ID: 1113472853

View in Genome Browser
Species Human (GRCh38)
Location 13:110559102-110559124
Sequence CCTGCAAGGCAGGCAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113472853_1113472858 -8 Left 1113472853 13:110559102-110559124 CCATCCACTGCCTGCCTTGCAGG 0: 1
1: 0
2: 8
3: 45
4: 408
Right 1113472858 13:110559117-110559139 CTTGCAGGCTACAAGCAGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 137
1113472853_1113472860 -1 Left 1113472853 13:110559102-110559124 CCATCCACTGCCTGCCTTGCAGG 0: 1
1: 0
2: 8
3: 45
4: 408
Right 1113472860 13:110559124-110559146 GCTACAAGCAGCCAGGCATTGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1113472853_1113472859 -2 Left 1113472853 13:110559102-110559124 CCATCCACTGCCTGCCTTGCAGG 0: 1
1: 0
2: 8
3: 45
4: 408
Right 1113472859 13:110559123-110559145 GGCTACAAGCAGCCAGGCATTGG 0: 1
1: 0
2: 1
3: 6
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113472853 Original CRISPR CCTGCAAGGCAGGCAGTGGA TGG (reversed) Intronic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
900143914 1:1149912-1149934 GCTGCAAGGCTGGCAATGGAGGG + Intergenic
900285297 1:1896225-1896247 CCTGCAAGGGAGGCAGGGGCTGG - Intergenic
900411755 1:2515717-2515739 ACTGGAAGACAGGCAGTGGCAGG + Exonic
901052093 1:6430323-6430345 CCTGCCAGGGAGGCTGTGGGTGG + Intronic
901054051 1:6440485-6440507 CCGGCAGGGCGGGGAGTGGAGGG + Intronic
901321547 1:8343246-8343268 CCAGCATGGCATGCAGGGGAGGG + Intronic
901559343 1:10057902-10057924 CAAGCATGGGAGGCAGTGGAGGG + Intronic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
902447396 1:16476013-16476035 CCTGCAGGGCCGGCAGCGGCAGG - Intergenic
902480242 1:16707825-16707847 CCGGCAGGGCGGGGAGTGGAGGG - Intergenic
902580266 1:17403624-17403646 TCTGCTATGCAGGCAATGGAGGG - Intergenic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903809679 1:26028481-26028503 CCTGCAACCCAGCCAGGGGAGGG - Intronic
905022194 1:34825638-34825660 CCAGCAAGGCCGCCAGTGGGCGG - Intronic
905399221 1:37689847-37689869 CCTGCACGGCAAGCAGAGGCCGG + Exonic
907245160 1:53103695-53103717 CCTGTGAGGCAGGCAGAGCAGGG + Intronic
907276295 1:53318392-53318414 CCAGCGAGGCAGGCAGCTGAAGG - Intronic
910825653 1:91404663-91404685 TCTGCCGGGCAGGCAGCGGACGG - Intronic
911716429 1:101138814-101138836 CCTGAGAGGCAGGCAGGGCAAGG - Intergenic
912331504 1:108824231-108824253 CCTGTCTGGCAGGCTGTGGACGG + Intronic
912711116 1:111950610-111950632 CTTGAAAGGCAGGCAGATGAAGG + Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
914883805 1:151568841-151568863 CCTGTAAGGCAGGGTGTGGTAGG + Intronic
915576541 1:156782547-156782569 CCTGGAAGACAGGCAGTGGTAGG + Intronic
915807003 1:158864640-158864662 CCGCCAAGCCAGGCATTGGAGGG - Intergenic
916602605 1:166307652-166307674 GCTGTTAGGCAGGCAGAGGAGGG - Intergenic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918648313 1:186927971-186927993 GTCGAAAGGCAGGCAGTGGAGGG + Intronic
920301582 1:204992265-204992287 CTTACATGCCAGGCAGTGGAGGG + Intronic
920732077 1:208496877-208496899 TCTGCCAGGCATGGAGTGGAAGG + Intergenic
922482808 1:225950859-225950881 CCTCCAAGGCTGACAGTGAAGGG + Intergenic
923744269 1:236686327-236686349 GCTGCAGGGGAGACAGTGGAGGG + Intergenic
924131037 1:240908583-240908605 CCTGGCAGGGAGGGAGTGGAAGG - Intronic
924536155 1:244937458-244937480 AGTGCAGGCCAGGCAGTGGAGGG - Intergenic
1062959909 10:1565027-1565049 CCTGCACGGGAGGGAGGGGAAGG - Intronic
1063909695 10:10817056-10817078 CCAACATGGCGGGCAGTGGACGG + Intergenic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1064886371 10:20117485-20117507 CATTCAAGGCAGACAGTTGATGG + Intronic
1065091943 10:22244133-22244155 TCTGCAGGGGAGACAGTGGAGGG - Intergenic
1065628253 10:27653244-27653266 CCTGCATGGCAGGGAGTGGGTGG - Intergenic
1065706574 10:28476342-28476364 GGTGAGAGGCAGGCAGTGGAGGG + Intergenic
1066426952 10:35316175-35316197 ACTGCTAGGCAGGCAGAGTATGG - Intronic
1066466895 10:35659691-35659713 CCTGCATGGTAGGCACTGGGTGG + Intergenic
1067118603 10:43455468-43455490 CCTGCACGGCAGGCATGGAAAGG - Intronic
1067165627 10:43864423-43864445 CACCCAAGGCAGGCAGTGGTGGG - Intergenic
1068913719 10:62406174-62406196 TCTGAAAGGAAGGCAGTGGCTGG - Intronic
1069150574 10:64954228-64954250 CCTGGAAGGCACTCAGGGGAGGG - Intergenic
1069954800 10:72043399-72043421 CCTGCAGGGCTGGCAGGGAAGGG + Intergenic
1070353500 10:75616146-75616168 CAGGCAAGGCAGGCTGTGCAGGG + Intronic
1070419070 10:76218428-76218450 CCTGCAATGCAGGGAGTGATTGG + Intronic
1071176864 10:82936822-82936844 GTTACAAAGCAGGCAGTGGAGGG + Intronic
1071430663 10:85603874-85603896 CCTGCAAGGTGGACAGGGGATGG - Intronic
1072609151 10:97005018-97005040 CTGGCCAGGCTGGCAGTGGATGG - Intronic
1073460963 10:103665680-103665702 CAGGCCAGGCAGGCAGTGGGCGG + Intronic
1073468622 10:103708999-103709021 CCTGCAAGCCAGGGAATTGAAGG - Intronic
1074461212 10:113638629-113638651 CCTGCAAGGCAGCAATTGGCTGG - Intronic
1075780706 10:125015528-125015550 ACTGCAAGACCGGGAGTGGACGG - Intronic
1076224950 10:128766677-128766699 CATCCAAGGTAGGCAGTAGAGGG - Intergenic
1076717585 10:132374304-132374326 CCAGCAAGGCAAGCCGGGGAGGG + Intronic
1076752609 10:132551155-132551177 CCTGAAAGGTAGGCAAGGGAGGG - Intronic
1076814053 10:132905900-132905922 CCTGCAAGGAAGGCTAGGGAGGG + Intronic
1077001978 11:328054-328076 CCTGCAATGCCGCCAGTGGAAGG - Intergenic
1077092510 11:786108-786130 ACTGGAAGGCAGGCTGAGGATGG + Intergenic
1077165065 11:1131138-1131160 CCCACGAGGCAGGCAGGGGAGGG + Intergenic
1077411286 11:2405079-2405101 CCAGCAAGGCAGGCCCAGGAAGG + Intronic
1079241981 11:18727877-18727899 ACAGGAAGGAAGGCAGTGGAGGG + Intergenic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1081630763 11:44688174-44688196 CCTGCCAGGCAGGCACCAGAGGG - Intergenic
1081906705 11:46674881-46674903 AGTGCAAGGCAGGGAGTGCAGGG + Intergenic
1082127848 11:48453759-48453781 CCACCAAGCCAGGCACTGGAGGG + Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083759902 11:64810132-64810154 CCTGCAAGGCAAGCCGGGGGAGG + Exonic
1084198375 11:67539353-67539375 CCTGCAGGGCAGGGAGTGTGAGG - Intergenic
1084548880 11:69828933-69828955 CCTGCAGGTCAGGCAGAGAAAGG - Intergenic
1084784605 11:71434896-71434918 ACTGCAGAGCAGGCAGGGGAGGG + Exonic
1085249062 11:75129798-75129820 TCAGCAACACAGGCAGTGGAGGG - Intronic
1086001315 11:81988747-81988769 CCTGAAAGGCAGGCACTTCAAGG + Intergenic
1087252135 11:95914391-95914413 CCTGCAGGGCAGGGAGTGGTGGG + Intronic
1088280953 11:108134289-108134311 CCTACAAGGCAGGCAGTATTGGG + Exonic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089030847 11:115327344-115327366 CCTGCAAGGCTGGCACTTGCGGG + Intronic
1089353250 11:117833402-117833424 CCTGGATGGCAGGGACTGGAGGG - Intronic
1090056793 11:123430819-123430841 CCTGCAGGGCGGGCAGCGGCCGG - Exonic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091995115 12:4987264-4987286 GCTGCCAGGCAGGCAGGAGAAGG - Intergenic
1092019149 12:5185935-5185957 ACTGCCAGGCAGGGAGGGGACGG - Intergenic
1092039198 12:5368625-5368647 TCTGCAGTGCAGGCTGTGGAGGG - Intergenic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092570870 12:9720006-9720028 AGTGCAAGGCAGTGAGTGGAAGG + Intronic
1092844008 12:12567310-12567332 CCAGCAAGGCAGGGAGTCCAAGG + Intergenic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1095992267 12:48043694-48043716 CCCAAAAGGCAGGCAGTTGAAGG + Exonic
1096222091 12:49836905-49836927 GCTGTAAGGCAGACAATGGATGG + Exonic
1096244305 12:49975694-49975716 CCTGCAAGGCAGGAAGCCCAAGG - Exonic
1096256262 12:50063961-50063983 CCAGCTAGGCAGGGAGTGGAGGG + Intronic
1098159084 12:67630935-67630957 CCTGCAGGGCAGGCACTGGTGGG + Intergenic
1098888500 12:75984048-75984070 CCTGCTAGGCAGGCCGGGCATGG + Intergenic
1100664632 12:96737938-96737960 CATGGAAGGCAGGCTGGGGATGG + Intronic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102223932 12:111214766-111214788 ACTGCAAGGGAGGCGGTGAAGGG - Intronic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1103729821 12:123020030-123020052 CCTGCGAGGCAGGAAGTGGCAGG + Intronic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104621013 12:130312913-130312935 CTTCCAAGGCATGCAGGGGATGG - Intergenic
1104999581 12:132681218-132681240 CCTGGAACGGAGTCAGTGGACGG - Exonic
1105476155 13:20729816-20729838 CCTGCAAGGAGGGCAGGGCAGGG - Intronic
1106407521 13:29486975-29486997 CCTGGTAGGCAGGCAGGTGAGGG + Intronic
1106801017 13:33255739-33255761 CCTCCAGGGCAGGGAGGGGACGG + Intronic
1107590883 13:41903669-41903691 CCTGCAAGGCAAGGAGTAAAAGG + Intronic
1107634977 13:42382806-42382828 TGTGGAAGGCAGGCAGTGGATGG - Intergenic
1108339186 13:49480197-49480219 TCTAAAAGGCAGGCAATGGATGG - Exonic
1109720511 13:66269607-66269629 CTTTCAAGGCTGGCAGAGGAAGG + Intergenic
1111074819 13:83220333-83220355 CCTGAAAGGAAGGGAGTGGTAGG - Intergenic
1111791660 13:92864331-92864353 CCTGCAAGCCAGACAATGGCAGG - Intronic
1111878750 13:93929152-93929174 CCTGAAAGGCAAGCAGTGAAAGG - Intronic
1111897612 13:94160542-94160564 CCTGCAACCCATGCAGTGCATGG - Intronic
1113325501 13:109277617-109277639 CCTGCAAGGCTGGAAGAGAAAGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1113786783 13:113006261-113006283 ACTGCAGGGCAGGCAGTGCCAGG - Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1114455012 14:22848573-22848595 TCTGCAAGGCAGGCGGCGGAGGG - Intronic
1114459069 14:22875505-22875527 ATTGCAAGGCAGGGAGGGGACGG - Exonic
1116039685 14:39670562-39670584 CTTGCAAGGCAGTGAGTTGAAGG + Intergenic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1118055653 14:62077047-62077069 CCTGCAAAGCAGGCAGTTACGGG - Intronic
1118304055 14:64639788-64639810 TCTGCAAGACTTGCAGTGGAGGG + Intergenic
1119086382 14:71743229-71743251 TCTGCAAGGTAGTCTGTGGATGG - Intergenic
1119758050 14:77132573-77132595 TCTGCCAGGCATGCTGTGGAAGG - Exonic
1120761765 14:88291767-88291789 CCTGTAATGCAGGCTGAGGAGGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121737046 14:96225902-96225924 CCTGCTAGGGTGGGAGTGGAGGG - Intronic
1122156548 14:99753546-99753568 CCTGCCAGGGAGGGAGTAGAGGG - Intronic
1122366283 14:101196812-101196834 CCTGGAAGGCTGGCAGCAGAGGG - Intergenic
1122622727 14:103068915-103068937 CCAGCAAGTCAGGCAGGGGTGGG - Intergenic
1122854758 14:104554720-104554742 CCTGCAATGCTGGCTGTGGGTGG + Intronic
1122920588 14:104878329-104878351 CCATCGAGGCAGGCAGAGGAGGG - Intronic
1122970273 14:105149673-105149695 CCTGCAAGCATGGCAGTGGCTGG - Intronic
1124076832 15:26454131-26454153 CCCTCAAGGCAGGCACTGGTGGG - Intergenic
1125506674 15:40271440-40271462 CATGCCAGGGAGGAAGTGGAAGG + Intronic
1125514500 15:40310175-40310197 CCTCCAGGGTGGGCAGTGGAAGG + Intergenic
1126538999 15:49801639-49801661 CCTGAAGGGAAGCCAGTGGAGGG - Intergenic
1127969221 15:63945731-63945753 ACTGTAAGTCAGGCAGTGGATGG + Intronic
1128262736 15:66243744-66243766 CAGGCAAGTCAGGCAGGGGAAGG + Intronic
1128546090 15:68568821-68568843 CCTGCCAGCCAGGAAGGGGAAGG + Intergenic
1129467912 15:75734186-75734208 CCTCTGTGGCAGGCAGTGGAGGG - Intergenic
1129719348 15:77869545-77869567 CCTCTGTGGCAGGCAGTGGAGGG + Intergenic
1129888211 15:79053335-79053357 CCTAGAAGGCTGACAGTGGAGGG - Intronic
1131084728 15:89566721-89566743 CCTGCAAGGCAAGAAGGTGAAGG - Intergenic
1131116933 15:89801645-89801667 CCTGGATGGCAGGGACTGGAGGG - Intronic
1132827730 16:1913471-1913493 CCTGCCAGCCAGGTAGTGCAGGG + Intronic
1132847545 16:2007374-2007396 CCTTACAGGCAGGCAGTGGGAGG - Intronic
1133235683 16:4386380-4386402 CCTGGAAGGCAGGAAGTGGTGGG + Intronic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1135222302 16:20623651-20623673 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135313397 16:21422861-21422883 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135366321 16:21855139-21855161 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135445494 16:22516025-22516047 CCTGCATGGGAGACTGTGGAGGG + Intronic
1135551620 16:23402877-23402899 CCTGCAAGGCTGGGAGTCCAGGG - Intronic
1136152544 16:28360581-28360603 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136194205 16:28640601-28640623 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136210538 16:28754700-28754722 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136323508 16:29503366-29503388 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136438193 16:30243335-30243357 CCTGCATGGGAGACTGTGGAGGG - Intronic
1137251811 16:46746840-46746862 GCTGCAGGGCAGGGAGGGGAAGG + Intronic
1137409554 16:48216287-48216309 CCTGCAAGACAGCAAGTTGATGG + Exonic
1138321786 16:56120216-56120238 GGTGGAAGGCAGGCACTGGAGGG + Intergenic
1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG + Intergenic
1138607098 16:58096560-58096582 CCTGCAAGGGAGGGATTGGGTGG - Intergenic
1138659269 16:58508100-58508122 CCTCCAGGGCCAGCAGTGGACGG + Intronic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1138910113 16:61386407-61386429 AATGCAAGGCAGGCAGTGACAGG - Intergenic
1139388497 16:66589605-66589627 CCTGCAGGCCAGGCAGTGTGAGG + Intergenic
1139492327 16:67292940-67292962 CAGGCTAGGCAGGTAGTGGAGGG - Intronic
1139558129 16:67725548-67725570 GGAGCAAGGCAGGCAGTGGGAGG + Exonic
1139852813 16:69961171-69961193 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1139857747 16:69993965-69993987 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1139881784 16:70184079-70184101 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1140370725 16:74411427-74411449 CCTGCAAGGCAACCAGTGGCTGG + Intronic
1140506556 16:75477291-75477313 CCTGCAAAGCAAGCAGGGCAAGG - Exonic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1142970321 17:3606884-3606906 CCTGCCCAGCATGCAGTGGATGG - Intergenic
1143660585 17:8322272-8322294 ACAGCAAGGCAGACAGTGGCTGG + Exonic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144578266 17:16443521-16443543 TGGGCAAGGCAGGCAGGGGAGGG - Exonic
1144739797 17:17575518-17575540 CATGCAGGCCAGGCAGTGGGAGG + Intronic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1148063103 17:44850066-44850088 CCTGCAAGGTAGGCAGGCCAGGG - Exonic
1148897208 17:50845881-50845903 CCTGGGAGGCAGGCAGGAGAGGG - Intergenic
1149154280 17:53607774-53607796 AATGCATGGCATGCAGTGGAAGG - Intergenic
1149585862 17:57786030-57786052 CCTCCTAGCCAGGCAGTGGGGGG - Intergenic
1149657499 17:58318076-58318098 GCTTGCAGGCAGGCAGTGGAGGG + Intronic
1151393105 17:73801236-73801258 GCAGTAAGGCAGGCAGGGGAGGG - Intergenic
1151430009 17:74056006-74056028 CCTCCAAGGCTGGCACCGGATGG + Intergenic
1151604098 17:75125343-75125365 CTTGCAAGGAGAGCAGTGGAGGG + Intronic
1151668322 17:75558094-75558116 CACTCAAGGCAGGCAGGGGATGG + Intronic
1151824133 17:76514166-76514188 CCTGCTAGCCAGGCAGGGGAAGG + Intergenic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1151936700 17:77266353-77266375 CCTGCAAGGAGGGATGTGGAGGG + Intergenic
1152235759 17:79137572-79137594 CCCGGGGGGCAGGCAGTGGAGGG - Intronic
1152739603 17:82013154-82013176 CCTGCAGCGGAGGCAGGGGAGGG + Intronic
1154119191 18:11637218-11637240 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1154402614 18:14056009-14056031 CATGCTAGGCGGGCTGTGGAAGG - Intergenic
1154489545 18:14909118-14909140 GCTGCATAGGAGGCAGTGGAGGG + Intergenic
1156464714 18:37341501-37341523 ACTGGAAGGCAGTGAGTGGAGGG + Intronic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157804080 18:50645055-50645077 CCTGCAGGCCAGGGAGTGGGTGG + Intronic
1158032258 18:52980072-52980094 CCTGTAAGGCAGACAGTTGGGGG - Intronic
1160159316 18:76459428-76459450 CCTCCCTGGCCGGCAGTGGAGGG - Intronic
1160608053 18:80066969-80066991 CCCTCCAGGCAGGCAGAGGAGGG + Intronic
1161377985 19:3950007-3950029 CCTGCCTGGGAGGCACTGGAGGG + Intergenic
1163182541 19:15614761-15614783 CCTGCCAGGCTGGCAGTGGAGGG + Intergenic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1164618428 19:29680229-29680251 CCTCCAGGCCAGGCTGTGGATGG + Intergenic
1164670110 19:30067592-30067614 CCTGGAGGGCAGTCAGGGGAAGG + Intergenic
1165024503 19:32949797-32949819 GCTGCACTGCAGGCAATGGAAGG + Intronic
1165046409 19:33108328-33108350 CCTGAAAGGCGGGCAGGGGCGGG - Intronic
1165461016 19:35944526-35944548 CCTGCAGGGCAGGCAGGTGGGGG - Exonic
1166408868 19:42543038-42543060 CCTGCAGGACAGTCAGTGCAGGG + Intronic
1166762889 19:45235668-45235690 TCTGCCAGGGAGGAAGTGGAGGG - Intronic
1168242731 19:55095509-55095531 CCTGAAAGGCGGACAGCGGAGGG - Exonic
1168667472 19:58215255-58215277 CTTGCAAGACAGGAAGAGGAAGG + Intergenic
1202714281 1_KI270714v1_random:33735-33757 CCGGCAGGGCGGGGAGTGGAGGG - Intergenic
925251418 2:2442151-2442173 ATTGCATGGCAGACAGTGGAAGG + Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
928796929 2:35034215-35034237 CCTGCAACGTAGTGAGTGGAGGG + Intergenic
929580844 2:43080993-43081015 CCTGCATGGCAGGCAGGCCATGG + Intergenic
929607822 2:43246893-43246915 CCTGGAAGGCAGGCAAGAGAAGG + Intronic
929888111 2:45896306-45896328 TCTGCTAGTCAGGAAGTGGAAGG - Intronic
932293982 2:70609189-70609211 TGTTCAAGGCAGGAAGTGGAAGG - Intronic
933655680 2:84885087-84885109 CCTGCACACCTGGCAGTGGAGGG - Intronic
937211686 2:120276802-120276824 CCTGCAAGGTAGGTGGTGGTTGG + Intronic
937798060 2:126049086-126049108 CCTGCAAGTCAGTAAGGGGATGG + Intergenic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
940056096 2:149513984-149514006 CCTGCCAGGCAGGCAAGGGGAGG + Intergenic
940473469 2:154130012-154130034 CCTGCAAGTCAGTGAGTGAAAGG - Intronic
940570543 2:155427478-155427500 ACTTCAAGGCTGGCAGTGTAAGG - Intergenic
940683305 2:156813860-156813882 CCTGCACGGCAGGCAGAGAATGG - Intergenic
941008242 2:160269627-160269649 CCTGTGAGGCAGGCAGTGCCTGG + Intronic
941526281 2:166610568-166610590 GCGGCCAGGCAGGCAGTAGATGG + Intergenic
944755846 2:202760904-202760926 TCAGCAGGGCTGGCAGTGGAGGG - Intronic
945197838 2:207253846-207253868 TCTGTAAGGCAGGGACTGGAGGG + Intergenic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
946989823 2:225315850-225315872 CCTAAAAGGTTGGCAGTGGAGGG + Intergenic
947368237 2:229418294-229418316 CCTGCAAGGAAGGCAGTTGGGGG + Intronic
947582104 2:231326690-231326712 CCTGGAAGGCAGGTTGTGGCTGG - Intronic
947788909 2:232851045-232851067 CATGCAAGGCAGGCTGGGCACGG + Intronic
947960275 2:234230425-234230447 CCTGCAAGGGAGGCTGGGAAAGG + Intergenic
947987902 2:234464752-234464774 TCTGGAAGGAAGGCAGGGGAAGG - Intergenic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948578990 2:238971459-238971481 CCTACAAGGGAGGCAGAGGCTGG - Intergenic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
948943419 2:241207552-241207574 CCTGCAAGGCATGGAGCGGAGGG - Exonic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169441117 20:5634742-5634764 TCTGCAAGGGAGGCAGTGTTGGG - Intergenic
1170882221 20:20306729-20306751 CTTTCCAGGCAGGCAGAGGAAGG + Intronic
1171212139 20:23325260-23325282 CCTGCAGGGATTGCAGTGGATGG - Intergenic
1171226532 20:23446218-23446240 CTTGCAAGGCTGGCCTTGGATGG - Intergenic
1171419225 20:25006649-25006671 CCTGCTAGGCATGCAGGGGCTGG - Exonic
1172283922 20:33727825-33727847 CCTGCCAGCAAGGCAATGGAAGG + Intergenic
1172842725 20:37911720-37911742 CCAGCAAGGCAGGCACAGGGTGG - Intronic
1172945865 20:38688724-38688746 GCTGCAAGCCAGGCAGGGAAGGG + Intergenic
1173585234 20:44177211-44177233 CCTCCAAGGCAGGAAGTCTATGG + Intronic
1174074575 20:47924128-47924150 CCTGCAGGGCAGTCAGAGGATGG + Intergenic
1174479033 20:50818063-50818085 CTTTCAAAGGAGGCAGTGGAAGG + Intronic
1175612805 20:60365439-60365461 CCTGCAGGGCAGGGAGGGGCTGG - Intergenic
1175905597 20:62377970-62377992 TCTGCATGGCACGCAGTGGCCGG + Intergenic
1176027441 20:62993320-62993342 CCTGGGAGGCAGGCAGAGGCTGG + Intergenic
1176130573 20:63495126-63495148 CCTGCCAGGCAGGCGGGGCAGGG - Intronic
1176292767 21:5055076-5055098 CCTGGAGGGCAGGCAGAGGCAGG - Intergenic
1176373146 21:6074532-6074554 CCTGCCAGGCCGGCAGTGGGTGG - Intergenic
1177597728 21:23267354-23267376 TCTGTCAGGCAGGCAGAGGAAGG + Intergenic
1178579046 21:33821636-33821658 TGTGCAAGGCAGGCAGGGCAAGG + Intronic
1178722112 21:35019196-35019218 CCTGCAAGGCAGGAAGTGCCAGG - Intronic
1179421168 21:41238112-41238134 CCTGGAATGCAGGCAGGGGGTGG + Intronic
1179525167 21:41971308-41971330 CCTGCTACCCAGGCAGGGGAGGG + Intergenic
1179750331 21:43463711-43463733 CCTGCCAGGCCGGCAGTGGGTGG + Intergenic
1179864493 21:44208574-44208596 CCTGGAGGGCAGGCAGAGGCAGG + Intergenic
1179914466 21:44467417-44467439 CCGGGGAGGCAGGCAATGGAGGG - Intergenic
1180044179 21:45295412-45295434 GCTAAAAGGCAGGCAATGGATGG - Intergenic
1180258737 21:46651539-46651561 TCTCCAGTGCAGGCAGTGGAGGG + Intronic
1180742777 22:18065300-18065322 CCAGGAAGGCAGGCAGGGGCTGG + Intergenic
1181059073 22:20273343-20273365 GCGGCAAGGGAGGCTGTGGAGGG - Intronic
1181407019 22:22692304-22692326 GCTGCAAGGCGGGCACTGGGAGG + Intergenic
1181854050 22:25769565-25769587 ACTGCAAGGCACCCAGAGGAGGG + Intronic
1182270618 22:29150978-29151000 CCTCCAACACAGGCAGTGGGTGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184042743 22:41953613-41953635 CCTGCCGGGCAGGCAGAGGTGGG + Intergenic
1184177124 22:42794795-42794817 CCTGCTAGGAAGGGTGTGGACGG - Intergenic
1185079875 22:48703757-48703779 CCTGCAGGGCAGGCTGTGAGAGG - Intronic
1185162846 22:49239895-49239917 CCTGCGAGGCTGTCTGTGGATGG + Intergenic
1185173678 22:49307335-49307357 GCGGCAAGGCAGGGAGAGGAGGG + Intergenic
1185242622 22:49754838-49754860 CCTGCAAGACAGGCTGTGCCCGG - Intergenic
1203278603 22_KI270734v1_random:110139-110161 CCTGCAAGGGGTGCAGAGGAGGG + Intergenic
950257682 3:11519515-11519537 CATGAAAGGCAGGCAGTGAGAGG + Intronic
950408097 3:12816990-12817012 CCTGCACGGCAGACGGTGGGAGG - Exonic
950890488 3:16400130-16400152 CCTGCAGGCCAGGCTGAGGATGG - Intronic
953413810 3:42704240-42704262 CCTGCAGGGCAGTCAGTGCCAGG - Intronic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
954117970 3:48477783-48477805 CCCACAAGGCAGGGTGTGGAGGG - Intronic
954294960 3:49669248-49669270 GCTGCAGGGCAGGCAGTAAAAGG + Exonic
954540268 3:51389055-51389077 CCCCCAAGGCAGCCAGTGCACGG + Exonic
954652287 3:52172407-52172429 CCCACATTGCAGGCAGTGGATGG + Intergenic
955052961 3:55430449-55430471 CCTGGAAGGTAGCCAGAGGATGG + Intergenic
955086498 3:55707744-55707766 CCTGCGATGCAGGCAGGGGTGGG + Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955495673 3:59529623-59529645 CCAGCAAGGCAGCCAGTACAGGG + Intergenic
960946938 3:122973420-122973442 CCAGCCTGGCGGGCAGTGGAGGG + Intronic
961018602 3:123485747-123485769 CCTGCAAGGCTGGCTGGGCAGGG + Intergenic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
961792192 3:129384254-129384276 CCTGCAAGGCAGCCAGAGGCTGG + Intergenic
961812666 3:129530854-129530876 CCTGCAAGGCAGTCAGCAGGCGG - Exonic
966797079 3:183725676-183725698 CCTGGAAGGGACGCAGTGGGAGG - Intronic
968074463 3:195808957-195808979 AGTGCAGGGCAGGCAGGGGAGGG - Intronic
968086625 3:195876805-195876827 CGGGCAAGGCGGGCAGTGGGAGG - Intronic
968266713 3:197368544-197368566 CCTGCAAGGCAGGAAGGGGGAGG + Intergenic
968503655 4:962294-962316 TCTGCAAAGCGGGCAGTTGAGGG - Intronic
968660626 4:1797374-1797396 CCTAGCAGGCAGGCAGTGGGGGG + Intronic
968751581 4:2392260-2392282 CCAGCCAGGCTGGCTGTGGAGGG - Intronic
968762954 4:2451723-2451745 TCTGCAAGTCAGGCTGTGGGGGG + Intronic
968889661 4:3361729-3361751 TCTGCAAGGGAGGCAGTGACAGG + Intronic
968890456 4:3366061-3366083 GCTGCAGGCCAGGCAGTGGTGGG + Intronic
969248942 4:5954581-5954603 CCTCCACGGCAGGCAGCGCATGG + Intronic
970204414 4:13641780-13641802 ACTGGAAGGCAGGCACTGAAAGG - Intergenic
971119362 4:23687098-23687120 CCTACTAGGCAGGCAGAGAATGG + Intergenic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
971884333 4:32423851-32423873 ACTGCAATGCAGGCCCTGGAGGG + Intergenic
972335860 4:38106842-38106864 CCTGCAGGGGAGGCCGTGGTGGG - Intronic
972340435 4:38148279-38148301 CCTGAAAGGCTGGCAGTTGTTGG + Intergenic
974876946 4:67713072-67713094 CTTGCTGGGCAGGCAGTGGCAGG - Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
980901382 4:138908482-138908504 CCTGCATGGAAGGCCGAGGATGG - Intergenic
981753540 4:148117405-148117427 GCTGAAAGGCAGGCAATGGCAGG - Intronic
982772889 4:159414457-159414479 CCTGCAAGACAGGATGTGGGTGG - Intergenic
985102670 4:186474084-186474106 AGTGTACGGCAGGCAGTGGAAGG - Intronic
985668809 5:1195973-1195995 CCTCCCAGGCACGCAGTCGACGG + Intergenic
985668852 5:1196153-1196175 CCTCCCAGGCACGCAGTCGATGG + Intergenic
985771745 5:1816166-1816188 CCGGTAAGGCAGGCAGCGGCCGG - Exonic
986274836 5:6264646-6264668 TCTGCAAGGCAGGAAGTGCAGGG + Intergenic
987137508 5:14913639-14913661 CCTGGAAGGCTGGAACTGGAAGG + Intergenic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
990193875 5:53290860-53290882 CCTGCAAGGTGCGCAGTGGTGGG + Intergenic
990528774 5:56653795-56653817 CAAGGAAGGCAGGCAGTGGGAGG - Intergenic
991493873 5:67209320-67209342 CCTACACGGTAGGCAGTGGCAGG + Intergenic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
997229329 5:132231278-132231300 CCTGCAAGGCAGGAAGACCAAGG - Intronic
997591652 5:135076856-135076878 GCTGCAAGGTAGGCAGGGCAGGG + Intronic
998107199 5:139476146-139476168 CCTGCAAGGCCCCCTGTGGAAGG + Exonic
998483092 5:142479342-142479364 GCTGCAAGGGAGTCTGTGGATGG + Intergenic
998848260 5:146331622-146331644 CCTGCAGGGCTGGCAGAGAAGGG + Intronic
999259445 5:150228974-150228996 CCTGACAGCCAGGCAGGGGAAGG + Intronic
999755484 5:154661265-154661287 CCAGCAGGGCAGGCAGAGGAGGG - Intergenic
1000019113 5:157303689-157303711 CCTGCAGGGTATGCAGAGGAGGG - Intronic
1000286740 5:159833420-159833442 GCTGGAAGGCAGGGAATGGAGGG - Intergenic
1001199060 5:169699432-169699454 CCTCCAAGGGGGACAGTGGAGGG + Exonic
1002015924 5:176322695-176322717 CCTGAAATGCAGGAAGTGAAGGG - Intronic
1002449408 5:179310399-179310421 CCTGCAAGGCAGCCTATGGGGGG - Intronic
1002537028 5:179881418-179881440 CCTGCAGAGAAGGCAGGGGATGG - Intronic
1002638232 5:180618534-180618556 CAGACAAGGCAGGCAGTGGAGGG - Intronic
1002673111 5:180886216-180886238 CCAGCAAGCCAGGCACAGGAGGG + Intergenic
1003228187 6:4225286-4225308 CCACCAAGCCAGGCATTGGAGGG - Intergenic
1003525153 6:6891115-6891137 TCTGCAAGGCAGGCTGTGCTAGG + Intergenic
1004327912 6:14693739-14693761 CGTTCAAGGCAGGCAGTGCGGGG - Intergenic
1004545612 6:16595663-16595685 GCTGAAAGGCAGGCAGTGAGGGG + Intronic
1005315877 6:24602393-24602415 CATGCCAGGCCGGAAGTGGATGG + Intronic
1006298933 6:33183095-33183117 ACTGCAAGGCAGGCAGAAGACGG + Intronic
1006595357 6:35189116-35189138 CCTGCAAGACAGGCAGGGTGAGG + Intergenic
1006763713 6:36486351-36486373 ACTGGAAGGCAGGCAGGAGAGGG - Intronic
1006803078 6:36771749-36771771 CCTCCAGGGTAGGCAGGGGAGGG - Intronic
1006898717 6:37486559-37486581 GCTGCAGGGCAGGGGGTGGATGG - Intronic
1007060161 6:38932700-38932722 GCAGCAAGGCATGAAGTGGATGG + Intronic
1007685724 6:43666281-43666303 CCTGCCAGGCAGGCAGCAGCTGG + Intronic
1007822422 6:44570488-44570510 CCTGCAATGCAGGCTGTCTATGG - Intergenic
1009412033 6:63377336-63377358 CCTTCAGGGCATGCAGTTGATGG - Intergenic
1013287556 6:108694031-108694053 ATGGCAAGGCAGGCAATGGAAGG - Intergenic
1014393563 6:120894978-120895000 CCTGGAACACAGGCAGTGGTTGG + Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1016495822 6:144660686-144660708 AGTGCACGGCAGGCAGTGGCTGG - Intronic
1018364051 6:163100155-163100177 CCTGCAGGGGAGGCCGTGGTGGG - Intronic
1019038369 6:169082402-169082424 ACTGCAAACCTGGCAGTGGAAGG + Intergenic
1019108576 6:169690731-169690753 GCTGGGAGGCAGGCAGCGGAAGG - Intronic
1019173743 6:170149298-170149320 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173770 6:170149458-170149480 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173779 6:170149518-170149540 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173790 6:170149580-170149602 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173832 6:170149763-170149785 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173861 6:170149923-170149945 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173871 6:170149983-170150005 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173885 6:170150044-170150066 TCTACACTGCAGGCAGTGGAGGG - Intergenic
1019173939 6:170150293-170150315 TCTGCATTGCAGGTAGTGGAGGG - Intergenic
1019199699 6:170304629-170304651 CCTTGAAGGCAGGCAGAGCAAGG - Intronic
1019354218 7:570517-570539 ACTGCTGGGCAGGCAGTGGGGGG - Intronic
1019450456 7:1095112-1095134 CTTGCAGGGCAGGCTCTGGAAGG - Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020407988 7:7858380-7858402 CCTGCAAAGAGGGCAGAGGAGGG + Intronic
1020830545 7:13089504-13089526 CCTGCCAGGCAGAAAGTGAAGGG + Intergenic
1022950141 7:35330729-35330751 CCAGCAGGGCAGGCAGTGGTTGG - Intergenic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1023660865 7:42469664-42469686 ACTGCACGGCATGCAGCGGAGGG - Intergenic
1023998570 7:45176872-45176894 CCTGCAGGGGCGGCAGAGGAGGG - Intronic
1024211915 7:47213395-47213417 CCTAAAAGGCACTCAGTGGAAGG - Intergenic
1024516901 7:50266993-50267015 GCTGCAAGGCATGCTGGGGAGGG - Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1027129698 7:75582151-75582173 TCTGGAAGGGAGGCAGAGGAAGG + Exonic
1027570555 7:79860574-79860596 CTTGCAAGGCAGGCTGTACAGGG - Intergenic
1027816297 7:82976342-82976364 TCTGAAGGGCAGGCAGAGGAAGG - Intronic
1028289148 7:89044093-89044115 CCTGGGAGGCATTCAGTGGAAGG + Intronic
1029488009 7:100854796-100854818 CCTGCTAGGGAGGGTGTGGAAGG + Intronic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1031453741 7:121954340-121954362 AATGCAAGGCAGTGAGTGGAGGG - Intronic
1032377885 7:131441967-131441989 CCCTCAACGGAGGCAGTGGATGG + Intronic
1032504724 7:132426321-132426343 CCGGCAACCCAGCCAGTGGAGGG - Intronic
1033072054 7:138212408-138212430 CCTTCAAGGCAGGGACTGGTGGG + Intergenic
1033445015 7:141413167-141413189 CCTGAATGTCAGGCAGAGGATGG - Intronic
1035232742 7:157476266-157476288 CCTGCCAGGCACTCAGTGGCTGG - Intergenic
1035626150 8:1072120-1072142 CCGTCAAGGCACACAGTGGAGGG + Intergenic
1037941202 8:22952329-22952351 CATGCATGGCATGCAGAGGAGGG - Intronic
1038323452 8:26550962-26550984 CCTGGATGGAAGGCAGAGGAAGG - Intronic
1040481711 8:47832969-47832991 CCTGCAAAGCAGGGAGTCCAGGG + Intronic
1041955783 8:63556832-63556854 ACTGCAATCCAGGCAGAGGATGG - Intergenic
1044737024 8:95289296-95289318 ACTGCATTGCAGGTAGTGGATGG - Intergenic
1047560758 8:125986047-125986069 CCTGCACTGTAGGCAGTAGAAGG - Intergenic
1048255318 8:132901130-132901152 GCTTGAGGGCAGGCAGTGGAGGG + Intronic
1048969977 8:139640011-139640033 GCTGCTTGGCAGGAAGTGGATGG - Intronic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1049277158 8:141725611-141725633 CCTGCAGGCCAGGCAGAGGAAGG + Intergenic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049423459 8:142526898-142526920 CCTGCAAGCCAGGCAGAGGCGGG - Intronic
1049495300 8:142928104-142928126 ACTGCAAGGCAGGCTGGGAACGG - Intergenic
1049540906 8:143208344-143208366 CCTGGAAGGCAGGAACTTGATGG - Intergenic
1049575163 8:143386496-143386518 CCTGGAGGGGAGGCAGCGGAAGG + Intergenic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1052746687 9:32448476-32448498 CCACCAAGCCAGGCACTGGAGGG + Intronic
1053169997 9:35871763-35871785 CCTGCAAGGAAGGCACTGAGAGG - Intergenic
1056042578 9:82683481-82683503 CCCTCAAGGCAGGCAGTAAAAGG - Intergenic
1056183255 9:84106077-84106099 CTTGCAAGGCAGGCAGTGTATGG + Intergenic
1058096143 9:100862482-100862504 CCTCCTGGGAAGGCAGTGGAGGG - Intergenic
1058936498 9:109774039-109774061 CCTGCGGGGTTGGCAGTGGAGGG - Intronic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1060796398 9:126515213-126515235 CCTGAAGGGCAGCCAGGGGAGGG - Intergenic
1061009299 9:127945753-127945775 CCTGGAAGGCAGGAAGGGGCAGG + Exonic
1061074641 9:128333679-128333701 CCTCCAAGGGAAGCAGGGGATGG - Exonic
1061590673 9:131595611-131595633 CCTTGAGGGCAGGCAGTGAAGGG + Intronic
1061673528 9:132202507-132202529 CCTGGAAGGCAGGCAGGGGGTGG + Intronic
1061920423 9:133779564-133779586 GCAGCAAGGCAGGAAGGGGATGG + Intronic
1186449794 X:9662518-9662540 CCAAAAAGACAGGCAGTGGAAGG + Intronic
1186540963 X:10399276-10399298 CCTTCAGGCCAGGCAGTGGGTGG + Intergenic
1187478120 X:19629607-19629629 TCTGCAGGGCAGGAAGTGGCAGG + Intronic
1192184752 X:68939525-68939547 CCTGCAAGGCTGGCAAAGCAGGG - Intergenic
1194035786 X:88869722-88869744 CCTGCAAGGGATGCAATGTATGG - Intergenic
1194523986 X:94954404-94954426 ACTGCATGGCAGTCAGAGGAAGG + Intergenic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1197782437 X:130171659-130171681 CCGGGAATGCAGGCAGGGGAGGG + Exonic
1198076128 X:133194822-133194844 CCTGCAAGGCAGGGAGCCAACGG + Intergenic
1199934286 X:152556033-152556055 CCTGGATGGCATGCAGTGTAGGG - Intergenic
1200046941 X:153408258-153408280 GCTGCCACTCAGGCAGTGGACGG + Intergenic