ID: 1113463400

View in Genome Browser
Species Human (GRCh38)
Location 13:110497137-110497159
Sequence TAACCTCAGCCAGGGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113463388_1113463400 28 Left 1113463388 13:110497086-110497108 CCACCAGCACAGCCTCAGTCAGG 0: 9
1: 8
2: 6
3: 40
4: 361
Right 1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 94
1113463387_1113463400 29 Left 1113463387 13:110497085-110497107 CCCACCAGCACAGCCTCAGTCAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 94
1113463394_1113463400 16 Left 1113463394 13:110497098-110497120 CCTCAGTCAGGGGTAAGGATCTA 0: 1
1: 3
2: 9
3: 7
4: 83
Right 1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 94
1113463392_1113463400 25 Left 1113463392 13:110497089-110497111 CCAGCACAGCCTCAGTCAGGGGT 0: 9
1: 3
2: 6
3: 24
4: 229
Right 1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113463400 Original CRISPR TAACCTCAGCCAGGGATCTA GGG Intronic
901390892 1:8945377-8945399 TGCCCTCAGCCAGGCATCCAGGG - Intergenic
906584683 1:46965885-46965907 TCACTCCAGCCAGGGTTCTATGG - Intergenic
917127783 1:171705491-171705513 TAACCTCAGCTAGGGATGTGTGG + Intronic
918110655 1:181452557-181452579 CTACCTCAGCCAGGGCTCTCAGG + Intronic
922205370 1:223441768-223441790 TCATCTCAGACAGGGCTCTATGG + Intergenic
922963496 1:229667857-229667879 TTCCCTCAGCCAGGAATCTTTGG - Intergenic
923005195 1:230044087-230044109 TAACAAGAGCCAAGGATCTAAGG - Intergenic
923497162 1:234535750-234535772 TAACCTCCGCCAGGGCTTGAGGG - Intergenic
1062787756 10:279440-279462 TCTCCTCTGCCAGGGACCTATGG + Intronic
1064210956 10:13360123-13360145 TAACCCCAGGCAGGGGCCTAGGG - Intergenic
1069476669 10:68739500-68739522 TAAACTGGGCCATGGATCTAGGG - Intronic
1070714387 10:78708481-78708503 TGACCTCAGCCTGGGCTCAAGGG - Intergenic
1075230441 10:120671693-120671715 CAACTCCAGCCAGGGATTTAGGG + Intergenic
1075969994 10:126643988-126644010 AAACCTCAGCCAGGGTCCTCTGG + Intronic
1076888937 10:133274687-133274709 TAGCCTCAGCCAGGCAGCAAAGG + Intronic
1080957228 11:37112692-37112714 TATGCTCAGCCAGAGGTCTAGGG - Intergenic
1084400321 11:68939528-68939550 TCACCGCAGCCATGGATCTGGGG - Exonic
1084414792 11:69025541-69025563 TAACCACTGCCAGGGAACTCTGG + Intergenic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1089194335 11:116684494-116684516 TAACCTTAGCCAGTGAAATAAGG + Intergenic
1090745741 11:129703529-129703551 CAACCACAGCGAGGCATCTAGGG + Intergenic
1091618497 12:2067734-2067756 TAACCTCAGTCAGGGCGCAACGG + Intronic
1091779235 12:3203468-3203490 TAACCTCTGCCAAGGTTTTAAGG - Intronic
1091911509 12:4234182-4234204 TAACCTATGACAGGGATTTATGG - Intergenic
1094580302 12:31728515-31728537 CAATCTCAGCCAGGGATCCGTGG + Intronic
1096669118 12:53187831-53187853 TGACCTCAGCCAAGGGTCCAGGG - Exonic
1100390562 12:94142985-94143007 AAGCCCCAGCCAGAGATCTAGGG - Intergenic
1103584785 12:121944248-121944270 TAGACTCAGCCAGGGAAATATGG + Intronic
1105532470 13:21231974-21231996 TAACTCCAGACAGGGATCAACGG + Intergenic
1108841951 13:54628688-54628710 CAACCTGAGCCAGTGATATAAGG + Intergenic
1110913226 13:80989929-80989951 TGACCTCATCCAGGAGTCTAAGG + Intergenic
1113166390 13:107448195-107448217 GACCCTCAGCCAGGAATCGAAGG - Intronic
1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG + Intronic
1117135547 14:52731155-52731177 AAACAGCAGGCAGGGATCTAAGG - Intronic
1121712585 14:96050680-96050702 TAAACTCAGGCAGGGCTCAATGG - Intronic
1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG + Intergenic
1136620166 16:31423357-31423379 TAACCTCAGCCAGCGAGATCTGG + Exonic
1142425684 16:90001114-90001136 GAACGTCAGCCAGGCATCAAGGG + Intergenic
1144549298 17:16225716-16225738 TAGCTTCAGCCAGGTAGCTAAGG + Intronic
1148760588 17:49997869-49997891 GAGCCTCAGCCAGGGGTCCACGG - Intergenic
1151128337 17:71869387-71869409 TAAACTCAGCCAGGGCTGTTGGG + Intergenic
1153910724 18:9704602-9704624 TAAGCTCAGCCAGAGATCCAAGG + Intergenic
1153934091 18:9905227-9905249 TTACTTTAGCCAGGGCTCTAAGG - Intergenic
1157960934 18:52152565-52152587 TAATCTCTGTCAGGGATATAAGG - Intergenic
1162078498 19:8205058-8205080 TCTCCTCACCCAGGGTTCTAGGG + Intronic
1165309594 19:35022267-35022289 TGACCTCACCCAAGGATCAAGGG + Intronic
926873191 2:17445993-17446015 CAACTTCAGCCAGGGACTTAGGG + Intergenic
927609779 2:24526427-24526449 TAACATGAGCCATGGATTTAGGG + Intronic
927954114 2:27196201-27196223 TCACCTCAGCCAGGGCTACATGG - Intergenic
928883433 2:36122656-36122678 CAACTCCAGCCAGGGATATATGG - Intergenic
930186838 2:48419612-48419634 TGACCCTAGCCAGGGATCAAGGG - Intergenic
930455732 2:51605596-51605618 CAACTCCAGCCAGGGATTTAGGG - Intergenic
936685903 2:114826383-114826405 TTTCCTCACCCAGGGACCTATGG + Intronic
936789339 2:116132746-116132768 TTACCTCACCCAGGGAACTAAGG - Intergenic
947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG + Intronic
948155512 2:235778126-235778148 TAACCTGAGCCAGGGACAGAGGG - Intronic
948301271 2:236909180-236909202 TACCCTGAGCCAGGGATGTGGGG + Intergenic
1170365937 20:15598454-15598476 TAACCTCAGTCGGGCATCTGAGG - Intronic
1173256948 20:41400472-41400494 CAAACTCAGCAAGGTATCTATGG - Intergenic
1173764549 20:45595688-45595710 TATCCCCAGCCAGGGGTTTATGG - Intergenic
1178403097 21:32304066-32304088 TAAATTCTACCAGGGATCTAAGG - Intronic
1184731423 22:46373088-46373110 TGACCTCAGCCTGGGATGCAGGG - Intronic
1185263986 22:49888551-49888573 TAACCCCAGACAGGGCTCCAGGG + Exonic
949886282 3:8697188-8697210 TAACCTCACCCAAGGATATAAGG + Intronic
951699973 3:25486438-25486460 TATCCTCTGCCAGGGCTGTAGGG - Intronic
952112200 3:30137157-30137179 TAACCTCGCCCAAGGATATAAGG - Intergenic
953856919 3:46506318-46506340 AAACCTCAGCCTGGGATTGACGG - Intergenic
953865624 3:46580676-46580698 TAGCCTGAGCCAGGTTTCTAGGG + Intronic
954529232 3:51304095-51304117 CAACTTCAGCCAGGGGTTTAGGG - Intronic
956386469 3:68725024-68725046 CAACTGCAGCCAGGGTTCTAGGG - Intergenic
958132674 3:89449280-89449302 TCACGTCAGCCAGCGATGTATGG + Exonic
961270989 3:125688463-125688485 TAACCTCAGCCAAGGATATAAGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
971443713 4:26718846-26718868 TAAACTCAGCCAGGATTTTAAGG + Intronic
977039814 4:92002127-92002149 CAACTCCAGCCAGGGATTTATGG + Intergenic
980404951 4:132344334-132344356 CATCCTCAGCCAGGGGTTTATGG - Intergenic
983464981 4:168075824-168075846 ACACCCCAGCCAGGGATCCAAGG + Intergenic
983753755 4:171307860-171307882 TAAAGTTAGCCAGGGCTCTATGG - Intergenic
984584845 4:181551609-181551631 TAGCCTCTGTCAGGGATATAGGG + Intergenic
987607840 5:20161233-20161255 TGGCATCAGCCAGGCATCTAGGG - Intronic
987881304 5:23749554-23749576 TAACCTCTGCTAGGGAAGTAAGG - Intergenic
996117340 5:119633225-119633247 TAGCCTCATCCTTGGATCTATGG - Intronic
996419334 5:123244499-123244521 TAACCACAGCCTGGGAACAAGGG + Intergenic
997299105 5:132789405-132789427 TACCCCCTGCCAGGGATCCAGGG + Intronic
999765553 5:154737983-154738005 TAACCTCCTCCAGGAACCTAAGG + Intronic
1003902646 6:10669068-10669090 TAAGCTCAGGCAGGGATTTTAGG - Intergenic
1004443637 6:15677225-15677247 TAACCTCACCCAGGGATTCTAGG - Intergenic
1005356204 6:24985682-24985704 TTACATCAACCAGGGGTCTAGGG - Intronic
1007130348 6:39466655-39466677 TAACCTTAGACTGGGAGCTAGGG - Intronic
1009707107 6:67266242-67266264 CAACTTCAGCCAGGGGTTTACGG - Intergenic
1011973151 6:93254719-93254741 TCACATCAGCCAGTGATGTATGG - Exonic
1015045671 6:128773657-128773679 TAGCCTCAGCCCTGGAGCTAAGG + Intergenic
1015447596 6:133325751-133325773 TAACTGCAGCCATGGCTCTATGG - Intronic
1023124869 7:36945616-36945638 TAACCCCATCCAGGGAGCTAAGG - Intronic
1024506542 7:50167073-50167095 GAACCTCAGCCAAGGAGCTGAGG + Intergenic
1033265854 7:139886437-139886459 TAACCTTTGCCCGGAATCTATGG + Intronic
1045732954 8:105263291-105263313 TAACTCCAGCCAGGGTTATATGG - Intronic
1048095156 8:131283991-131284013 TGACCTCTGCCAGGGAGCTGAGG + Intergenic
1059104481 9:111500014-111500036 TAACCTCAGTTAGGGAGCTGAGG - Intergenic
1188669791 X:32868713-32868735 TAACTCCAGCCAGGGGTTTAGGG + Intronic
1192723557 X:73724797-73724819 TCACCTTTGCCAGGGATCTTGGG + Intergenic