGG + Intergenic
931430026 2:62201981-62202003 GACCCTCTGATGGAGTCTCTGGG - Intronic
931907098 2:66854286-66854308 GAGTATCTGATGGGGTTTCATGG + Intergenic
932729021 2:74204664-74204686 GATGATATGGTGGGGTCCCTGGG + Intronic
934048270 2:88189753-88189775 TAGGATCTGTTAGGGTCACTGGG + Intergenic
934512239 2:94954602-94954624 CAGGAACTGATGGGGACTTTGGG + Intergenic
934557749 2:95296419-95296441 GAGGACCTGACGGGATCTCCTGG - Intergenic
935162825 2:100544018-100544040 GGGCATCTGATGGGGTGTTTGGG + Intergenic
936990880 2:118364821-118364843 GAGGCTCAGCTGGGGTGTCTTGG - Intergenic
942496412 2:176544758-176544780 GAGGAACTGCTGGTATCTCTGGG - Intergenic
944681056 2:202077096-202077118 GAGGAGCTGGTGGGGTCACCTGG - Intronic
948011803 2:234654582-234654604 GAGGGGCTGATGGTGTCTTTTGG + Intergenic
948593732 2:239066689-239066711 GAGCATCCTGTGGGGTCTCTGGG + Intronic
1170024128 20:11870218-11870240 TAGGATCTGATGCTATCTCTGGG + Intergenic
1170868010 20:20177543-20177565 GGGGCTTTGCTGGGGTCTCTGGG - Intronic
1172196871 20:33097855-33097877 GGGGATTTGAAGGGGTCTTTGGG - Intronic
1174133470 20:48362336-48362358 GAGGTGCTGGTGGGGTCACTGGG - Intergenic
1175642572 20:60643218-60643240 GAGCATCTCATGTGGTCTCTGGG + Intergenic
1175903116 20:62367620-62367642 GAGGAGCTGGTGGGCGCTCTGGG - Intergenic
1175964120 20:62651961-62651983 AAGGATCTGATGGGGTCCCTGGG - Intronic
1176105351 20:63383298-63383320 GTGGATCTGAAGGGGCCACTTGG - Intergenic
1178237252 21:30857385-30857407 CAGGATCTGATGCTATCTCTAGG - Intergenic
1178792766 21:35715111-35715133 GATGATCTGGTGGGTTTTCTGGG - Intronic
1181620886 22:24090414-24090436 GGGGATGTGATGGAGTCACTTGG + Intronic
1181695435 22:24590631-24590653 GAGGATCTGAAGGGAACACTGGG - Intronic
1182583874 22:31331799-31331821 GAGCATCTGCTGTGTTCTCTTGG - Intronic
1183546678 22:38457878-38457900 GAAGATGGGATGGGGGCTCTGGG + Intergenic
1183929991 22:41230395-41230417 GAGGACCTGCTGGGGTCTCCTGG + Exonic
1184058705 22:42068859-42068881 GAGGAGCTGATGGGGGTTATAGG - Intronic
1184841528 22:47055056-47055078 GAGGAGGTGAGGGGGTCTCGAGG + Intronic
952955616 3:38555601-38555623 GAGGATCTTCTGGGGTCCCTGGG - Intronic
953026542 3:39148432-39148454 GGGGAAAGGATGGGGTCTCTTGG - Intronic
953127745 3:40108346-40108368 GCAGAGCTGATGGGGTCTGTAGG + Intronic
954840655 3:53508805-53508827 GAGAAGCTGTTGGGGTCTGTTGG - Intronic
958995978 3:100905436-100905458 AAGGATATGATAGGGTTTCTTGG - Intronic
961320002 3:126066206-126066228 GAGGACCTGAGGGGGCCTCTGGG + Intronic
964632423 3:158826103-158826125 GATCATCTTGTGGGGTCTCTGGG + Intronic
968547234 4:1205559-1205581 GCGGCTCCGATGGGGCCTCTGGG - Intronic
969232036 4:5838786-5838808 GAGGATAAGATGGGGCTTCTTGG - Intronic
969872709 4:10114981-10115003 GAGGGAATGAAGGGGTCTCTGGG - Intronic
972459672 4:39289379-39289401 GAGGATCAGATGAGGTTCCTTGG + Intronic
975278410 4:72531481-72531503 CAGAATCAGATGAGGTCTCTAGG + Intronic
975343408 4:73266742-73266764 GAGGATCTGAGAAGATCTCTAGG - Intergenic
984714327 4:182912788-182912810 AAAGATCTGCTGGGGGCTCTGGG + Intronic
985708521 5:1415174-1415196 GCGGGTCTCATGGGGTCTCGGGG + Intronic
985769125 5:1797972-1797994 TAGCATCTGCTTGGGTCTCTCGG + Intergenic
985780602 5:1868952-1868974 GAGGATACGTTGGAGTCTCTGGG - Intergenic
988682312 5:33496009-33496031 TGGGATCTGATGTTGTCTCTAGG - Intergenic
989478632 5:41903140-41903162 GGGGATATGATGTGGTCTGTGGG - Intergenic
991092471 5:62706386-62706408 GAGGGTCTGATGGGGCCACTTGG - Intergenic
991917154 5:71616400-71616422 TGGGATCTGATGCTGTCTCTAGG + Intronic
992864343 5:80942258-80942280 GAGGTGCTGATGGCCTCTCTGGG + Intergenic
999533490 5:152489114-152489136 GAGGAACTGTGGGGGCCTCTAGG - Intergenic
1000975022 5:167755171-167755193 AAGGTTGTGATGGAGTCTCTGGG + Intronic
1001670298 5:173468167-173468189 GGAGACCTGATGGGGTGTCTGGG + Intergenic
1002295052 5:178225855-178225877 TGGGATCTGATGCTGTCTCTAGG - Intronic
1004832385 6:19490889-19490911 GAGGATCTGAAGGAGAGTCTGGG + Intergenic
1006113783 6:31764407-31764429 GAGAAACAGATGGGGCCTCTGGG - Intronic
1006717187 6:36128105-36128127 TAGGCTCTCATGGGGTCTCAGGG + Intronic
1006918890 6:37614803-37614825 GAGGAGCTTGTGGGGACTCTGGG - Intergenic
1007480799 6:42148591-42148613 AAAGACCTGATTGGGTCTCTGGG - Intergenic
1007703167 6:43775988-43776010 GAGGCTCAGCTGTGGTCTCTGGG + Intronic
1008315274 6:50031391-50031413 GAGGAGCTAATGGGTTCTTTTGG - Intergenic
1010008546 6:71023993-71024015 AAGGATATGATTGGGTTTCTTGG - Intergenic
1011072549 6:83401647-83401669 GTGGATGTGATGGGGTGGCTGGG - Intronic
1013170288 6:107631528-107631550 GAGGGTCTGATGGATTCTGTGGG + Intronic
1018173844 6:161162550-161162572 GGGGATCTGGCAGGGTCTCTCGG - Intronic
1018673267 6:166197240-166197262 GGGGATCGGAGGGTGTCTCTTGG - Intergenic
1021097079 7:16547212-16547234 CAGGCTCTGGTGGGGTCTCTCGG - Intronic
1023877357 7:44294210-44294232 GGGCATCTGATGTGGTCCCTTGG - Intronic
1032704670 7:134411581-134411603 TGGTATCTCATGGGGTCTCTGGG + Intergenic
1033572283 7:142642246-142642268 GAGGATGTGGTGGGGGCTGTAGG - Intergenic
1033590650 7:142805504-142805526 GAGGCTCTGAGGGAGTTTCTGGG + Intergenic
1035249950 7:157590653-157590675 GGGGAGCTGATGGGGCCTCGCGG + Intronic
1035451059 7:158977120-158977142 GACGTTCTCATGGGATCTCTGGG - Intergenic
1035454804 7:159001143-159001165 GAGGGCCTGGCGGGGTCTCTAGG - Intergenic
1036679079 8:10857469-10857491 GAGGTCCTGGTGGAGTCTCTGGG + Intergenic
1038488227 8:27951395-27951417 AAGGTTCTGTTGGGGGCTCTGGG - Intronic
1039335201 8:36581559-36581581 GAGGATGTGGTGGGTTCTCTTGG - Intergenic
1041670358 8:60485505-60485527 GTGGTTCTCCTGGGGTCTCTGGG - Intergenic
1043749647 8:83919836-83919858 GAGGATGTGATGGGGGCGATTGG + Intergenic
1044137216 8:88601598-88601620 GAAGATCTGGATGGGTCTCTAGG - Intergenic
1044791255 8:95849371-95849393 GAGCCTCTGATGGGTTCTCCAGG - Intergenic
1044903952 8:96979468-96979490 GAGGAAGTGATGGGGTTTCCAGG + Intronic
1045560163 8:103254216-103254238 GAGGATCTGATGATGACTCTTGG - Intergenic
1045652538 8:104354361-104354383 GAGGATATGATGGGGTCCTAAGG + Intronic
1046330904 8:112713608-112713630 GAGAATCTGATTGTGTATCTTGG - Intronic
1048987836 8:139744796-139744818 GAGGAGCTGTTGGGCTCTCTTGG + Intronic
1050700087 9:8329195-8329217 GACCTTCAGATGGGGTCTCTGGG + Intronic
1051989028 9:23128911-23128933 GAGGATCAGATGGTTTCTGTAGG + Intergenic
1052339311 9:27349722-27349744 GAGGTTCTGATGGGAAATCTAGG + Intronic
1052971269 9:34378590-34378612 GAGGCTGTGATGGGGACTCCTGG + Intergenic
1053148101 9:35725565-35725587 GAGGACCAGCTGGGGCCTCTGGG + Exonic
1055468764 9:76591136-76591158 GTGGAGCTGATGGGGTCTTTGGG + Intergenic
1055639569 9:78309042-78309064 GAGAATCTGATAGGATATCTGGG - Intronic
1056581538 9:87890405-87890427 GATTCTCTGTTGGGGTCTCTGGG - Intergenic
1056693201 9:88825457-88825479 ATGGCTCTGCTGGGGTCTCTGGG - Intergenic
1057005874 9:91558328-91558350 GAGAATCTGATCAGGACTCTGGG + Intergenic
1057804260 9:98209346-98209368 GAGGATCTCGTTGGGTCTTTAGG - Intronic
1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG + Intronic
1061185405 9:129049933-129049955 GTGGCTCTGATGCAGTCTCTGGG - Exonic
1061678859 9:132232719-132232741 GAGGACCTGGTGGGGACTCCTGG + Intronic
1061911733 9:133728595-133728617 AGGGCTCTGATGGGGTCTCAGGG - Intronic
1185876345 X:3705326-3705348 TAGGAGGTGATGGGGTCACTAGG - Intronic
1187372386 X:18720854-18720876 GAGGAGATGAGGGGGTTTCTGGG - Intronic
1188652393 X:32647501-32647523 AAGGATATGATAGGGTTTCTTGG - Intronic
1189893929 X:45633627-45633649 GAGGAGCTGATGTGGGCACTGGG + Intergenic
1191978955 X:66904401-66904423 GGGGACCTGATGGGGGCTGTAGG + Intergenic
1192977550 X:76302576-76302598 GACCTTCGGATGGGGTCTCTGGG + Intergenic
1196599272 X:117583634-117583656 GAGGAGCTAATGTGATCTCTTGG + Intergenic
1200038073 X:153346088-153346110 GAGGATCAGCTGGGCTCTCTGGG + Intronic