ID: 1113473111

View in Genome Browser
Species Human (GRCh38)
Location 13:110561062-110561084
Sequence GCGTTCCTGCTCTGCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1651
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 1584}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113473111_1113473118 4 Left 1113473111 13:110561062-110561084 CCAGGGCGGCAGAGCAGGAACGC 0: 1
1: 0
2: 1
3: 65
4: 1584
Right 1113473118 13:110561089-110561111 CTCGGGAGCAAAGGCAGCTTAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1113473111_1113473117 -5 Left 1113473111 13:110561062-110561084 CCAGGGCGGCAGAGCAGGAACGC 0: 1
1: 0
2: 1
3: 65
4: 1584
Right 1113473117 13:110561080-110561102 AACGCGGGGCTCGGGAGCAAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1113473111_1113473120 23 Left 1113473111 13:110561062-110561084 CCAGGGCGGCAGAGCAGGAACGC 0: 1
1: 0
2: 1
3: 65
4: 1584
Right 1113473120 13:110561108-110561130 TAGGTACACAAATGACCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1113473111_1113473119 22 Left 1113473111 13:110561062-110561084 CCAGGGCGGCAGAGCAGGAACGC 0: 1
1: 0
2: 1
3: 65
4: 1584
Right 1113473119 13:110561107-110561129 TTAGGTACACAAATGACCAGCGG 0: 1
1: 0
2: 1
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113473111 Original CRISPR GCGTTCCTGCTCTGCCGCCC TGG (reversed) Intronic
900111623 1:1008851-1008873 ACGGTCTTGCTCTGTCGCCCAGG + Intergenic
900160912 1:1223424-1223446 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
900236325 1:1593134-1593156 GAGGTCTCGCTCTGCCGCCCAGG - Intergenic
900248774 1:1654682-1654704 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
900730494 1:4255757-4255779 GCGTCCTTGTTCTGACGCCCTGG - Intergenic
901074165 1:6542481-6542503 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
901095594 1:6676652-6676674 GCGCGCGTGCTCTGTCGCCCAGG - Intronic
901109222 1:6782292-6782314 AGGGTCCTGCTCTGTCGCCCAGG - Intergenic
901414822 1:9109416-9109438 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
901454384 1:9354773-9354795 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
901543260 1:9935400-9935422 GCATTCTTACTCTGTCGCCCAGG - Intronic
901855757 1:12043270-12043292 GCGCCTCTGCCCTGCCGCCCCGG + Intergenic
902043355 1:13508209-13508231 GGGGTCTTGCTCTGCCACCCAGG - Intronic
902169018 1:14595653-14595675 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
902265726 1:15262176-15262198 GCATTCCTGCTGTGCAGCCTGGG - Intronic
902279703 1:15365362-15365384 GGGTTCTTGCTCTGCCACCCAGG + Intronic
902354437 1:15887002-15887024 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
902542908 1:17167038-17167060 TCTTTCCTGCCCTGCCTCCCTGG + Intergenic
902591448 1:17477867-17477889 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
902912116 1:19606718-19606740 GCCTTCTTGTTCTGTCGCCCAGG - Intronic
902915779 1:19638418-19638440 TCATTCCTGCTCTCCCGTCCAGG + Intronic
903046900 1:20571242-20571264 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
903066263 1:20701403-20701425 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
903241447 1:21985318-21985340 GCGTTACTGCACTGCAGCCTGGG - Intronic
903250746 1:22051792-22051814 ACGTTCTTGCTCTGTCACCCAGG - Intergenic
903280921 1:22249339-22249361 GGGCTCCTGCTTTGCAGCCCAGG + Intergenic
903313745 1:22483051-22483073 GGAGTCCTGCTCTGTCGCCCGGG - Intronic
903492176 1:23737724-23737746 GAGTACTTGCTCTGTCGCCCAGG + Intergenic
903510370 1:23870128-23870150 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
903823961 1:26128712-26128734 CAGGTCTTGCTCTGCCGCCCAGG - Intergenic
903854180 1:26326510-26326532 GTCTTCTTGCTCTGTCGCCCAGG - Intronic
903898462 1:26624513-26624535 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
903922104 1:26807198-26807220 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
904162899 1:28534503-28534525 GAGATCCTGCTCTGTCACCCAGG + Intronic
904173580 1:28609510-28609532 GGGCTACTGCTCTGTCGCCCAGG + Intronic
904210563 1:28884353-28884375 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
904534247 1:31188595-31188617 GCATTCCTTCTCTGTAGCCCAGG - Intronic
904548869 1:31298409-31298431 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
904576078 1:31505852-31505874 GCCTCCCTGCTCTGAGGCCCTGG + Intergenic
904673807 1:32185416-32185438 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
904766594 1:32853443-32853465 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
904838074 1:33351924-33351946 GCATTCTTACTCTGTCGCCCAGG - Intronic
904906948 1:33904688-33904710 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
905078194 1:35293024-35293046 AGGTTCCTGCTCTGTCACCCAGG + Intronic
905520555 1:38596215-38596237 GGGATCTTGCTCTGTCGCCCAGG - Intergenic
905612467 1:39366357-39366379 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
905699067 1:39998416-39998438 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
905741857 1:40378148-40378170 GGGGTCTTGCTCTGCCACCCAGG + Intronic
905982999 1:42248506-42248528 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
905990987 1:42336649-42336671 GGAATCCTGCTCTCCCGCCCAGG + Intergenic
906330957 1:44883862-44883884 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
906335888 1:44930664-44930686 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
906494044 1:46290948-46290970 ACATTCCTGCTCTGTTGCCCAGG + Intronic
907245619 1:53106572-53106594 GGTGTCTTGCTCTGCCGCCCAGG - Intronic
907265738 1:53259605-53259627 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
907368347 1:53980932-53980954 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
907432555 1:54421887-54421909 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
908195778 1:61744256-61744278 GGGTTCTTGCTCTGTCACCCAGG - Intronic
908267851 1:62396173-62396195 ACAGTCTTGCTCTGCCGCCCAGG - Intergenic
908493325 1:64668299-64668321 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
908746283 1:67379482-67379504 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
909785578 1:79607933-79607955 GCCTTCTTGCTCTGTCGCCCAGG + Intergenic
909899225 1:81111255-81111277 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
909988190 1:82188523-82188545 GCGGTCTTGCTCTGCTGCCCAGG + Intergenic
910163330 1:84297847-84297869 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
910249483 1:85180662-85180684 GGATTCTTGCTCTGTCGCCCAGG - Intronic
910597790 1:88997863-88997885 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
910655363 1:89612807-89612829 GAGTTCTTGCTCTGTTGCCCAGG - Intergenic
911148054 1:94570814-94570836 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
911659519 1:100485535-100485557 GGGTGCTTGCTCTGTCGCCCAGG - Intronic
911747774 1:101459044-101459066 GCAGTCTTGCTCTGCCACCCAGG - Intergenic
912010507 1:104954850-104954872 ACGGTCTTGCTCTGTCGCCCAGG - Intergenic
912011089 1:104964036-104964058 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
912283177 1:108339254-108339276 GGATTCTTGCTCTGCTGCCCAGG - Intergenic
912361526 1:109099943-109099965 CCGTTCTTGCTGTGTCGCCCAGG - Intergenic
912454071 1:109786215-109786237 GGGTTCCTGATTTGGCGCCCAGG + Intergenic
912666080 1:111580819-111580841 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
912820606 1:112864963-112864985 GCAGTCCTGCTCTGTTGCCCAGG + Intergenic
912838486 1:113018160-113018182 GCGATCTTGCTCTGTTGCCCAGG - Intergenic
913005080 1:114622137-114622159 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
913213780 1:116603189-116603211 TCTTTCCTGCCCTGCTGCCCAGG - Intronic
913341568 1:117763092-117763114 GGATTCTTGCTCTGCTGCCCAGG - Intergenic
914231773 1:145768339-145768361 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
914575109 1:148959078-148959100 GCTTTCCTGTTTTGCCGCACAGG + Intronic
914731784 1:150377570-150377592 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
914737736 1:150434328-150434350 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
914778526 1:150761151-150761173 GGATTCATGCTCTGTCGCCCAGG - Intronic
914818982 1:151085069-151085091 GGGTTCTTGCTCTGTCACCCAGG - Intronic
914833526 1:151188854-151188876 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
914981049 1:152414623-152414645 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
914999064 1:152571537-152571559 GGAATCTTGCTCTGCCGCCCAGG - Intronic
915370508 1:155345855-155345877 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
915475285 1:156149628-156149650 GCGGTCCAGCTGTGTCGCCCCGG + Intronic
915956658 1:160225867-160225889 GGGGTCCTGCTCTGTCACCCAGG + Intronic
916231493 1:162545269-162545291 GGAGTCATGCTCTGCCGCCCAGG - Intergenic
917341377 1:173981872-173981894 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
917357476 1:174141804-174141826 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
917423123 1:174885939-174885961 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
917863318 1:179169520-179169542 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
918621901 1:186614831-186614853 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
918629540 1:186699519-186699541 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
918806700 1:189055832-189055854 GGGTTCTTGCTCTGTCGCCCAGG - Intergenic
918995317 1:191751865-191751887 GAAATCCTGCTCTGTCGCCCAGG + Intergenic
919073716 1:192789039-192789061 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
919092559 1:192992642-192992664 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
919596130 1:199564989-199565011 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
919616546 1:199815207-199815229 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
919679091 1:200416739-200416761 GCAGTCTTGCTCTGCCGCCCAGG + Intergenic
919959891 1:202456241-202456263 GGATTCTTGCTCTGTCGCCCAGG - Intronic
919961205 1:202470878-202470900 GAGGTCTTGCTCTGCCACCCAGG - Intronic
920121220 1:203660054-203660076 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
920272818 1:204779112-204779134 GGGGTCTTTCTCTGCCGCCCAGG - Intergenic
920304669 1:205010875-205010897 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
920419760 1:205824750-205824772 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
920611876 1:207448829-207448851 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
920639578 1:207739153-207739175 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
920928578 1:210365953-210365975 GTGATCCTGCTCTGTCACCCAGG + Intronic
920937631 1:210450263-210450285 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
921796782 1:219354220-219354242 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
921870969 1:220139557-220139579 AGGTTCCTGCTCTGTTGCCCAGG - Intronic
922289097 1:224195571-224195593 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
922506118 1:226126760-226126782 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
922598048 1:226828843-226828865 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
922652914 1:227356447-227356469 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
922847611 1:228700893-228700915 GGGGTCCTGCTCTGTTGCCCAGG - Intergenic
922851816 1:228739093-228739115 GGGATCTTGCTCTGTCGCCCAGG - Intronic
923077991 1:230626831-230626853 GAGTTCTTGCTGTGCCTCCCAGG - Intergenic
923533280 1:234828617-234828639 GTCTTCCTGCTCTGTTGCCCAGG - Intergenic
923632901 1:235665584-235665606 GAGTCTCTGCTCTGTCGCCCAGG - Intronic
923775517 1:236974844-236974866 GGGGTCCTGCTCTGTCACCCAGG - Intergenic
924014448 1:239705179-239705201 GGGGTCTTGCTCTGCTGCCCAGG - Intronic
924060275 1:240167094-240167116 GGAGTCCTGCTCTGCCACCCAGG - Intronic
924249046 1:242113113-242113135 GGATTCTTGCTCTGTCGCCCAGG + Intronic
924529522 1:244881655-244881677 GGGTTCCTGCTCTACCTCCAGGG - Intergenic
924630644 1:245737123-245737145 AGGTTCCTGCTCTGTCACCCAGG + Intergenic
924752852 1:246911957-246911979 GGATTCTTGCTCTGTCGCCCAGG + Intronic
924810749 1:247399861-247399883 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1063017289 10:2091357-2091379 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1063088938 10:2844145-2844167 GAGTTTTTGCTCTGTCGCCCAGG - Intergenic
1063232110 10:4075433-4075455 AGGTTCTTGCTCTGCTGCCCAGG - Intergenic
1063365513 10:5488052-5488074 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1063503296 10:6574088-6574110 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1063593346 10:7411887-7411909 GCGTTCCTCCCCAGGCGCCCGGG - Intergenic
1063635542 10:7778711-7778733 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1063656267 10:7993202-7993224 GAGTTCTTACTCTGTCGCCCAGG + Intronic
1063751898 10:8958647-8958669 GAGTTCTTACTCTGTCGCCCAGG - Intergenic
1063762379 10:9094977-9094999 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1063774226 10:9242876-9242898 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1064055823 10:12096409-12096431 ACGGTCTTGCTCTGTCGCCCAGG + Intronic
1064057882 10:12113221-12113243 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1064427295 10:15241005-15241027 GGGGTCCTGCTCTGTCACCCAGG - Intronic
1064538912 10:16386534-16386556 ACGGTCTTGCTCTGTCGCCCAGG - Intergenic
1064601193 10:16995063-16995085 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1064771053 10:18723231-18723253 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1064805949 10:19132959-19132981 GAATTCATGCTCTGTCGCCCAGG + Intronic
1065323262 10:24528345-24528367 GGGGTCTTGCTCTGCCACCCAGG + Intronic
1065504441 10:26415152-26415174 ACAGTCCTGCTCTGTCGCCCAGG - Intergenic
1065514476 10:26511316-26511338 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1065547805 10:26839468-26839490 AGGGTCCTGCTCTGTCGCCCAGG - Intronic
1065583485 10:27194584-27194606 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1065768982 10:29059137-29059159 GAGTTCTTGCTCTGTCACCCAGG - Intergenic
1065820069 10:29517219-29517241 GGGGTCTTGCTCTGCGGCCCAGG - Intronic
1065834505 10:29644643-29644665 GGAATCTTGCTCTGCCGCCCAGG - Intronic
1066067329 10:31771906-31771928 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1066102486 10:32130153-32130175 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1066113825 10:32221870-32221892 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1066179327 10:32944319-32944341 ACTTACCTTCTCTGCCGCCCAGG - Intronic
1066268078 10:33795893-33795915 GAGTTCTTGCTCTGTGGCCCAGG + Intergenic
1066321277 10:34306253-34306275 ACATTCTTGCTCTGTCGCCCAGG - Intronic
1066385055 10:34934845-34934867 GCAGTCTTGCTCTGTCGCCCGGG - Intergenic
1066624608 10:37393530-37393552 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1066720487 10:38332116-38332138 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1066750054 10:38645733-38645755 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1067114170 10:43422070-43422092 GGGGTCCTGCTCTGTCACCCAGG - Intergenic
1067363177 10:45600839-45600861 GCCTGCCGGCCCTGCCGCCCCGG + Intergenic
1067455757 10:46418410-46418432 TCCTTCCTGCTCTTCCGCCACGG + Intergenic
1067464020 10:46480600-46480622 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1067489945 10:46689210-46689232 AGGGTCTTGCTCTGCCGCCCAGG + Intergenic
1067604721 10:47651172-47651194 AGGGTCTTGCTCTGCCGCCCAGG - Intergenic
1067623175 10:47904051-47904073 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1067631445 10:47966229-47966251 TCCTTCCTGCTCTTCCGCCACGG - Intergenic
1067699005 10:48555428-48555450 ACCTTCCAGCTCTGCAGCCCTGG - Intronic
1067871045 10:49961623-49961645 GCGGTCTTGCTCTGTCACCCAGG + Intronic
1068362299 10:55993860-55993882 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1068406793 10:56600242-56600264 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1068467662 10:57416203-57416225 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
1068546989 10:58358784-58358806 GCGGTCTTGCTCTGTCACCCAGG + Intronic
1069051136 10:63796059-63796081 GAAGTCCTGCTCTGTCGCCCAGG + Intergenic
1069133203 10:64731728-64731750 GAGATCTTGCTCTGTCGCCCAGG - Intergenic
1069621620 10:69840900-69840922 CCCTTCCAGCTCTGGCGCCCGGG - Intronic
1069675251 10:70241709-70241731 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1069692839 10:70365083-70365105 GAAGTCTTGCTCTGCCGCCCAGG + Intronic
1069850873 10:71404064-71404086 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
1069966612 10:72123311-72123333 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1070117149 10:73540079-73540101 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1070162459 10:73874352-73874374 CCCTGCCTGCCCTGCCGCCCGGG - Intronic
1070252720 10:74787165-74787187 GCAGCCGTGCTCTGCCGCCCAGG + Intergenic
1070269655 10:74940606-74940628 AAGTTCTTGCTCTGTCGCCCAGG + Intronic
1070279701 10:75039488-75039510 GCAGTCTTGCTCTGTCGCCCCGG - Intronic
1070302659 10:75215745-75215767 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1070616374 10:77972403-77972425 AGGTTCATGCTCTGTCGCCCAGG - Intronic
1071620275 10:87112607-87112629 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
1071828746 10:89351288-89351310 GGGTTTCTGCTCTGTTGCCCAGG - Intronic
1072130299 10:92487820-92487842 ACAGTCTTGCTCTGCCGCCCAGG + Intronic
1072151056 10:92684078-92684100 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1072335986 10:94399088-94399110 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1072562191 10:96586737-96586759 GTGTTCGTGCTCGTCCGCCCGGG + Exonic
1072939341 10:99745829-99745851 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1073142500 10:101257953-101257975 AAGTTCTTGCTCTGTCGCCCAGG + Intergenic
1073334282 10:102694011-102694033 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1074118993 10:110479289-110479311 GGGGTCTTGCTTTGCCGCCCAGG + Intergenic
1074367268 10:112869186-112869208 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1074448820 10:113542368-113542390 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1074498643 10:114002380-114002402 GCCTGCCTGCTCTTCCGCCTGGG + Intergenic
1074598398 10:114888626-114888648 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
1074601669 10:114920301-114920323 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1074666938 10:115738162-115738184 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1074796986 10:116956939-116956961 GGGTTCTTGCTCTGTCACCCAGG + Intronic
1074844356 10:117384214-117384236 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1074863148 10:117528456-117528478 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1075155098 10:119969270-119969292 GTCTTCTTGCTCTGTCGCCCAGG + Intergenic
1075334190 10:121597303-121597325 GCCTGCCTGCTCTGCCGCAGCGG - Intronic
1075603546 10:123788252-123788274 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1075644459 10:124088384-124088406 GCGTTTCTGCCCTGCAACCCTGG - Intronic
1075877333 10:125819008-125819030 GCAGTCCTGCTCTGTCGCCCAGG + Intronic
1076083642 10:127606080-127606102 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1076315269 10:129535368-129535390 GAGGTCTTGCTCTGCCACCCAGG - Intronic
1076456051 10:130597550-130597572 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1076554611 10:131312947-131312969 GGGTGCCTGCTCTCCCACCCAGG - Intergenic
1076737633 10:132465858-132465880 GTCTTCCTGCTCCGCCCCCCGGG - Intergenic
1076745101 10:132509023-132509045 GCGCACCTGCTCAGCAGCCCTGG - Intergenic
1076751200 10:132544252-132544274 GGGGCCCTGCTCTGCCGCTCCGG + Intronic
1077807228 11:5602415-5602437 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1078287297 11:9970230-9970252 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1079603714 11:22341506-22341528 TCGCCCCTGCTCTGCCGCGCAGG + Exonic
1079661726 11:23046115-23046137 GCGGTCTCGCTCTGTCGCCCAGG + Intergenic
1079708886 11:23655489-23655511 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1080367755 11:31596376-31596398 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1080436761 11:32252103-32252125 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1081235870 11:40646630-40646652 GGACTCTTGCTCTGCCGCCCAGG + Intronic
1081548952 11:44094879-44094901 GGGGTCTTGCTCTGCTGCCCAGG + Intergenic
1081638728 11:44738393-44738415 ACGTACCTGCTCTGCAGCCTTGG + Intronic
1081901531 11:46632969-46632991 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1081901540 11:46633048-46633070 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1082278961 11:50249054-50249076 GGGGTCCTGCTCTGTCACCCAGG - Intergenic
1082842003 11:57697435-57697457 GCGGTCTCGCTCTGCTGCCCAGG - Intronic
1083212054 11:61194220-61194242 GCCTTCCTGCCCTCCTGCCCTGG - Intergenic
1083443756 11:62693476-62693498 GAGATCTTGCTCTGTCGCCCAGG - Intronic
1083647792 11:64182903-64182925 GCTTTCCTTCCCTGCCTCCCAGG + Intergenic
1083761387 11:64820282-64820304 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1083786124 11:64948680-64948702 GGCATCTTGCTCTGCCGCCCAGG + Intronic
1083817414 11:65143282-65143304 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1083834914 11:65260357-65260379 ACGATCTTGCTCTGTCGCCCAGG + Intergenic
1083950801 11:65954790-65954812 GAGTTTTTGCTCTGTCGCCCAGG - Intronic
1084199175 11:67543840-67543862 AAGGTCTTGCTCTGCCGCCCAGG + Intergenic
1084525577 11:69695906-69695928 GGAGTCTTGCTCTGCCGCCCCGG + Intergenic
1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG + Exonic
1084615724 11:70234561-70234583 GGGGTCCTGCTCTGTCGCCCAGG + Intergenic
1084634316 11:70380549-70380571 ACAGTCCTGCTCTGTCGCCCAGG - Intronic
1084829221 11:71755959-71755981 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1085102421 11:73812687-73812709 GGGATCCTGCTCTGTCGCCCAGG - Intronic
1085414636 11:76311953-76311975 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1085426305 11:76407549-76407571 GGAGTCTTGCTCTGCCGCCCAGG - Exonic
1085503448 11:77041929-77041951 GCAGTCTTGCTCTGTCGCCCAGG - Exonic
1085637434 11:78169390-78169412 ACATTCTTGCTCTGTCGCCCAGG + Intergenic
1086122650 11:83317157-83317179 GCGCCTCTGCCCTGCCGCCCCGG - Intergenic
1086230405 11:84562773-84562795 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
1087357683 11:97115885-97115907 GGAGTCCTGCTCTGCCACCCAGG + Intergenic
1087775718 11:102254890-102254912 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1087836721 11:102882280-102882302 GGGTTCCAGCTCTGTCACCCAGG - Intergenic
1088182734 11:107130191-107130213 GGGGTCCTGCTCCGTCGCCCAGG + Intergenic
1088300157 11:108349635-108349657 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
1088374113 11:109121270-109121292 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1088470389 11:110183351-110183373 GCGTTCTTGCTCTGTCACCCAGG + Intronic
1088641211 11:111874733-111874755 GGAGTCTTGCTCTGCCGCCCAGG - Exonic
1088661871 11:112055267-112055289 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1088876907 11:113943785-113943807 CCGTTCTTGCTCTGTCACCCAGG - Intronic
1088927714 11:114319266-114319288 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
1089419669 11:118322200-118322222 GCGGTCTTGCTCTGTCACCCAGG + Intergenic
1089425488 11:118370593-118370615 TCTTTCTTGCTCTGTCGCCCAGG - Intronic
1089470138 11:118714044-118714066 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1090060702 11:123461990-123462012 GGGATCTTGCTCTGTCGCCCAGG + Intergenic
1090286454 11:125503611-125503633 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1090931006 11:131298051-131298073 GTGTACCTGCTGTGCCCCCCTGG + Intergenic
1091161211 11:133422524-133422546 GGGGTCCTGCTCTACCGCCCAGG + Intronic
1091256380 11:134190510-134190532 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
1091438841 12:496901-496923 AGGGTCTTGCTCTGCCGCCCAGG + Intronic
1091474664 12:760789-760811 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1091482127 12:844155-844177 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1091489452 12:920189-920211 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1092029183 12:5269686-5269708 GAGTTTCTCTTCTGCCGCCCAGG + Intergenic
1092122962 12:6057338-6057360 ACGGTCTTGCTCTGTCGCCCGGG + Intronic
1092373680 12:7937694-7937716 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1092391801 12:8086586-8086608 GCAGTCCTGCTCTGTCGCCTAGG - Intronic
1092480265 12:8853181-8853203 GCGGTCTTGCTCTGTTGCCCAGG + Intronic
1092798297 12:12136159-12136181 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1092846857 12:12591576-12591598 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1092912521 12:13159870-13159892 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1093111654 12:15159796-15159818 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1093508885 12:19903393-19903415 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1093564851 12:20589841-20589863 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1093567555 12:20626519-20626541 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1093591030 12:20903046-20903068 GGAATCCTGCTCTGTCGCCCAGG - Intronic
1093733554 12:22593079-22593101 TCGGTCTTGCTCTGTCGCCCAGG + Intergenic
1093790830 12:23248255-23248277 GGGTTCTTGCTCTGCTGTCCAGG - Intergenic
1094411067 12:30169559-30169581 GCGTTCCAGCTCTGCACCCAGGG + Intergenic
1094539931 12:31354787-31354809 GGGTTCTTGCTCTGTCACCCAGG - Intergenic
1094676858 12:32628758-32628780 ACGGTCTTGCTCTGTCGCCCAGG - Intronic
1094841454 12:34344241-34344263 CCGACCCTGCTCTGCCGCGCCGG + Intergenic
1095436662 12:42196199-42196221 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1096133298 12:49178444-49178466 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1096329821 12:50701406-50701428 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1096483959 12:51964164-51964186 GGGTTCTTGCTCTGTCACCCAGG + Intronic
1096562355 12:52445696-52445718 GAGTTCTTGCTCTGTTGCCCAGG + Intergenic
1096697437 12:53358818-53358840 ACGGTCTTGCTCTGTCGCCCAGG - Intergenic
1096707635 12:53432400-53432422 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1096977803 12:55709371-55709393 GGGTTCTTACTCTGCTGCCCTGG + Intronic
1097181531 12:57174737-57174759 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1097449144 12:59714588-59714610 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1097475593 12:60051671-60051693 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1097671068 12:62539337-62539359 GGGTCACTGCTCTGCCTCCCAGG + Intronic
1097831802 12:64232922-64232944 GGGATCTTGCTCTGTCGCCCAGG + Intergenic
1098054914 12:66494853-66494875 TCCTTCCTGCTCTGTCACCCTGG - Intronic
1098107674 12:67087086-67087108 GGGATCTTGCTCTGTCGCCCAGG - Intergenic
1098243130 12:68488382-68488404 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1098279140 12:68845787-68845809 GCGGTCTTGCTCTGTCGCCCAGG + Exonic
1098309484 12:69134130-69134152 AAGTTCCTGCTCTGTTGCCCAGG - Intergenic
1098342239 12:69464147-69464169 AGGTTCTTGCTCTGCCACCCAGG - Intergenic
1098431588 12:70425410-70425432 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1098434829 12:70457628-70457650 GGGGTCCTGCTCTGTTGCCCAGG - Intergenic
1098647119 12:72917159-72917181 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1098790066 12:74810757-74810779 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1098950681 12:76637583-76637605 GCAGTCCTGCTCTGTTGCCCAGG + Intergenic
1098963328 12:76761904-76761926 TCTTTCTTGCTCTGCGGCCCAGG - Intergenic
1099904488 12:88756076-88756098 GCGGTCTTGCTCTGTTGCCCAGG - Intergenic
1100327402 12:93552249-93552271 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1100413398 12:94346074-94346096 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
1100487457 12:95044291-95044313 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1100496280 12:95128259-95128281 GGGGTCCTGCTGTGTCGCCCAGG + Intronic
1100817590 12:98400888-98400910 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1100840119 12:98604523-98604545 GGGTTCTTGCTTTGTCGCCCAGG + Intronic
1100854753 12:98749122-98749144 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1101103270 12:101416470-101416492 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1101285041 12:103302559-103302581 GCTTTCCTGCTTTGCCTTCCAGG - Exonic
1101452035 12:104788605-104788627 GGATTCCTGCTCTGTCCCCCAGG - Intergenic
1101892036 12:108725834-108725856 GGATTCTTTCTCTGCCGCCCAGG + Intronic
1101897767 12:108768971-108768993 GCGTCCCTGCCCTGCCCCCTGGG + Intergenic
1101935107 12:109050962-109050984 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1102007169 12:109596322-109596344 GCCTTCCTGCTGTGCCTTCCTGG - Intronic
1102023349 12:109699101-109699123 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1102268475 12:111508470-111508492 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1102282640 12:111630369-111630391 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1102316823 12:111895120-111895142 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1102537749 12:113593783-113593805 AAGGTCTTGCTCTGCCGCCCAGG + Intergenic
1102886939 12:116529462-116529484 GAGTTTTTGCTCTGTCGCCCAGG + Intergenic
1102967180 12:117137062-117137084 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1103042370 12:117706067-117706089 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1103111057 12:118278830-118278852 GCTGTCTTGCTCTGTCGCCCAGG + Intronic
1103122984 12:118396279-118396301 GGGGTCTTGCTCTGCCACCCAGG + Intronic
1103285453 12:119797327-119797349 GCGTGCCTGCCTTGCAGCCCTGG - Intronic
1103326295 12:120123316-120123338 AGGGTACTGCTCTGCCGCCCAGG - Intergenic
1103338190 12:120205641-120205663 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1103354576 12:120310338-120310360 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1103389906 12:120564576-120564598 ATGGTCTTGCTCTGCCGCCCAGG - Intronic
1103406809 12:120681503-120681525 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1103527804 12:121579375-121579397 GCTTCCCGGCTCTGCCGCCGCGG - Intronic
1103628658 12:122241329-122241351 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1104046761 12:125168616-125168638 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1104069511 12:125331777-125331799 GCGGTGTTGCTCTGTCGCCCAGG + Intronic
1104121708 12:125806205-125806227 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1104457937 12:128931025-128931047 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1104670070 12:130674448-130674470 GCCATCCTGCTCTGTCCCCCAGG - Intronic
1104729643 12:131097840-131097862 GAGTTCCTGCTCTTGTGCCCGGG + Intronic
1104746548 12:131214596-131214618 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1104965383 12:132506727-132506749 GAGTTCCTGCTCGCCCACCCAGG - Intronic
1104986350 12:132599664-132599686 AAGTTCCTGCTCTGTTGCCCAGG + Intergenic
1104991794 12:132628615-132628637 GCCTCCTTGCTCTGTCGCCCAGG - Intronic
1105025449 12:132845622-132845644 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1105349925 13:19605830-19605852 GGGTTTCTGCTGTGCTGCCCAGG - Intergenic
1105449988 13:20490929-20490951 AGGATCCTGCTCTGTCGCCCAGG + Intronic
1105673323 13:22643915-22643937 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1105730475 13:23210663-23210685 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1105777872 13:23679913-23679935 AGGTTCTTGCTCTGCTGCCCAGG - Intergenic
1105827519 13:24135670-24135692 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1106150345 13:27094474-27094496 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1106216800 13:27708900-27708922 TCGTTCCGGTTCTGCCTCCCTGG + Intergenic
1106521375 13:30500747-30500769 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1106838588 13:33662234-33662256 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1106841780 13:33691805-33691827 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1107005212 13:35601734-35601756 GGAGTCCTGCTCTGCCACCCAGG - Intronic
1107035548 13:35898765-35898787 AGGGTCCTGCTCTGTCGCCCAGG + Intronic
1107303185 13:38987464-38987486 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1107590052 13:41893856-41893878 GTATTCTTGCTCTGTCGCCCAGG - Intronic
1107621292 13:42233103-42233125 GGGGTCTTGCTCTGCTGCCCAGG - Intronic
1107842507 13:44473467-44473489 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1107937280 13:45355857-45355879 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1108352313 13:49598629-49598651 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1108507141 13:51122506-51122528 CAGTTCTTGCTCTGTCGCCCAGG - Intergenic
1108510624 13:51152539-51152561 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
1108683694 13:52800870-52800892 GGAGTCCTGCTCTGCCACCCAGG - Intergenic
1108763789 13:53602043-53602065 GTGGTCTTGCTCTGCTGCCCAGG - Intergenic
1109127822 13:58540411-58540433 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1109191694 13:59332000-59332022 GGGGTCTTGCTCTGCTGCCCAGG - Intergenic
1109436166 13:62306106-62306128 GAGTTCTTGCTCTGTCACCCAGG - Intergenic
1110295973 13:73866227-73866249 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1110444807 13:75567571-75567593 GCAGTCTCGCTCTGCCGCCCAGG + Intronic
1110959730 13:81606492-81606514 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1111689372 13:91542880-91542902 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1111813685 13:93123683-93123705 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1111824119 13:93246764-93246786 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
1111943198 13:94635871-94635893 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1111943603 13:94639794-94639816 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1111982330 13:95030044-95030066 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1112016841 13:95338213-95338235 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1112097560 13:96151376-96151398 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1112213080 13:97400938-97400960 GCGGTCTTGCTCTGTTGCCCAGG + Intergenic
1112284743 13:98094359-98094381 AGGGTCTTGCTCTGCCGCCCAGG + Intergenic
1112332779 13:98489476-98489498 GCGTTCCCCCTCAGCCACCCTGG - Intronic
1112920446 13:104605178-104605200 GGGTTCTTGCTCTGTCTCCCAGG - Intergenic
1113473111 13:110561062-110561084 GCGTTCCTGCTCTGCCGCCCTGG - Intronic
1113678907 13:112228659-112228681 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1113867264 13:113535055-113535077 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1114039599 14:18664552-18664574 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1114263146 14:21053599-21053621 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1114448402 14:22807538-22807560 GGGTTCTTGCTCTGTCGCCCAGG - Intronic
1114507189 14:23226269-23226291 GGTTTCTTGCTCTGTCGCCCAGG - Intronic
1115014428 14:28593178-28593200 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1115209050 14:30946349-30946371 GGGTTCTTGCTCTGTTGCCCAGG - Intronic
1115317995 14:32046312-32046334 AAGGTCCTGCTCTGCCACCCAGG - Intergenic
1115589873 14:34853759-34853781 GGGGTCTTGCTCTGTCGCCCTGG - Intronic
1115610940 14:35047975-35047997 GGGTTCTTGCTCTGTTGCCCAGG - Intronic
1115728192 14:36239633-36239655 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1115856760 14:37638278-37638300 GGATTCTTGCTCTGCCGCCCAGG + Intronic
1116114516 14:40629902-40629924 GCCGGCCCGCTCTGCCGCCCCGG - Intergenic
1116266551 14:42698582-42698604 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1116270723 14:42762087-42762109 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1116838219 14:49792240-49792262 GAGTTCTTGCTCTGTCACCCAGG + Intronic
1116874126 14:50094485-50094507 AAGTTCGTGCTCTGTCGCCCAGG + Intergenic
1116904438 14:50391406-50391428 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1116917455 14:50538832-50538854 GGGTTCTTGCTCTGTTGCCCAGG + Intronic
1117085027 14:52191261-52191283 GGAGTCCTGCTCTGCCACCCAGG - Intergenic
1117141018 14:52791388-52791410 ACGGTCCTGCTCTCGCGCCCCGG + Intronic
1117396599 14:55316699-55316721 ATGTTCCTGCTCTGTTGCCCAGG - Intronic
1117584525 14:57186505-57186527 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1117943398 14:60992871-60992893 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1118171492 14:63393684-63393706 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1118269329 14:64327667-64327689 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1118360265 14:65050563-65050585 GCTATCTTGCTCTGTCGCCCAGG - Intronic
1118490098 14:66250497-66250519 AAGGTCTTGCTCTGCCGCCCAGG - Intergenic
1118800139 14:69182368-69182390 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1118972677 14:70650395-70650417 GGTGTCCTGCTCTGTCGCCCAGG - Intronic
1119207826 14:72807937-72807959 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1119221851 14:72915241-72915263 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1119239097 14:73043933-73043955 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1119241858 14:73067093-73067115 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1119284965 14:73446020-73446042 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1119314088 14:73676994-73677016 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1119385349 14:74254803-74254825 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1119508226 14:75191067-75191089 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1119526668 14:75328125-75328147 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1119587157 14:75847025-75847047 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1119746547 14:77048737-77048759 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1119823415 14:77638150-77638172 GGGATCTTGCTCTGTCGCCCAGG + Intergenic
1119854763 14:77891238-77891260 GCAATCCTGCTCTCCTGCCCTGG - Intronic
1120224712 14:81777812-81777834 GCGTCCCTGCTCTCCAGCCTGGG - Intergenic
1120238932 14:81926955-81926977 GGATTCTCGCTCTGCCGCCCAGG - Intergenic
1120427286 14:84364301-84364323 GGCTTCTTGCTCTGTCGCCCAGG - Intergenic
1120885534 14:89448916-89448938 GTGTTCTTGCTCTGTTGCCCAGG - Intronic
1120948996 14:90023715-90023737 AGGCTCTTGCTCTGCCGCCCAGG + Intronic
1120953195 14:90061083-90061105 GCGTTCCATCTCTTCCCCCCGGG - Intergenic
1120976916 14:90256886-90256908 GCTTTGCTGCTCCGCCGACCAGG + Intronic
1121074306 14:91054757-91054779 GGGTTCCTGCTATGTTGCCCAGG - Intronic
1121174160 14:91878010-91878032 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
1121284884 14:92727402-92727424 GCAGTCTTGCTCTGCCACCCAGG - Intronic
1121349757 14:93164080-93164102 GGGGTCATGCTCTGTCGCCCAGG - Intergenic
1121535608 14:94688709-94688731 GGGATCTTGCTCTGTCGCCCAGG + Intergenic
1121750612 14:96351708-96351730 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1121750994 14:96356143-96356165 GCATTCTTGCTCTGTCACCCAGG - Intronic
1121924923 14:97918732-97918754 GAGTTCTTGCTCTGTTGCCCAGG + Intergenic
1121973341 14:98379512-98379534 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1122348233 14:101073465-101073487 GCCTTCCTGCTCCACCGCCTGGG + Intergenic
1122390882 14:101382628-101382650 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1122550568 14:102546927-102546949 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1122622441 14:103067442-103067464 CAGGTCTTGCTCTGCCGCCCAGG + Intergenic
1122635365 14:103127236-103127258 GCGCTCCTGCTCCGCCACCACGG - Exonic
1122848267 14:104512706-104512728 AGGGTCCTGCTCTGTCGCCCAGG - Intronic
1122944785 14:105002479-105002501 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1122983335 14:105201357-105201379 CCGGCCCTGCACTGCCGCCCAGG + Intergenic
1122992452 14:105243422-105243444 GTCTTGCTGCTCTGTCGCCCAGG - Intronic
1123436006 15:20255047-20255069 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1123464321 15:20503580-20503602 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1123653742 15:22496841-22496863 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1123684713 15:22788471-22788493 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1123909291 15:24950885-24950907 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1123965285 15:25449732-25449754 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1124112149 15:26800720-26800742 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
1124253668 15:28123704-28123726 GCGGTCCTTCTCTGCCTGCCTGG - Intronic
1124275049 15:28319557-28319579 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1124307649 15:28592038-28592060 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1124366912 15:29078583-29078605 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1124402120 15:29357811-29357833 GCTCTCTTGCTCTGTCGCCCAGG - Intronic
1124829780 15:33137060-33137082 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1124899018 15:33805501-33805523 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1124957465 15:34368695-34368717 GCGCTCTTGCTCTGTTGCCCAGG + Intergenic
1125128060 15:36248002-36248024 GGGTTCTTGCTCTGCCACCCAGG - Intergenic
1125366822 15:38926539-38926561 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1125459089 15:39891382-39891404 GAGTTCTTGCTGTGTCGCCCAGG + Intronic
1125571229 15:40719804-40719826 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1125598953 15:40905213-40905235 GGGTTCTTGCTCTGTCACCCAGG - Intergenic
1125651704 15:41322422-41322444 AAGTTCTTGCTCTGTCGCCCAGG + Intronic
1125694554 15:41624271-41624293 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1125799074 15:42428787-42428809 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1126003079 15:44230287-44230309 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1126082824 15:44982522-44982544 GGGTTCTCGCTCTGTCGCCCAGG + Intergenic
1126182369 15:45798113-45798135 GGAATCCTGCTCTGTCGCCCAGG + Intergenic
1126665973 15:51076960-51076982 GCGTTCCTCCTCTCCCGTGCTGG + Intronic
1127089027 15:55448472-55448494 GGGGTCTTGCTCTGCTGCCCAGG - Intronic
1127306911 15:57715356-57715378 GGGGTCTTGCTCTGTCGCCCAGG + Exonic
1127347445 15:58114617-58114639 GAGTTCCTGCTCTGTCACCCAGG - Intronic
1127474779 15:59323141-59323163 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1127528913 15:59822568-59822590 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1127668662 15:61173679-61173701 GGGGTCCTGCTCTGCCACCCAGG + Intronic
1127729110 15:61781807-61781829 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1127909507 15:63404768-63404790 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1127966231 15:63924760-63924782 GGGTCCCTGCTCTGTCGCCAGGG - Intronic
1128008973 15:64272769-64272791 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1128941114 15:71788443-71788465 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1128981779 15:72193546-72193568 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1129196843 15:73973504-73973526 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1129201065 15:74000329-74000351 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1129358277 15:75007411-75007433 AGGGTCTTGCTCTGCCGCCCGGG + Intronic
1129781798 15:78277208-78277230 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1130293439 15:82624861-82624883 GGGGTCCTGCTCTGTCACCCAGG + Intronic
1130510050 15:84581855-84581877 GCGTTCCTGCCCGCCTGCCCGGG - Intergenic
1130958431 15:88643677-88643699 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1131020603 15:89094680-89094702 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1131126194 15:89859417-89859439 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1131214136 15:90522898-90522920 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1131254673 15:90854260-90854282 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1131637964 15:94257903-94257925 GGAATCATGCTCTGCCGCCCAGG + Intronic
1131648381 15:94371712-94371734 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1131943837 15:97597455-97597477 GCATTCCTGCTCTCCCTCCATGG + Intergenic
1132068250 15:98751224-98751246 GTGTTCTTGCTCTGTCACCCAGG + Intronic
1132252150 15:100341928-100341950 GCGCTCCTGCTTCGCCGCCACGG - Exonic
1132505500 16:306484-306506 GCCTTCCTGCCCTCCCGCCGTGG + Intronic
1132761923 16:1512762-1512784 GAGGTCTTGCTCTGTCGCCCAGG - Intronic
1132771431 16:1565601-1565623 GCTTTCCTGCCCTGCAGGCCTGG + Intronic
1132825876 16:1905146-1905168 AGGGTCTTGCTCTGCCGCCCAGG - Intergenic
1132895048 16:2224755-2224777 GGAGTCCGGCTCTGCCGCCCAGG - Intronic
1132930176 16:2455032-2455054 GTGTTCTTGCTCTGTCGCCCAGG - Intronic
1133008969 16:2899707-2899729 GAGTTCCTGCCCTGGCCCCCTGG + Intergenic
1133209614 16:4256226-4256248 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1133244424 16:4438289-4438311 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1133786619 16:8978712-8978734 AGGTTCTTGCTCTGCCGCCCAGG - Intergenic
1133998546 16:10765480-10765502 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1134061875 16:11204203-11204225 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1134079511 16:11315443-11315465 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1134155995 16:11843843-11843865 GAGTTCTTGCTCTGTCGCCCAGG - Intronic
1134228149 16:12408131-12408153 AGGGTCCTGCTCTGCCACCCAGG - Intronic
1134603234 16:15549973-15549995 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1134608358 16:15588760-15588782 GCGATCTTGCTCTGTTGCCCAGG - Intronic
1134649159 16:15894775-15894797 GGGGTCTTGCTCTGCTGCCCAGG - Intergenic
1135022312 16:18973025-18973047 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1135042420 16:19128071-19128093 TCTTTCTTGCTCTGTCGCCCAGG + Intronic
1135188917 16:20338518-20338540 GGGGTCTTGCTCTGCCACCCAGG + Intronic
1135190393 16:20349447-20349469 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1135402750 16:22177600-22177622 GGAATCTTGCTCTGCCGCCCAGG - Intronic
1135696719 16:24594395-24594417 ACAGTCCTGCTCTGCCCCCCAGG + Intergenic
1135732358 16:24905594-24905616 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1135809381 16:25573766-25573788 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1135844792 16:25909212-25909234 GGGCTCTTGCTCTGCAGCCCAGG + Intronic
1135983663 16:27168068-27168090 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1136074770 16:27809375-27809397 GCGTTCTTGCTATGTTGCCCAGG - Intronic
1136103581 16:28012869-28012891 GAGTTCTTGCTCTGTTGCCCAGG - Intronic
1136347652 16:29686520-29686542 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1136448594 16:30339258-30339280 GCGTTCTTGCTATGTTGCCCAGG - Intergenic
1136590996 16:31217638-31217660 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1136592937 16:31228595-31228617 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1136605906 16:31333547-31333569 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1136614654 16:31390508-31390530 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1136696544 16:32085595-32085617 GGCTTCTTGCCCTGCCGCCCCGG - Intergenic
1136732653 16:32431351-32431373 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1136797045 16:33028879-33028901 GGCTTCTTGCCCTGCCGCCCCGG - Intergenic
1136848597 16:33595940-33595962 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1136929273 16:34404567-34404589 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1136975301 16:35007238-35007260 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1137084488 16:36102447-36102469 GGCTTCTTGCCCTGCCGCCCCGG - Intergenic
1137295247 16:47086078-47086100 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1137351568 16:47718258-47718280 GGGTTCCTGCTCTGGGGCCCAGG + Intergenic
1137641434 16:50033836-50033858 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1138378360 16:56582642-56582664 ACGGTCTTGCTCTGCCACCCAGG - Intergenic
1138507765 16:57486592-57486614 GCGATTCTGCCCTGGCGCCCTGG + Intronic
1138528475 16:57622095-57622117 GGGATCCTGCTCTGTCACCCAGG - Intronic
1138592505 16:58009697-58009719 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1138603742 16:58073804-58073826 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1138982863 16:62292282-62292304 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1139235812 16:65337592-65337614 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1139395273 16:66633790-66633812 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1139626359 16:68192180-68192202 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1139705044 16:68735534-68735556 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1139719055 16:68838267-68838289 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1140390419 16:74581867-74581889 GCGTTACTGCACTCCAGCCCAGG + Intronic
1140413773 16:74758732-74758754 GGGTTCTTGCTCTGTGGCCCAGG - Intronic
1140470511 16:75211534-75211556 GGAGTCCTGCTCTGCCACCCAGG - Intergenic
1140720090 16:77763808-77763830 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1140737212 16:77908886-77908908 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1140758354 16:78089114-78089136 ACGGTCTTGCTCTGTCGCCCAGG - Intergenic
1140889815 16:79275318-79275340 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1141499741 16:84435799-84435821 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1141532476 16:84656293-84656315 GAGTTCTTGCTCTGTCTCCCAGG + Intronic
1141681174 16:85544859-85544881 GCGGTCCTGTTCTGCTGCCTGGG - Intergenic
1141851734 16:86650753-86650775 GAGGTCTTGCTCTGCTGCCCAGG + Intergenic
1141867151 16:86758301-86758323 GGAATCTTGCTCTGCCGCCCAGG + Intergenic
1141983950 16:87567576-87567598 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1142351269 16:89581668-89581690 GGGTTCTCACTCTGCCGCCCAGG + Intronic
1142386325 16:89767391-89767413 ACAGTCTTGCTCTGCCGCCCAGG + Intronic
1203020429 16_KI270728v1_random:398251-398273 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1203038764 16_KI270728v1_random:671409-671431 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1203110304 16_KI270728v1_random:1444589-1444611 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1142477110 17:194997-195019 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1142479491 17:209779-209801 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1142628293 17:1206414-1206436 AGGTTCTTGCTCTGCCACCCAGG + Intronic
1142649023 17:1334399-1334421 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1142665097 17:1458260-1458282 GGATTCCTGCTCTGTTGCCCAGG + Intronic
1142687960 17:1588670-1588692 GGGGTCTTGCTCTGCCACCCAGG - Intronic
1142702489 17:1672303-1672325 GAGTTTTTGCTCTGTCGCCCAGG + Intronic
1142718055 17:1758140-1758162 ACGGTCTTGCTCTGTCGCCCAGG + Intergenic
1142747013 17:1964704-1964726 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1142754900 17:2010577-2010599 GGGGTCTTGCTCTGCCACCCAGG + Intronic
1142776218 17:2141465-2141487 GCGGTCTTGCTCTGTCACCCAGG + Intronic
1142999011 17:3779351-3779373 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1143129757 17:4670692-4670714 GGACTCCTGCTCTGTCGCCCAGG - Intergenic
1143681413 17:8478754-8478776 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1143759291 17:9089387-9089409 GGAATCTTGCTCTGCCGCCCAGG - Intronic
1143971493 17:10799221-10799243 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1144053438 17:11517526-11517548 GGGTTCTTGCTCTGTCACCCAGG + Intronic
1144299325 17:13908859-13908881 GGGTTCCTGCTCTGTTACCCAGG - Intergenic
1144415320 17:15041167-15041189 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1144559406 17:16309264-16309286 GCGTTCCTGCTCTGCCATGCAGG - Intronic
1144732185 17:17534795-17534817 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1144799711 17:17917306-17917328 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1144845367 17:18215241-18215263 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1144854255 17:18259191-18259213 GTCTTCTTGCTCTGCTGCCCAGG + Intergenic
1144901652 17:18598523-18598545 GCGGTCTCGCTCTGTCGCCCAGG - Intergenic
1144969281 17:19097420-19097442 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1144978635 17:19154645-19154667 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1144989587 17:19223587-19223609 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1145234913 17:21201645-21201667 AGGTTCCTGCTCTGTCACCCAGG + Intronic
1145821919 17:27844716-27844738 GAGTTCTCGCTCTGTCGCCCGGG - Intronic
1146024189 17:29305467-29305489 GTGGTCTTGCTCTGTCGCCCAGG - Intergenic
1146165111 17:30582486-30582508 GGGGTCTTGCTCTGCCACCCAGG + Intergenic
1146181563 17:30701739-30701761 AGGGTCTTGCTCTGCCGCCCAGG + Intergenic
1146201127 17:30859755-30859777 GGCGTCTTGCTCTGCCGCCCAGG + Intronic
1146439336 17:32880200-32880222 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1146767392 17:35535679-35535701 GGATTCTTGCTCTGCCGCCAAGG + Intronic
1147141205 17:38461495-38461517 GCCTTCCTGCTCTGCCACTGGGG + Intronic
1147165348 17:38590259-38590281 ACAGTCCTGCTCTGTCGCCCAGG + Intronic
1147303218 17:39546203-39546225 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1147423848 17:40336099-40336121 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1147428728 17:40358342-40358364 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1147436679 17:40420758-40420780 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1147590673 17:41681390-41681412 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1147593155 17:41698563-41698585 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1147603784 17:41762414-41762436 GGGTTCTTGCTCTGTCACCCAGG + Intronic
1147607188 17:41780667-41780689 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1147622039 17:41874597-41874619 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1147637033 17:41970423-41970445 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1147643687 17:42020759-42020781 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1147696657 17:42360032-42360054 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1147820447 17:43238398-43238420 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147822559 17:43250290-43250312 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147825076 17:43265085-43265107 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147828196 17:43282605-43282627 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147829306 17:43288769-43288791 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147830396 17:43294904-43294926 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147912627 17:43865272-43865294 GAGTTTTTGCTCTGTCGCCCAGG + Intergenic
1147982132 17:44281164-44281186 GGACTCTTGCTCTGCCGCCCAGG - Intergenic
1148096981 17:45059212-45059234 GCTCTCTTGCTCTGTCGCCCAGG - Intronic
1148100666 17:45088726-45088748 GCATTCTTGCTCTGCTGCCCAGG - Intronic
1148133370 17:45275785-45275807 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
1148149363 17:45387324-45387346 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1148433505 17:47662548-47662570 GTCTTCTTGCTCTGTCGCCCTGG - Intronic
1148636869 17:49155747-49155769 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1148746155 17:49919693-49919715 GCGTTCCTGCATTCCCTCCCAGG + Intergenic
1148913814 17:50957769-50957791 GGGATCTTGCTCTGTCGCCCAGG + Intergenic
1148962212 17:51402787-51402809 GGGGTCTTGCTCTGCTGCCCAGG + Intergenic
1149548283 17:57520677-57520699 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1149652795 17:58287083-58287105 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1149747466 17:59113195-59113217 GAGGTCTTGCTCTGCTGCCCAGG - Intronic
1149913654 17:60588711-60588733 GAATTCTTGCTCTGTCGCCCAGG + Intergenic
1150066689 17:62115940-62115962 AAGTTCCTGCTCTGTCGCCCAGG - Intergenic
1150150288 17:62803543-62803565 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1150262250 17:63803670-63803692 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1150351824 17:64451167-64451189 GAGTCTCTGCTCTGTCGCCCAGG + Intronic
1150627244 17:66849382-66849404 GCGTTCCTGCCCTGCCTTCCTGG - Intronic
1150701167 17:67447969-67447991 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1150742078 17:67787449-67787471 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1151058209 17:71058630-71058652 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1151113179 17:71703407-71703429 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1151211295 17:72546458-72546480 GCTGTCTTGCTCTGTCGCCCAGG + Intergenic
1151314991 17:73316458-73316480 GGATTCTTGCTCTGACGCCCAGG + Intergenic
1151614621 17:75201307-75201329 GGAGTCGTGCTCTGCCGCCCAGG + Intergenic
1151738927 17:75965805-75965827 GGGTTCTTGCTCTGCTGCCCAGG - Intronic
1152391400 17:80006004-80006026 GCCTACCTGCTCTGCCCTCCGGG + Intronic
1152440195 17:80303587-80303609 ACAGTCCTGCTCTGTCGCCCAGG + Intronic
1152543919 17:80991390-80991412 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1152550064 17:81025030-81025052 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1152559981 17:81073066-81073088 GGGTACCTGCTCTGGGGCCCTGG + Intronic
1152796936 17:82312731-82312753 GGGGTCTTGCTCTGCCACCCAGG + Intergenic
1152852139 17:82643405-82643427 GGGATCTTGCTCTGTCGCCCAGG - Intronic
1153048379 18:877464-877486 ACGGTCCTGCTCTGTCACCCAGG - Intergenic
1153294586 18:3533598-3533620 GGGTTCTTGCTCTGTCACCCAGG + Intronic
1153563695 18:6398149-6398171 CAGGTCTTGCTCTGCCGCCCAGG - Intronic
1153570487 18:6467390-6467412 ACGGTCTTGCTCTGCTGCCCAGG + Intergenic
1153683820 18:7525955-7525977 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1153788666 18:8557498-8557520 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1153855790 18:9145146-9145168 GGGTTCTTGCTCTGTTGCCCAGG + Intronic
1153945644 18:10014817-10014839 ACGGTCTTGCTCTGCCGCCCAGG - Intergenic
1154140283 18:11817625-11817647 GATTTCTTGCTCTGTCGCCCAGG + Intronic
1154245288 18:12691739-12691761 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1154998712 18:21666055-21666077 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1155017793 18:21863003-21863025 GAGTCCTTGCTCTGTCGCCCAGG + Intronic
1155107788 18:22684776-22684798 ACGGTCTTGCTCTGTCGCCCAGG - Intergenic
1155215084 18:23636161-23636183 AGGGTCCTGCTCTGTCGCCCAGG + Intronic
1155656615 18:28200664-28200686 GAGTTCTTGCTCTGTCGCCCAGG - Intergenic
1156236789 18:35213434-35213456 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
1156585113 18:38423515-38423537 ACGTTCTTGCTCTGTCACCCAGG + Intergenic
1156748892 18:40426274-40426296 GCGCTACTGCTCTCCAGCCCGGG - Intergenic
1156988694 18:43380085-43380107 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1157195910 18:45619963-45619985 GCCTCCCTGCTCTGCCACTCGGG - Intronic
1157364476 18:47051232-47051254 GCGGTCTTGCTGTGCTGCCCAGG - Intronic
1157373998 18:47146202-47146224 ACATTCTTGCTCTGTCGCCCAGG - Intronic
1157710594 18:49847281-49847303 TCTTTCCTGCTCAGCTGCCCAGG - Exonic
1157998825 18:52592657-52592679 GCTTTCTTGCTCTGTTGCCCAGG + Intronic
1158133601 18:54181523-54181545 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1158716793 18:59887791-59887813 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
1158809480 18:61015617-61015639 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1158959616 18:62578790-62578812 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1158991116 18:62869911-62869933 GGGCTCTTGCTCTGTCGCCCAGG + Intronic
1159333057 18:67026838-67026860 GGTGTCTTGCTCTGCCGCCCAGG + Intergenic
1160615954 18:80128622-80128644 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1160950840 19:1666561-1666583 AAGTTCTTGCTCTGTCGCCCAGG + Intergenic
1160977237 19:1799115-1799137 GGGGTCTTGCTCTGCCGCCCAGG - Intronic
1161118703 19:2513242-2513264 GGGTTCCTGGACGGCCGCCCAGG - Exonic
1161148114 19:2691839-2691861 GCAATCTTGCTCTGCTGCCCAGG - Intronic
1161206586 19:3044443-3044465 GGATTCCCGCTCTGTCGCCCAGG + Intronic
1161265331 19:3361015-3361037 GCGCTCTTCCTCCGCCGCCCAGG - Intronic
1161306266 19:3570463-3570485 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1161329656 19:3680328-3680350 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1161366744 19:3884259-3884281 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1161435323 19:4259403-4259425 GGGGTTTTGCTCTGCCGCCCAGG + Intronic
1161638795 19:5406690-5406712 GGGGTCTTGCTCTGCCACCCAGG - Intergenic
1161794419 19:6378253-6378275 GCATTCCTGCTCGGCAGCCAAGG + Intronic
1161869349 19:6858241-6858263 GAGTTCTTGCTCTGTCACCCAGG - Intergenic
1161905963 19:7156812-7156834 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1161969400 19:7568419-7568441 GGTGTCCTGCTCTGTCGCCCAGG - Intergenic
1162148113 19:8625935-8625957 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1162318920 19:9959466-9959488 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1162455926 19:10784680-10784702 GGGTCCCTGCCCTGCAGCCCTGG - Intronic
1162465689 19:10838382-10838404 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1162585592 19:11556323-11556345 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1162709737 19:12583834-12583856 ACATTCTTGCTCTGTCGCCCAGG + Intronic
1162828454 19:13269020-13269042 GTGGTCTTGCTCTGTCGCCCAGG + Intronic
1162847408 19:13403929-13403951 GCATTCTTGCTCTGTCACCCAGG - Intronic
1163014756 19:14447748-14447770 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1163096124 19:15058467-15058489 GAGATCTTGCTCTGCCACCCAGG + Intergenic
1163098499 19:15078725-15078747 ACGGTCCTGCTCTGTCACCCAGG - Intergenic
1163285667 19:16345938-16345960 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1163335796 19:16670911-16670933 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1163352839 19:16789741-16789763 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1163363193 19:16860939-16860961 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
1163429228 19:17257044-17257066 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1163435668 19:17293717-17293739 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1163453494 19:17392748-17392770 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1163569141 19:18069939-18069961 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1163606169 19:18276738-18276760 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1163665253 19:18600392-18600414 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1163749377 19:19066472-19066494 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1163798012 19:19348336-19348358 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1163842146 19:19618133-19618155 ACGGTCTTGCTCTGTCGCCCAGG - Intronic
1164590952 19:29506603-29506625 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1164594141 19:29522653-29522675 GAGTTCTTGCTCTGTTGCCCAGG - Intergenic
1164988339 19:32665785-32665807 GAGGTCTTGCTCTGCTGCCCAGG + Intronic
1165021308 19:32926585-32926607 CCATTCCCACTCTGCCGCCCAGG + Intronic
1165315195 19:35050940-35050962 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1165427115 19:35752378-35752400 GCCTTCCTTCTCTGGGGCCCTGG + Intronic
1165449752 19:35875186-35875208 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
1165478925 19:36050026-36050048 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
1165502069 19:36197444-36197466 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1165589690 19:36957255-36957277 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1165748207 19:38243525-38243547 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1165757386 19:38302085-38302107 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1165848216 19:38832738-38832760 GAGATCTTGCTCTGTCGCCCAGG - Intronic
1165901457 19:39171233-39171255 ACATTCCTGCTCTGTCTCCCTGG + Intronic
1166032406 19:40142368-40142390 ACAGTCTTGCTCTGCCGCCCAGG + Intergenic
1166131213 19:40746830-40746852 GCAGTCTTGCTCTGTCGCCCGGG + Intronic
1166261333 19:41643513-41643535 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1166586893 19:43957204-43957226 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1166723357 19:45010287-45010309 ACGGTCTTGCTCTGCCGCCCAGG - Intronic
1166770103 19:45276649-45276671 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1166925722 19:46265783-46265805 TCGGTCTTGCTCTGTCGCCCAGG + Intergenic
1167024433 19:46904909-46904931 GCGTTCCTGTTCTCCAGCCAGGG + Intergenic
1167088721 19:47328647-47328669 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1167282306 19:48576663-48576685 GAGGTCTTGCTCTGCTGCCCAGG + Intronic
1167399154 19:49253436-49253458 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1167477217 19:49707975-49707997 GTATTCTTGCTCTGTCGCCCAGG - Intronic
1167595788 19:50427497-50427519 GGGGTCTTGCTCTGCGGCCCAGG - Intronic
1167678478 19:50904388-50904410 GCGCTCTGGCTCTGTCGCCCAGG - Intergenic
1167699879 19:51036362-51036384 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1167894242 19:52568346-52568368 GGCGTCCTGCTCTGTCGCCCAGG - Intronic
1168063485 19:53907007-53907029 GCATTCCAGCTCTGCCCCCGCGG + Exonic
1168083290 19:54026454-54026476 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1168112068 19:54198504-54198526 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1168135116 19:54345676-54345698 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1168261796 19:55199279-55199301 ACGGTCCTGCTCTGTCTCCCAGG - Intronic
1168386581 19:55968411-55968433 GAGTTTTTGCTCTGTCGCCCAGG - Intronic
1168532450 19:57140498-57140520 AGGTTCTTGCTCTGCCACCCAGG + Intronic
1168538147 19:57189174-57189196 ACAGTCTTGCTCTGCCGCCCAGG - Intergenic
1168579395 19:57541202-57541224 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
926001778 2:9339151-9339173 GAGGTCATGCTCTGCTGCCCAGG - Intronic
926004598 2:9363607-9363629 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
926016941 2:9461785-9461807 GAGTCTCTGCTCTGTCGCCCAGG + Intronic
926029297 2:9571750-9571772 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
926086894 2:10026048-10026070 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
926184325 2:10676962-10676984 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
926270426 2:11361597-11361619 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
926334953 2:11856031-11856053 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
927550790 2:23997475-23997497 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
927662562 2:25005192-25005214 AGGGTCTTGCTCTGCCGCCCAGG - Intergenic
927745569 2:25616904-25616926 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
927802751 2:26116580-26116602 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
927807822 2:26163351-26163373 GAATTCTTGCTCTGTCGCCCAGG - Intergenic
927872317 2:26631446-26631468 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
927949152 2:27155710-27155732 GGGGTCTTGCTCTGTCGCCCAGG - Exonic
927977266 2:27348239-27348261 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
927984218 2:27396244-27396266 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
928434653 2:31246920-31246942 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
928518644 2:32066640-32066662 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
928524939 2:32130267-32130289 GTGGTCTTGCTCTGACGCCCAGG - Intronic
928576832 2:32663708-32663730 GGGTTCTTGCTCTGTCGCTCAGG + Intronic
928692839 2:33818901-33818923 GGGATCTTGCTCTGCTGCCCAGG + Intergenic
928936059 2:36679614-36679636 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
929120434 2:38479642-38479664 GGAATCTTGCTCTGCCGCCCAGG - Intergenic
929120441 2:38479807-38479829 GGAATCTTGCTCTGCCGCCCAGG - Intergenic
929481479 2:42312577-42312599 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
929848249 2:45555514-45555536 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
930069592 2:47355405-47355427 AGGGTCTTGCTCTGCCGCCCAGG + Intronic
930555324 2:52888076-52888098 GGGGTCTTGCTCTGCTGCCCAGG + Intergenic
930599625 2:53428100-53428122 GGGATCCTGCTCTGTCGCCCAGG - Intergenic
931027194 2:58123827-58123849 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
931094197 2:58920960-58920982 GCGATCAAGCTCTGCCTCCCGGG + Intergenic
931350095 2:61479888-61479910 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
931407046 2:61989202-61989224 GCCATCTTGCTCTGCCTCCCAGG + Intronic
931867326 2:66426525-66426547 GCGCTCCTGCTCCGGCTCCCGGG + Intergenic
932150920 2:69371100-69371122 AGGTTCTTGCTCTGTCGCCCAGG + Intronic
932244281 2:70183401-70183423 GGGGTCCTGCTCTGTCGCCAAGG - Intronic
932256863 2:70295036-70295058 GAGTTCTTGCTCTGTCGCCTAGG + Intergenic
932260260 2:70321047-70321069 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
932318790 2:70804955-70804977 GCGTTCTCACTCTGTCGCCCAGG + Intergenic
932797662 2:74711646-74711668 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
933063826 2:77769837-77769859 GAGTTCCTGCTCTGTCACCCAGG - Intergenic
933321133 2:80776963-80776985 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
933737835 2:85509505-85509527 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
933795114 2:85913436-85913458 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
934313131 2:91888701-91888723 GCGGTCTTGCTCTGTTGCCCAGG + Intergenic
934690064 2:96351640-96351662 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
934753375 2:96808864-96808886 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
934901023 2:98159982-98160004 GGATTCTTGCTCTGTCGCCCAGG - Intronic
934923456 2:98365061-98365083 GGGGTCCTGCTCTGTCACCCAGG + Intronic
935230513 2:101091697-101091719 GAGGTCCTGCTCTGTCTCCCAGG - Intronic
935255540 2:101307206-101307228 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
935807589 2:106764221-106764243 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
935988805 2:108700530-108700552 AGGGTCCTGCTCTGGCGCCCAGG - Intergenic
936120888 2:109743243-109743265 GGGGTCTTGCTCTGCCACCCAGG - Intergenic
936132728 2:109860526-109860548 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
936154405 2:110038974-110038996 GAGTTCTTGCTCTGTAGCCCAGG + Intergenic
936211969 2:110510959-110510981 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
936223808 2:110628229-110628251 GGGGTCTTGCTCTGCCACCCAGG + Intergenic
936374319 2:111927641-111927663 GCCTTCTTGCTCTGTCACCCAGG - Intronic
936421109 2:112365521-112365543 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
936432414 2:112476091-112476113 GAGGTCTTGCTCTGTCGCCCAGG + Intergenic
936448815 2:112618142-112618164 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
936511485 2:113150987-113151009 GCCATCCTCCTCTGCCTCCCAGG + Intergenic
936645065 2:114359205-114359227 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
937073357 2:119082777-119082799 ACTTTCCTGCTCTGCCACCATGG + Intergenic
937197713 2:120174437-120174459 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
937206923 2:120242710-120242732 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
937361363 2:121232074-121232096 GTGGTCCTGCCCCGCCGCCCTGG - Intronic
937450652 2:121999817-121999839 TTGTTCCTGCTCTGCCTTCCTGG + Intergenic
937788343 2:125928807-125928829 GCCGTCCTGCTCAGCAGCCCAGG - Intergenic
937832355 2:126437627-126437649 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
937913710 2:127088711-127088733 ACGGTCTTGCTCTGTCGCCCTGG - Intronic
938075203 2:128328666-128328688 GCAGTCTTGCTCTGTCGCCCTGG + Intergenic
939593844 2:144100893-144100915 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
940918714 2:159285678-159285700 GGGGTCCTGCTCTGTTGCCCAGG - Intronic
941422728 2:165303299-165303321 GGGTTCTCGCTCTGTCGCCCTGG + Intronic
941579215 2:167273978-167274000 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
942332344 2:174840192-174840214 GGGGTCCTGCTCTGTCTCCCAGG + Intronic
942466264 2:176210211-176210233 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
942494567 2:176526310-176526332 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
942565283 2:177259904-177259926 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
943029720 2:182671195-182671217 GTGTTCTCGCTCTGTCGCCCAGG + Intergenic
943216078 2:185037031-185037053 GAATTCTTGCTCTGTCGCCCAGG - Intergenic
944224590 2:197337401-197337423 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
944350833 2:198724841-198724863 AGGTTCCTGCTCTGTCCCCCAGG + Intergenic
944513525 2:200487846-200487868 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
944703053 2:202262582-202262604 GCAGTCTTGCTCTGCTGCCCAGG - Intergenic
944721169 2:202424346-202424368 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
944739268 2:202595721-202595743 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
944813878 2:203355484-203355506 AGGGTCCTGCTCTGTCGCCCAGG - Intronic
945091270 2:206178237-206178259 GGGGTCCTGCTCTGTTGCCCAGG - Intronic
945107876 2:206333543-206333565 GCAGTCTTGCTCTGCTGCCCAGG + Intergenic
945231356 2:207593502-207593524 GGGGTCTTGCTCTGCTGCCCAGG - Intronic
945261300 2:207846166-207846188 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
945581745 2:211603186-211603208 GCGTCACTGCACTGCAGCCCGGG + Intronic
946154521 2:217798546-217798568 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
946356425 2:219188401-219188423 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
946380635 2:219346372-219346394 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
946907828 2:224433087-224433109 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
947095606 2:226563134-226563156 GAGGTCCTGCTCTGTTGCCCAGG - Intergenic
947138843 2:227001979-227002001 AGGGTCCTGCTCTGCTGCCCAGG - Intergenic
947405645 2:229773407-229773429 ACGATCTTGCTCTGTCGCCCAGG + Intronic
947546041 2:231011152-231011174 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
947626766 2:231624158-231624180 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
948033312 2:234837297-234837319 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948118766 2:235513493-235513515 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
948131250 2:235602065-235602087 CAGTGCCTGCTCTGCGGCCCTGG - Intronic
948162875 2:235839560-235839582 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
948337324 2:237219825-237219847 GGAGTCTTGCTCTGCCGCCCGGG - Intergenic
948492633 2:238323102-238323124 GGATTCTTGCTCTGTCGCCCAGG + Intronic
948985262 2:241518168-241518190 GAGATCTTGCTCTGCTGCCCAGG - Intergenic
949083847 2:242130273-242130295 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1169143877 20:3240168-3240190 GCTTTCCGGCTCAGCCGCGCTGG + Intergenic
1169167639 20:3438056-3438078 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1169365365 20:4987818-4987840 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1169426819 20:5503489-5503511 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1169440267 20:5628111-5628133 TCATTCTTGCTCTGTCGCCCAGG + Intergenic
1169546855 20:6659248-6659270 GTCTTGCTGCTCTGTCGCCCAGG - Intergenic
1169583586 20:7055919-7055941 GGGGTCGTGCTCTGTCGCCCAGG + Intergenic
1170067701 20:12332179-12332201 GAGTTCCTGCTATGTTGCCCAGG - Intergenic
1170150915 20:13224869-13224891 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1170284430 20:14690941-14690963 GGATTCCAGCTCTGTCGCCCAGG + Intronic
1170855053 20:20044643-20044665 GGGGTCCTGCTCTGTCACCCAGG + Intronic
1170923517 20:20701702-20701724 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
1171134306 20:22683300-22683322 CCATTCCTGCTCTGACTCCCAGG + Intergenic
1171498596 20:25575717-25575739 GAGTACTTGCTCTGTCGCCCAGG - Intronic
1171968265 20:31546895-31546917 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1172144253 20:32745024-32745046 GTGGTCTTGCTCTGTCGCCCAGG - Intergenic
1172148139 20:32771608-32771630 GCGGTCTTGCTCTGTTGCCCAGG - Intronic
1172471600 20:35201660-35201682 GGAATCTTGCTCTGCCGCCCAGG - Intergenic
1172499152 20:35412585-35412607 CCAGTCCTGCTCTGTCGCCCAGG - Intergenic
1172562018 20:35897590-35897612 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1172742223 20:37178282-37178304 GGGATCTTGCTCTGTCGCCCAGG - Intronic
1172790453 20:37501600-37501622 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1172824154 20:37766146-37766168 GTGTTCCTCCTCTTCCCCCCAGG - Intronic
1173288748 20:41695885-41695907 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1173483714 20:43424275-43424297 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1173608222 20:44347242-44347264 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
1173750269 20:45470539-45470561 CCGTTCCCGCTCGGCCGCCGTGG - Intronic
1173805628 20:45923046-45923068 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1174214341 20:48904515-48904537 TCTTTCTTGCTCTGTCGCCCAGG - Intergenic
1174236758 20:49100244-49100266 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1174266917 20:49338647-49338669 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1174471210 20:50762428-50762450 AAGGTCCTGCTCTGTCGCCCAGG + Intergenic
1175019545 20:55829389-55829411 GAATTCTTGCTCTGTCGCCCAGG - Intergenic
1175756143 20:61531445-61531467 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1175906994 20:62385838-62385860 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1175978761 20:62726667-62726689 AGGTTCCTGCTCTGCCGTCCAGG - Intronic
1176137936 20:63533091-63533113 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1176151561 20:63593992-63594014 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1176174681 20:63714398-63714420 GGGTTCTTGCTCTGTCGTCCAGG - Intronic
1176228357 20:64016966-64016988 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1176253529 20:64138721-64138743 GCATTCTTGCTCTGTTGCCCAGG + Intergenic
1176294618 21:5064776-5064798 GAGGTCCTGACCTGCCGCCCAGG - Intergenic
1176900055 21:14429477-14429499 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1177312629 21:19417517-19417539 GAGTTCTCGCTCTGTCGCCCAGG + Intergenic
1177883934 21:26725748-26725770 GGAGTCTTGCTCTGCCGCCCTGG - Intergenic
1178259568 21:31086274-31086296 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1178302552 21:31465178-31465200 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1178322611 21:31616884-31616906 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1178588037 21:33886184-33886206 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1178875350 21:36409987-36410009 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1178876158 21:36415776-36415798 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1179454578 21:41490120-41490142 GAGTTTTTGCTCTGTCGCCCAGG - Intronic
1179539002 21:42072020-42072042 GGGCTTTTGCTCTGCCGCCCAGG - Intronic
1179862433 21:44197350-44197372 GAGGTCCTGGCCTGCCGCCCAGG + Intergenic
1179925498 21:44531893-44531915 GCACCCCTGCTCTTCCGCCCAGG - Intronic
1180192295 21:46171401-46171423 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1180539791 22:16433768-16433790 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1180661180 22:17468645-17468667 GGGTTCTTGCTCTGTCGCTCAGG - Intronic
1180882092 22:19211739-19211761 GCAATCTTGCTCTGTCGCCCAGG - Intronic
1180915986 22:19487502-19487524 GAGGTCCTGCTCTGTTGCCCAGG - Intronic
1180931426 22:19594774-19594796 GGGCTCCTGCTATGCTGCCCAGG - Intergenic
1180955933 22:19741269-19741291 GGGATCTTGCTCTGTCGCCCAGG + Intergenic
1180973059 22:19825594-19825616 GCGGTCTTGCTCTGTCCCCCAGG - Intronic
1181142475 22:20816604-20816626 GGGGTCCTGCTCTGTCACCCAGG - Intronic
1181315120 22:21965916-21965938 AGGGTCCTGCTCTGTCGCCCAGG + Intronic
1181327711 22:22063470-22063492 AGGGTCCTGCTCTGTCGCCCAGG + Intergenic
1181511389 22:23390343-23390365 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1181718844 22:24757810-24757832 AAGGTCCTGCTCTGTCGCCCAGG - Intronic
1181780457 22:25189177-25189199 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1181978552 22:26750225-26750247 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1182087334 22:27570334-27570356 GGTTTCTTGCTCTGTCGCCCAGG + Intergenic
1182262881 22:29088352-29088374 GGGTTCCCGCTCTGTCACCCAGG + Intronic
1182359226 22:29736998-29737020 GGATTCTTGCTCTACCGCCCAGG - Intronic
1182363033 22:29758595-29758617 GAGGTCTTGCTCTGCCACCCAGG - Intronic
1182374579 22:29837405-29837427 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1182756830 22:32687187-32687209 GAATTCTCGCTCTGCCGCCCAGG + Intronic
1182988364 22:34742524-34742546 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
1183036589 22:35145253-35145275 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1183446243 22:37857342-37857364 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1183462158 22:37958212-37958234 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1183977625 22:41522311-41522333 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1183982139 22:41547396-41547418 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1184018919 22:41807534-41807556 AGGGTCCTGCTCTGCTGCCCAGG - Intronic
1184471069 22:44696760-44696782 GCAGTCCTGCTCTGTCGCCCAGG + Intronic
1184484891 22:44771270-44771292 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1184543181 22:45143534-45143556 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
1184550671 22:45202761-45202783 GCGTTCCTGCCTTGCAGACCTGG - Intronic
1184557805 22:45242450-45242472 TCCTTCCTGCTGTGCCTCCCAGG - Intergenic
1184647084 22:45902133-45902155 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1184734637 22:46390929-46390951 CAGTCCCTGCTCTGCCGCTCAGG - Intronic
1185000669 22:48243556-48243578 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1185001224 22:48247358-48247380 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
949102080 3:157641-157663 GCGGTCTTGCTCTATCGCCCAGG - Intergenic
949116864 3:337214-337236 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
950068651 3:10134548-10134570 GTGCTCCTGCTCTGTCACCCAGG - Intergenic
950070187 3:10145678-10145700 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
950233120 3:11293990-11294012 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
950300962 3:11878230-11878252 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
950395894 3:12733928-12733950 ACGATCTTGCTCTGTCGCCCAGG + Exonic
950514077 3:13452691-13452713 GCGGTCTTGCTCTGTCGCCCAGG + Intergenic
950741817 3:15058213-15058235 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
950973147 3:17210211-17210233 GGATTCTTGCTCTGTCGCCCAGG + Intronic
951240501 3:20281080-20281102 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
951278198 3:20715076-20715098 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
951485245 3:23203079-23203101 GCGTGCCTGCGCGCCCGCCCGGG - Intronic
951895725 3:27608140-27608162 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
951897913 3:27627859-27627881 GAGGTCCTGCTCTGTCACCCAGG - Intergenic
952159392 3:30678520-30678542 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
952332712 3:32379288-32379310 AAGGTCTTGCTCTGCCGCCCAGG - Intergenic
952336273 3:32405728-32405750 GGGTTCTTGCTCTGTCACCCAGG - Intronic
952373862 3:32748854-32748876 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
952691401 3:36210636-36210658 TCTTTCTTGCTCTGCTGCCCAGG - Intergenic
953306313 3:41833319-41833341 GCCATCTTGCTCTGTCGCCCAGG + Intronic
953326531 3:42016009-42016031 GGGGTCTTGCTCTGTCGCCCTGG - Intronic
953394741 3:42558764-42558786 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
953507026 3:43496457-43496479 GGGTTCTTGCTCTGTCACCCAGG + Intronic
953615011 3:44482115-44482137 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
953934100 3:47024624-47024646 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
954059929 3:48058803-48058825 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
954208937 3:49082867-49082889 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
954229504 3:49205793-49205815 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
954339871 3:49944900-49944922 GGATTCTTGCTCTGTCGCCCAGG + Intronic
954344006 3:49980734-49980756 GAATTCTTGCTCTGTCGCCCAGG - Intronic
954701162 3:52451588-52451610 GTGTCCCTGCTCTGCCTCCTGGG - Intronic
955004775 3:54958365-54958387 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
955252967 3:57303311-57303333 GCGTCTTTGCTCTGTCGCCCAGG - Intronic
955319769 3:57965832-57965854 AGGGTCCTGCTCTGTCGCCCAGG - Intergenic
955590335 3:60527997-60528019 AGGTTCTTGCTCTGCAGCCCAGG + Intronic
956411890 3:68987938-68987960 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
956439919 3:69270040-69270062 GGGTTCTTGCTCTGTCACCCAGG + Intronic
956761728 3:72449583-72449605 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
957059037 3:75466586-75466608 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
957150155 3:76476125-76476147 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
957886433 3:86294261-86294283 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
957890487 3:86351317-86351339 GCATTCTTGCTCTGTCTCCCAGG + Intergenic
959011694 3:101085206-101085228 GGGTTCCTGCTATGTAGCCCAGG - Intergenic
959065778 3:101655684-101655706 GGATTCTTGCTCTGTCGCCCAGG + Intronic
959704251 3:109325142-109325164 GGGTCTCTGCTCTGCTGCCCAGG + Intergenic
959787728 3:110320730-110320752 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
960098123 3:113707765-113707787 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
960537871 3:118833141-118833163 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
960619445 3:119624654-119624676 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
960821486 3:121737624-121737646 GCGGTCTTGCTCTGTTGCCCAGG - Intronic
960834397 3:121890092-121890114 GAGTCTCTGCTCTGTCGCCCAGG + Intergenic
960834453 3:121890603-121890625 GAGTCTCTGCTCTGTCGCCCAGG - Intergenic
960945190 3:122961483-122961505 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
961006419 3:123408628-123408650 GCAATCTTGCTCTGTCGCCCAGG - Intronic
961157892 3:124696308-124696330 AGGTTCTTGCTCTGCTGCCCAGG + Intronic
961162305 3:124739355-124739377 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
961215853 3:125159982-125160004 GGGTTCTCGCTCTGTCGCCCAGG + Intronic
961294410 3:125873145-125873167 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
961318016 3:126053845-126053867 TCCTTCCTGCTCTGCCAGCCAGG + Intronic
961354685 3:126329457-126329479 AGGTTCTTGCTCTGCTGCCCAGG - Intergenic
961404769 3:126670404-126670426 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
961757626 3:129138958-129138980 GGAGTCCTGCTCTGCTGCCCAGG + Intronic
962182677 3:133225068-133225090 GGAGTCCTGCTCTGCCGCCTAGG + Intronic
962335899 3:134529897-134529919 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
962795343 3:138845077-138845099 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
963395832 3:144731885-144731907 GGGGTCTGGCTCTGCCGCCCAGG - Intergenic
963737706 3:149038526-149038548 GGGTTCTTGCTCTGTCACCCAGG + Intronic
963872902 3:150437780-150437802 GGAGTCCCGCTCTGCCGCCCAGG - Intronic
964187391 3:153963524-153963546 AAGGTCCTGCTCTGCAGCCCAGG + Intergenic
964202165 3:154130170-154130192 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
964288688 3:155151047-155151069 GGATTCTTGCTCTGTCGCCCAGG - Intronic
964905450 3:161714324-161714346 ACGGTCTTGCTCTGCCACCCAGG + Intergenic
965452220 3:168852352-168852374 GAGTTCTTGCTCTGTCGCCCAGG + Intergenic
965545419 3:169910418-169910440 AAGTTCTTGCTCTGCCACCCAGG - Intergenic
965827426 3:172745090-172745112 GGGGTCGTGCTCTGCTGCCCAGG + Intergenic
965827782 3:172747941-172747963 GCGGTCTTGCTCTATCGCCCAGG + Intergenic
966201081 3:177359913-177359935 GAGCTCCGGCTCTGCCGCCGCGG - Intergenic
966760006 3:183409578-183409600 GAGTTTCTGCTCTGTTGCCCAGG + Intronic
966787076 3:183631485-183631507 TCGCTCTTGCTCTGTCGCCCAGG - Intergenic
966792132 3:183682970-183682992 GGGGTCTTGCTCTGTCGCCCAGG + Exonic
967443749 3:189540362-189540384 GCTTTCCAGCTCTGCCTCCAGGG + Intergenic
967619808 3:191618918-191618940 GGAGTCTTGCTCTGCCGCCCGGG - Intergenic
967621264 3:191637027-191637049 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
967686851 3:192427351-192427373 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
967738536 3:192980160-192980182 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
967755786 3:193167012-193167034 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
967803527 3:193691193-193691215 GGGGTCCTACTCTGTCGCCCAGG - Intronic
968039747 3:195579068-195579090 GCGTTCCTGAGCTGTCGCCCTGG - Intronic
968191146 3:196668250-196668272 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
968417125 4:448408-448430 GGATTCCTGCTCTGTCACCCAGG - Intronic
968697371 4:2039386-2039408 GCAATCTTGCTCTGTCGCCCAGG - Intronic
968862489 4:3184047-3184069 GTGTTCCTGATCAGCCGCCATGG - Intronic
969002950 4:3996778-3996800 GCAATCTTGCTCTGTCGCCCAGG - Intergenic
969111233 4:4845665-4845687 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
969274133 4:6123793-6123815 GTGTCACTGCTCTGTCGCCCAGG - Intronic
969400359 4:6951264-6951286 GCAGTCTTGCTCTGCCGCCCAGG - Intronic
969623075 4:8288596-8288618 GGGTTCTTGCTCTGTCACCCAGG + Intronic
969909294 4:10428563-10428585 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
970121934 4:12763799-12763821 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
970155542 4:13138056-13138078 TGGTTCCTGCTCTGACACCCAGG - Intergenic
970571176 4:17384361-17384383 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
970691493 4:18625574-18625596 AAGTTCTTGCTCTGCTGCCCAGG + Intergenic
971372405 4:26029261-26029283 GCTCTGCTGCTCTGCCTCCCTGG - Intergenic
971829702 4:31674807-31674829 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
971922276 4:32956708-32956730 GCCTTCTAGCTCTGCTGCCCAGG - Intergenic
972095712 4:35344394-35344416 GCGTTCTTGCTATGTCGCCCAGG - Intergenic
972608434 4:40635055-40635077 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
972641476 4:40929333-40929355 GAGTCCTTGCTCTGTCGCCCAGG + Intronic
972657824 4:41082596-41082618 GTGGTCCTGCTCTGTCACCCAGG + Intronic
972800763 4:42473669-42473691 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
973153366 4:46915277-46915299 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
973242620 4:47973091-47973113 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
973777425 4:54256259-54256281 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
974037712 4:56831455-56831477 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
974904695 4:68040327-68040349 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
975589486 4:75986142-75986164 AAGGTCCTGCTCTGTCGCCCAGG + Intronic
975776268 4:77790725-77790747 GGATTCTTGCTCTGTCGCCCAGG + Intronic
975815084 4:78209117-78209139 GGGGTCTTGCTCTGCTGCCCAGG - Intronic
976185464 4:82438629-82438651 GCATTCCAGCTCTGTCACCCAGG - Intronic
976231610 4:82849586-82849608 GGATTCTTGCTCTGTCGCCCAGG - Intronic
976765412 4:88592902-88592924 GCCCTCCCGCCCTGCCGCCCGGG + Intronic
977039195 4:91993703-91993725 GTCTTCTTGCTCTGTCGCCCAGG - Intergenic
977167685 4:93721942-93721964 GGAATCTTGCTCTGCCGCCCAGG + Intronic
977254841 4:94729131-94729153 GTATTCTTGCTCTGTCGCCCAGG + Intergenic
977544574 4:98362286-98362308 GCGATCTTGCTATGACGCCCAGG - Intronic
978146732 4:105382975-105382997 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
978513232 4:109544074-109544096 GGGGTCTTGCTGTGCCGCCCAGG - Intergenic
980025038 4:127756005-127756027 GGGGTCTTGCTTTGCCGCCCAGG - Intronic
980940595 4:139270581-139270603 GCGGTCTCGCTCTGTCGCCCAGG - Intronic
981089601 4:140719087-140719109 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
981415788 4:144491997-144492019 AAGTTCTTGCTCTGTCGCCCAGG + Intergenic
981712025 4:147718651-147718673 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
982878520 4:160678032-160678054 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
983524436 4:168746353-168746375 GGGTTCTCGCTCTGTCGCCCAGG - Intronic
983562927 4:169119127-169119149 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
983943754 4:173563882-173563904 GCTGTCTTGCTCTGTCGCCCAGG - Intergenic
983973236 4:173900046-173900068 GGGGTCTTGCTCTGCTGCCCAGG + Intergenic
984154123 4:176173540-176173562 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
984154744 4:176181439-176181461 GTGGTCTTGCTCTGTCGCCCAGG - Intronic
984174065 4:176394868-176394890 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
984792265 4:183625728-183625750 GAGTTTTTGCTCTGCCGCCCAGG - Intergenic
984881605 4:184414365-184414387 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
984987194 4:185342914-185342936 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
985240538 4:187927034-187927056 GGAGTCTTGCTCTGCCGCCCTGG + Intergenic
985274929 4:188229135-188229157 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
985438632 4:189961038-189961060 ACGGTCTTGCTCTGCCACCCAGG - Intronic
986062232 5:4202514-4202536 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
986202685 5:5592321-5592343 GCGTTCCTGGGCTGCGGTCCTGG - Intergenic
986884493 5:12216567-12216589 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
987238294 5:15965868-15965890 GAGTTTCTGCTCTGTCACCCAGG - Intergenic
987371168 5:17194391-17194413 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
987507393 5:18792158-18792180 GAGTTCTTGCTCTGATGCCCAGG + Intergenic
987970763 5:24940755-24940777 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
988563886 5:32305112-32305134 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
988795560 5:34650290-34650312 AAGTTCTTGCTCTGTCGCCCAGG - Intergenic
988895979 5:35675564-35675586 TCGCTCTTGCTCTGTCGCCCAGG + Intronic
988905460 5:35784151-35784173 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
989138350 5:38177426-38177448 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
989414941 5:41163336-41163358 GAGGTCTCGCTCTGCCGCCCAGG + Intronic
989420890 5:41239135-41239157 GGATTCTTGCTCTGTCGCCCAGG + Intronic
989543702 5:42647546-42647568 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
989584742 5:43066069-43066091 GGGGTCCGGCTCTGTCGCCCAGG - Intronic
990397283 5:55395005-55395027 GGATTCTTGCTCTGCCACCCAGG - Intronic
990409976 5:55532928-55532950 ACGGTCTTGCTCTGTCGCCCAGG - Intronic
990450000 5:55925032-55925054 GCCTTCATGCTGTGCAGCCCAGG - Intergenic
991045088 5:62213914-62213936 GCAGTCTTGCTCTGCTGCCCAGG - Intergenic
991327335 5:65449593-65449615 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991424223 5:66474020-66474042 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
991698252 5:69293620-69293642 GGATTCTTGCTCTGTCGCCCAGG - Intronic
991699892 5:69307654-69307676 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991772480 5:70052694-70052716 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991851773 5:70928113-70928135 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
992177341 5:74163359-74163381 GGGTTCTTGCTCTGATGCCCAGG + Intergenic
992213451 5:74503676-74503698 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
992430179 5:76703039-76703061 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
992534242 5:77682615-77682637 GAGATCTTGCTCTGTCGCCCAGG + Intergenic
992826637 5:80555688-80555710 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
992835151 5:80633372-80633394 ACGGTCTTGCTCTGTCGCCCAGG + Intronic
992883628 5:81135276-81135298 GGGTTTTTGCTCTGTCGCCCAGG - Intronic
992955593 5:81905031-81905053 TCTTTCCTGCTCTGTCGCCCAGG - Intergenic
993079571 5:83278973-83278995 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
994283469 5:97934943-97934965 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
994361074 5:98849253-98849275 TGGATCTTGCTCTGCCGCCCAGG + Intergenic
994397506 5:99237722-99237744 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
994429791 5:99643561-99643583 GAGATCTTGCTCTGTCGCCCAGG - Intergenic
994614267 5:102083783-102083805 GGCTTCTTGCTCTGTCGCCCAGG + Intergenic
994712487 5:103282595-103282617 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
994818740 5:104620804-104620826 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
995425756 5:112020456-112020478 GTGTTCTTGCTCTGTTGCCCAGG - Intergenic
995511124 5:112910274-112910296 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
995767395 5:115633832-115633854 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
996534849 5:124567196-124567218 GGGGTCTTGCTCTGCTGCCCAGG + Intergenic
996584276 5:125067175-125067197 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
996706147 5:126500641-126500663 GTCTTCTTGCTCTGCTGCCCAGG - Intergenic
996707083 5:126508332-126508354 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
996733585 5:126738644-126738666 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
996756216 5:126938191-126938213 ACAGTCTTGCTCTGCCGCCCAGG + Intronic
996898300 5:128512485-128512507 GGGTTCCTGCTCTGTTGCCCAGG - Intronic
997321056 5:132978903-132978925 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
997480400 5:134180117-134180139 GGACTCTTGCTCTGCCGCCCAGG - Intronic
997540247 5:134655640-134655662 GAATTCTTGCTCTGTCGCCCAGG - Intronic
997678802 5:135734789-135734811 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
998077704 5:139249783-139249805 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
998090039 5:139360516-139360538 AGGGTCTTGCTCTGCCGCCCAGG + Intronic
998096618 5:139399289-139399311 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
998344422 5:141448917-141448939 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
998365938 5:141631211-141631233 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
998491680 5:142552052-142552074 GGGCTCCTGCTCTCCAGCCCAGG - Intergenic
998504612 5:142661972-142661994 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
998535178 5:142923885-142923907 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
998851308 5:146353440-146353462 AGGGTCTTGCTCTGCCGCCCAGG - Intergenic
999164779 5:149539439-149539461 GGGTTCTTGCTCGGCCGCCTAGG - Intronic
999244709 5:150147649-150147671 GCCCTCCTGCTCTGCCGCCCAGG - Intronic
999321361 5:150617319-150617341 GAGTTTCTGCTCTGTTGCCCAGG + Intronic
999392028 5:151200162-151200184 GGATTCTTGCTCTGCCACCCAGG + Intronic
999462232 5:151767663-151767685 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
999745197 5:154586536-154586558 GAGTTTCTGCTCTGTTGCCCAGG - Intergenic
1001568438 5:172715093-172715115 ACATTCCTGCCCTGCAGCCCTGG - Intergenic
1001656332 5:173353725-173353747 ACATTCTTGCTCTGCCGCCCAGG + Intergenic
1001790208 5:174449779-174449801 AGGGTCCTGCTCTGCCACCCAGG - Intergenic
1002144641 5:177169993-177170015 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1002160474 5:177311599-177311621 CCGTCCCTGCTCTACCGCCCCGG + Intronic
1002206760 5:177568361-177568383 GAGTTTCTGCTCTGTCACCCAGG - Intergenic
1002350043 5:178577147-178577169 GGGTCCCTGCTCTGCCGTCCGGG + Intronic
1002371817 5:178760891-178760913 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1002372132 5:178763323-178763345 GTCTTGCTGCTCTGCCGCCCAGG + Intergenic
1002545816 5:179944487-179944509 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1002550520 5:179987191-179987213 GGGTCCCTGCTCTGTCACCCAGG + Intronic
1002570414 5:180136655-180136677 GCGATCCTGCTCTGCGCCCACGG + Intronic
1002612121 5:180427296-180427318 GAGGTCTTGCTCTGTCGCCCAGG + Intergenic
1002652219 5:180707334-180707356 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1002790452 6:433797-433819 ACGGTCTTGCTCTGCTGCCCAGG - Intergenic
1003174822 6:3746660-3746682 GTGCCCCTGCTCTGCTGCCCGGG + Intronic
1003448683 6:6210368-6210390 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1003462020 6:6338111-6338133 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1003749984 6:9044160-9044182 AGGATCCTGCTCTGCCACCCAGG + Intergenic
1003881646 6:10484430-10484452 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1003906291 6:10702830-10702852 GTCTCCCTGCTCTGTCGCCCAGG + Intronic
1004104435 6:12652897-12652919 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1004106972 6:12674755-12674777 GAAGTCTTGCTCTGCCGCCCAGG - Intergenic
1004110243 6:12710768-12710790 ACGGTCTTGCTCTGTCGCCCAGG + Intergenic
1004129018 6:12901518-12901540 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1004245072 6:13966735-13966757 AGGTTCCTGATCTGTCGCCCAGG - Intronic
1004495462 6:16158842-16158864 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1004499498 6:16197390-16197412 GCCAGCCTGCTCTGCCACCCCGG - Intergenic
1004567692 6:16814603-16814625 GAGTTCTTGCTCTGTCACCCAGG + Intergenic
1004932824 6:20478171-20478193 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
1005473995 6:26189480-26189502 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
1005586045 6:27277451-27277473 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1005612444 6:27539330-27539352 ACATTCCGGCTCTGTCGCCCAGG - Intergenic
1005652923 6:27901243-27901265 ACGGTCTTGCTCTGTCGCCCAGG - Intergenic
1005813861 6:29534899-29534921 AGGTTCTTGCTCTGCTGCCCAGG - Intergenic
1006003500 6:30984947-30984969 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1006023203 6:31130064-31130086 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1006023776 6:31134002-31134024 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1006160626 6:32038864-32038886 GGGTTCTTGCTATGCTGCCCAGG + Intronic
1006306810 6:33226737-33226759 GGAATCCTGCTCTGTCGCCCAGG - Intergenic
1006310423 6:33254246-33254268 AAGTTGCTGCTCTGTCGCCCAGG - Intronic
1006323509 6:33335556-33335578 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1006386873 6:33735891-33735913 GTGGTCTTGCTCTGTCGCCCAGG + Intronic
1006413718 6:33891229-33891251 GCCTTCCTTCTCTGGCTCCCTGG + Intergenic
1006493571 6:34404690-34404712 AGGGTCCTGCTCTGCCTCCCAGG - Intronic
1006529724 6:34641051-34641073 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1006566523 6:34962885-34962907 GGGATCTTGCTCTGTCGCCCAGG + Intronic
1006596414 6:35195768-35195790 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1006613137 6:35307371-35307393 GCGTTCCAAATCTGCCGCCCAGG - Intronic
1006633909 6:35448815-35448837 GGGTTCTTGCTCTGTCACCCAGG - Intergenic
1006668769 6:35716749-35716771 GGATTCCTGCTGTGCTGCCCTGG + Intronic
1006677763 6:35776593-35776615 CCGCCGCTGCTCTGCCGCCCAGG + Exonic
1006731896 6:36242490-36242512 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1006858317 6:37151794-37151816 ACGGTCTTGCTCTGTCGCCCAGG + Intergenic
1006928415 6:37672411-37672433 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1007036683 6:38680696-38680718 GAGTTCCTGCTATGTTGCCCAGG - Intronic
1007153621 6:39719955-39719977 GGGGTCCTGCTCTGTCACCCAGG - Intronic
1007356976 6:41328011-41328033 GGGTTCCTGCTCTGCCTCTTTGG - Intergenic
1007457974 6:41995281-41995303 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1007481299 6:42151903-42151925 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1007489197 6:42205031-42205053 AGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1007555404 6:42761421-42761443 GCACTCCAGCTCTGCTGCCCAGG - Intronic
1007604125 6:43104434-43104456 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1007657677 6:43461680-43461702 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1007734284 6:43970984-43971006 AGCTTCCTGCTCTGCCCCCCAGG + Intergenic
1007759138 6:44122106-44122128 GGAGTCCTGCTCTGTCGCCCTGG + Intronic
1007773656 6:44210966-44210988 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1007774703 6:44218591-44218613 GCATTTCTGCACTGCCTCCCTGG - Intergenic
1008313381 6:50007002-50007024 GCATTCTCGCTCTGTCGCCCAGG + Intergenic
1008362957 6:50643320-50643342 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1008648267 6:53538350-53538372 GCAGTCTCGCTCTGCCGCCCAGG + Intronic
1008655552 6:53608979-53609001 ACATTCTTGCTCTGTCGCCCAGG - Intronic
1008856799 6:56098739-56098761 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1009778961 6:68243844-68243866 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1009952066 6:70409895-70409917 GCAGTCTTGCTCTGCCGCCCAGG + Intergenic
1010194423 6:73225055-73225077 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1010405626 6:75502538-75502560 GAGGTCTTGCTCTGCCACCCAGG - Intergenic
1010424291 6:75708866-75708888 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1011061808 6:83278465-83278487 GAGCTCTTGCTCTGTCGCCCAGG + Intronic
1011623366 6:89263546-89263568 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1011957897 6:93046572-93046594 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1012382430 6:98636012-98636034 GCGTGCCTTCTCTGCCCTCCAGG + Intergenic
1012883859 6:104822355-104822377 GGAGTCCTGCTCTGCCTCCCAGG - Intronic
1013060753 6:106631198-106631220 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1013324321 6:109029560-109029582 GGGTTCTTGCTCTGTCACCCAGG + Intronic
1013329664 6:109087103-109087125 GCTGTCTTGCTCTGTCGCCCAGG - Intronic
1013540048 6:111099339-111099361 TGGGTCCTGCTCTGCTGCCCAGG + Intronic
1013593624 6:111642090-111642112 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1013998195 6:116333944-116333966 GGGTTCTTGCTCTGTCACCCAGG - Intronic
1014266350 6:119282039-119282061 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1014939974 6:127426336-127426358 ACGTTCTTGCTCTGTCACCCAGG - Intergenic
1015411462 6:132898182-132898204 TGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1015442897 6:133269231-133269253 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
1015504141 6:133964013-133964035 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1015720940 6:136241063-136241085 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1015979591 6:138825555-138825577 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1015981318 6:138842433-138842455 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1016099023 6:140074802-140074824 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
1016430624 6:143981534-143981556 GCCTTCCTGCACTGCAGCCTGGG + Intronic
1016563558 6:145425197-145425219 GTAGTCTTGCTCTGCCGCCCAGG + Intergenic
1016651751 6:146469847-146469869 CCTTTCCTGCTCTGCTTCCCTGG - Intergenic
1016757611 6:147703919-147703941 GGATTCTTGCTCTGACGCCCAGG + Intronic
1016830589 6:148429715-148429737 GGGATCTTGCTCTGTCGCCCAGG - Intronic
1016838006 6:148498373-148498395 AGGTTCTTGCTCTGCCACCCAGG - Intronic
1017531104 6:155292853-155292875 AGGGTCTTGCTCTGCCGCCCAGG + Intronic
1017833208 6:158151394-158151416 GAGGTCTTGCTCTGTCGCCCAGG - Intronic
1017842490 6:158232727-158232749 GCGCTCCTCCTCTTCCTCCCCGG + Intronic
1017847419 6:158271457-158271479 AGGTTCTTGCTCTGCCACCCAGG + Intronic
1017995641 6:159529580-159529602 GCGGTCTTGCTCTGTTGCCCAGG - Intergenic
1018216897 6:161537475-161537497 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1018332797 6:162749544-162749566 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1018590945 6:165421415-165421437 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1018869859 6:167773755-167773777 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
1019393834 7:805836-805858 GGGGTCTTGCTCTGCTGCCCAGG - Intergenic
1019645157 7:2125004-2125026 TGGTTCCTGCTCTGCATCCCGGG + Intronic
1019702759 7:2481952-2481974 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1019777030 7:2917976-2917998 AGGGTCTTGCTCTGCCGCCCAGG + Intronic
1019799194 7:3075583-3075605 GCACTCCTGCTCTGCAGCCCCGG - Intergenic
1019808560 7:3147476-3147498 AGGGTCCTGCTCTGTCGCCCAGG + Intronic
1019948371 7:4348802-4348824 GAGTTCTTGCTCTGTCACCCAGG + Intergenic
1019988102 7:4672915-4672937 GCAGTCTTGCTCTGCTGCCCAGG - Intergenic
1020022689 7:4878512-4878534 GGGGTCTTGCTCTGCTGCCCGGG - Intronic
1020113993 7:5465224-5465246 ACGGTCGTGCTCTGTCGCCCAGG + Intronic
1020138812 7:5601226-5601248 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1020182282 7:5931669-5931691 GGGTTCTTGCTCTGTTGCCCAGG - Intronic
1020230821 7:6317307-6317329 ACGGTCTTGCTCTGCCGCCCAGG + Intergenic
1020249961 7:6459762-6459784 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1020265816 7:6559340-6559362 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1020300628 7:6793096-6793118 GGGTTCTTGCTCTGTTGCCCAGG + Intronic
1020778854 7:12493168-12493190 AGGGTCTTGCTCTGCCGCCCAGG - Intergenic
1020978675 7:15040058-15040080 GTATTCCTGCTCTGTCGCCCAGG - Intergenic
1021139161 7:17002539-17002561 AGGGTCTTGCTCTGCCGCCCAGG - Intergenic
1021411100 7:20330821-20330843 GTGGTCCTGCTCTGGCCCCCCGG - Intronic
1021832829 7:24634254-24634276 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1021990238 7:26134279-26134301 GCAGTCTTGCTCTGCCACCCAGG - Intergenic
1022364171 7:29694272-29694294 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1022697116 7:32718038-32718060 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1022909910 7:34890980-34891002 ACGGTCGTGCTCTGCCTCCCAGG + Intergenic
1023139019 7:37082686-37082708 GCGTTACTGCACTCCAGCCCGGG + Intronic
1023409862 7:39879473-39879495 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1023464586 7:40440183-40440205 TGGTTCCTGCTCTGTTGCCCAGG + Intronic
1023813092 7:43927319-43927341 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
1024312881 7:47985865-47985887 AGGGTCTTGCTCTGCCGCCCAGG + Intergenic
1025043002 7:55664114-55664136 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1025135924 7:56412642-56412664 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1025191749 7:56900824-56900846 GTCTTCTTGCTCTGTCGCCCAGG - Intergenic
1025195289 7:56927780-56927802 GGGCTCTTGCTCTGCTGCCCAGG + Intergenic
1025534610 7:61932445-61932467 GGATTCTTGCTCTGCCACCCAGG + Intergenic
1025676663 7:63649163-63649185 GGGCTCTTGCTCTGCTGCCCAGG - Intergenic
1025680199 7:63676110-63676132 GTCTTCTTGCTCTGTCGCCCAGG + Intergenic
1025702412 7:63832203-63832225 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1025857548 7:65296284-65296306 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1025978002 7:66384831-66384853 ACGGTCCTGCTCTGTCGCCCAGG + Intronic
1026078922 7:67199874-67199896 GGGTTCTCGCTCTGTCGCCCAGG - Intronic
1026103862 7:67405472-67405494 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1026303070 7:69115756-69115778 GGGGTCTTGCTCTGCCACCCAGG - Intergenic
1026662774 7:72316917-72316939 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1026697898 7:72612069-72612091 GGGTTCTCGCTCTGTCGCCCAGG + Intronic
1026836793 7:73645050-73645072 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
1026861838 7:73795571-73795593 GTGTTCTTGCTCTGTTGCCCAGG + Intergenic
1026965538 7:74437117-74437139 ATTTTCCTGCTCTGTCGCCCAGG + Intergenic
1026992160 7:74592881-74592903 GAGGTCTTGCTCTGTCGCCCTGG + Intronic
1027184148 7:75960263-75960285 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1027203584 7:76079498-76079520 AGGGTCCTGCTCTGTCGCCCAGG + Intergenic
1027383587 7:77637981-77638003 GAGGTCTTGCTCTGTCGCCCAGG + Intronic
1027427139 7:78072704-78072726 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1027847385 7:83398916-83398938 GGGGTCCTGCTCTGTTGCCCAGG - Intronic
1028224001 7:88228272-88228294 GGAGTCTTGCTCTGCCGCCCGGG - Intergenic
1029096628 7:98090072-98090094 GTCTTCTTGCTCTGTCGCCCAGG - Intergenic
1029128445 7:98311878-98311900 TCTTTCTTGCTCTGTCGCCCAGG - Intronic
1029129652 7:98320359-98320381 GAGTTTTTGCTCTGTCGCCCAGG + Intronic
1029136052 7:98372361-98372383 GCGTCACTGCTCTGCAGCCTGGG + Intronic
1029213582 7:98928961-98928983 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1029234449 7:99101906-99101928 GTGGTCGTGCTCTGTCGCCCAGG - Intronic
1029237749 7:99136166-99136188 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1029294745 7:99531029-99531051 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1029527936 7:101106828-101106850 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1029553902 7:101254359-101254381 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1029576466 7:101406752-101406774 GGGGTCCTGCTATGTCGCCCAGG - Intronic
1029645446 7:101852590-101852612 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1029656360 7:101927622-101927644 AGGGTCTTGCTCTGCCGCCCAGG - Intronic
1029687655 7:102159820-102159842 GAGTTTCTGCTCTGTTGCCCAGG - Intronic
1029851921 7:103470505-103470527 ACGATCTTGCTCTGTCGCCCAGG + Intergenic
1029876019 7:103752604-103752626 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
1030092871 7:105873126-105873148 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1030855932 7:114557833-114557855 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1031730788 7:125298297-125298319 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1032118854 7:129141924-129141946 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1032225708 7:130030223-130030245 GAGTTTTTGCTCTGTCGCCCAGG + Intronic
1032307358 7:130748117-130748139 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1032354740 7:131200034-131200056 GAGGTCTTGCTCTGCTGCCCAGG + Intronic
1032396272 7:131592338-131592360 GCGGTCTTGCTCTGTTGCCCAGG + Intergenic
1032617975 7:133496173-133496195 GCGGTCTTGCTCTGTCCCCCAGG + Intronic
1032712549 7:134473449-134473471 AGGTTCTTGCTCTGTCGCCCAGG + Intergenic
1032932616 7:136690677-136690699 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1033036930 7:137884029-137884051 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1033063929 7:138134713-138134735 GAGTTCCTTCTCTGTTGCCCAGG - Intergenic
1033256658 7:139807230-139807252 TGTTTCCTGCTCTGCCACCCAGG + Intronic
1033301378 7:140189072-140189094 GCAGTCTTGCTCTGCCGCCCAGG - Intergenic
1033316800 7:140304160-140304182 GCACTCTTGCTCTGTCGCCCAGG - Intronic
1033371965 7:140717304-140717326 AGGGTCTTGCTCTGCCGCCCAGG + Intronic
1034153836 7:148938231-148938253 GCGTTCTTGCTCTGTCACCCAGG + Intergenic
1034441026 7:151086265-151086287 GCGCTCCAGCCCTGGCGCCCCGG - Intronic
1034458469 7:151184994-151185016 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1034476341 7:151285644-151285666 GTGGTCTTGCTCTGCTGCCCAGG - Intergenic
1034540275 7:151753991-151754013 GCGGTCTTGCTCTGCCTCTCAGG - Intronic
1034602975 7:152280523-152280545 TCTTTCTTGATCTGCCGCCCAGG - Intronic
1034641923 7:152610984-152611006 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1034671338 7:152861248-152861270 GAGGTCTTGCTCTGTCGCCCAGG + Intergenic
1034887583 7:154809893-154809915 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1035123062 7:156585199-156585221 GGGCTCCTGCCCTGCAGCCCCGG - Intergenic
1035401468 7:158569099-158569121 ACATTCTTGCTCTGTCGCCCAGG - Intronic
1035604493 8:920727-920749 GCAGTCCCGCTCTGTCGCCCAGG - Intergenic
1035753751 8:2014962-2014984 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1036548417 8:9794469-9794491 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
1036631684 8:10520302-10520324 GCGTTGATGTTCTGCAGCCCAGG - Intergenic
1036925965 8:12906202-12906224 GGGGTCTTGCTCTGCCACCCAGG - Intergenic
1036937455 8:13017095-13017117 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1037098668 8:15016523-15016545 GCGTTCCTGGTCTACGCCCCTGG - Intronic
1037923138 8:22821957-22821979 GAGGTCTTGCTCTGTCGCCCAGG - Intronic
1037940116 8:22944928-22944950 AGGATCCTGCTGTGCCGCCCAGG + Intronic
1037945981 8:22989888-22989910 GCCTGCCTGCTTTGCAGCCCTGG + Intronic
1038023458 8:23569235-23569257 GCAGTCTTGCTCTGTCGCCCTGG - Intronic
1038236791 8:25766483-25766505 GGGTTCTTGCTCTGTTGCCCAGG + Intergenic
1038343443 8:26709376-26709398 AGGGTCTTGCTCTGCCGCCCAGG + Intergenic
1039013004 8:33116117-33116139 GGGTTCTGGCTCTGTCGCCCAGG - Intergenic
1039316321 8:36376674-36376696 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1039327127 8:36497994-36498016 GGGGTCTTGCTCTGCCCCCCAGG + Intergenic
1039447252 8:37642761-37642783 GGGGTCTTGCTCTGTCGCCCTGG + Intergenic
1039458692 8:37725745-37725767 GGGGTCTTGCTCTGCCACCCAGG - Intergenic
1039535535 8:38308788-38308810 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1039557184 8:38484861-38484883 GCCTTCCTGCTCTTCCTTCCTGG - Intergenic
1039588350 8:38726362-38726384 GGGGTCTTGCTCTGCTGCCCAGG + Intergenic
1039954770 8:42198459-42198481 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
1039994808 8:42522653-42522675 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1040459585 8:47634423-47634445 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1041289352 8:56294137-56294159 GAGTTTTTGCTCTGTCGCCCAGG + Intergenic
1041749368 8:61242765-61242787 AGGGTCCTGCTCTGCTGCCCAGG - Intronic
1041983139 8:63887547-63887569 GTTTTCTTGCTCTGTCGCCCAGG + Intergenic
1042134906 8:65623580-65623602 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1042382765 8:68137291-68137313 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1042456883 8:69015605-69015627 GAATTCTTGCTCTGTCGCCCAGG + Intergenic
1042555961 8:70034074-70034096 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1042843388 8:73147149-73147171 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1042924642 8:73954624-73954646 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1043332324 8:79132385-79132407 GGGTTCTTGCTCTGTTGCCCAGG - Intergenic
1043474428 8:80592363-80592385 GGGTTCTTGCTCTGTCACCCAGG - Intergenic
1043519412 8:81027877-81027899 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1044424188 8:92032065-92032087 GGATTCTCGCTCTGCCGCCCAGG - Intronic
1044730952 8:95228335-95228357 GGGGTCTCGCTCTGCCGCCCAGG - Intergenic
1044850027 8:96418977-96418999 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1044887784 8:96798023-96798045 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1044990765 8:97793830-97793852 GGGTTCTTGCTCTGTCGCCCAGG + Intronic
1044992561 8:97808933-97808955 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1045027982 8:98107793-98107815 GGGTTCTTGCTCTGTTGCCCAGG + Intronic
1045226187 8:100248270-100248292 GCAGTCCTGCTCTGTCACCCAGG + Intronic
1045457082 8:102391141-102391163 AGGTTCTTGCTCTGCTGCCCAGG - Intronic
1045467778 8:102485774-102485796 GCTGGCCTGCCCTGCCGCCCCGG - Intergenic
1046451545 8:114398254-114398276 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1046648674 8:116813140-116813162 GCGGTCTTGCTCTGTCGCCCAGG - Intronic
1047268355 8:123330179-123330201 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
1047353069 8:124094509-124094531 GAGTCCCTGCTCTGTCACCCAGG + Intronic
1047410780 8:124622765-124622787 GACTCCCTGCTCTGCCGCCCAGG - Intronic
1047497991 8:125422195-125422217 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1047833596 8:128662755-128662777 GGAGTCCTGCTCTGCCGCCCAGG - Intergenic
1047940271 8:129822489-129822511 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1047955138 8:129969037-129969059 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1047985617 8:130230019-130230041 GCGTTACTGCTCTCCAGCCTGGG + Intronic
1048251826 8:132872450-132872472 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1048559484 8:135518196-135518218 GGGGTCTTGCTCTGCTGCCCAGG + Intronic
1049020921 8:139957255-139957277 GCGTACCTGCCCTGCAGCCTTGG + Intronic
1049743547 8:144252640-144252662 GAGTTCTTGCTCTGTCGCCCAGG - Intronic
1049933965 9:482902-482924 GCCATCCTGCTCTGCCTGCCGGG + Intronic
1050155277 9:2660419-2660441 CCTTTCCTGTCCTGCCGCCCTGG - Intergenic
1050941289 9:11461725-11461747 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1051212855 9:14763467-14763489 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1051245774 9:15109401-15109423 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1051315852 9:15830993-15831015 GGATTCTCGCTCTGCCGCCCAGG + Intronic
1051672178 9:19522032-19522054 GGGTTCTTGCTCTGTTGCCCAGG + Intronic
1051845151 9:21443496-21443518 GCTTGCTTGCTCTGTCGCCCAGG - Intergenic
1052054252 9:23885594-23885616 GGGTTCTTGCTCTGTCACCCAGG - Intergenic
1052207869 9:25865438-25865460 GGGTTCTTGCTATGCTGCCCAGG + Intergenic
1053491964 9:38514082-38514104 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1053585421 9:39453121-39453143 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1053602224 9:39622693-39622715 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1054251311 9:62719745-62719767 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1054565423 9:66754258-66754280 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1054580892 9:66912105-66912127 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1054748509 9:68880527-68880549 GCAGTCTTGCTCTGCCGCCCAGG - Intronic
1054748921 9:68884637-68884659 AAGGTCCTGCTCTGCCACCCAGG - Intronic
1054776055 9:69124401-69124423 GGGTTCTTGCTTTGCTGCCCAGG + Intronic
1054948627 9:70824451-70824473 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1055015953 9:71618493-71618515 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1055510497 9:76991633-76991655 GAAGTCTTGCTCTGCCGCCCAGG + Intergenic
1055551191 9:77433552-77433574 GAGGTCTTGCTCTGCTGCCCAGG + Intronic
1055652863 9:78424036-78424058 ACGGTCTTGCTCTGTCGCCCAGG + Intergenic
1056102926 9:83317099-83317121 TCTTTCTTGCTCTGCCACCCAGG - Intronic
1056171601 9:83990482-83990504 GCATTCTAGCTCTGTCGCCCAGG - Intronic
1056346267 9:85698716-85698738 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1056376733 9:86021505-86021527 GCCTTCCTCCTCTCCTGCCCTGG + Intronic
1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG + Intergenic
1057501517 9:95600579-95600601 GAGTCCCCGCTCTGTCGCCCAGG + Intergenic
1057566252 9:96168477-96168499 GTCTTCTTGCTCTGCTGCCCAGG - Intergenic
1057689971 9:97275295-97275317 GCTTTACTTCTCTGCAGCCCTGG + Intergenic
1057755095 9:97827586-97827608 GAGGTCCCGCTCTGCCGCCCAGG - Intergenic
1057783278 9:98067743-98067765 ACGGTCTTGCTCTGTCGCCCAGG + Intronic
1058051734 9:100413087-100413109 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1059251350 9:112890317-112890339 GGCTTCCTGCTCTCCCGCCTCGG - Exonic
1059583314 9:115576622-115576644 GAGTTCTTTCTCTGTCGCCCAGG + Intergenic
1060185081 9:121559241-121559263 GGGTTCCTTCTCTGTCACCCAGG - Intergenic
1060347522 9:122829596-122829618 ACATTCCTGCTCTGTCACCCAGG - Intergenic
1060390329 9:123271300-123271322 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1060457174 9:123809694-123809716 GCCTTCTTGCTCTGTCACCCAGG + Intronic
1060657827 9:125384737-125384759 ACAGTCCTGCTCTGTCGCCCAGG - Intergenic
1060806364 9:126579792-126579814 GAGGTCTTGCTCTGTCGCCCAGG - Intergenic
1060806449 9:126580464-126580486 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1060833159 9:126732583-126732605 GGTCTCCTGCTCTGCCGCCCAGG + Intergenic
1061088048 9:128410744-128410766 GGATTCTTGCTCTGCCGCCTAGG - Intergenic
1061132900 9:128718260-128718282 GCCTCCCTGCCCTGCCTCCCTGG + Intronic
1061185655 9:129051619-129051641 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1061261508 9:129483010-129483032 GCCTCCCTGCTCCCCCGCCCTGG - Intergenic
1061323246 9:129845557-129845579 GGGTTCTTGCTCTGTTGCCCAGG + Intronic
1061350089 9:130057316-130057338 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1061454705 9:130688907-130688929 GGAATCCTGCTCTGTCGCCCAGG - Intergenic
1061477415 9:130877664-130877686 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1061982324 9:134113317-134113339 GGGGTCCCGCTCTGTCGCCCAGG + Intergenic
1062215227 9:135385386-135385408 AAGGTCTTGCTCTGCCGCCCAGG - Intergenic
1062418194 9:136464374-136464396 GCGTCACTGCTCTGCTGCCCTGG - Intronic
1062530907 9:136999617-136999639 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1185516066 X:699965-699987 GGGATCTTGCTCTGCTGCCCAGG + Intergenic
1185591319 X:1279322-1279344 ACGGTCTTGCTCTGTCGCCCAGG - Intronic
1185610403 X:1391035-1391057 GCGGTCTTGCTCTGTTGCCCAGG + Intronic
1185625349 X:1477161-1477183 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1185666407 X:1768755-1768777 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1185668971 X:1790697-1790719 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1185882311 X:3752253-3752275 GGGTTCTTGCTATGCTGCCCAGG + Intergenic
1185891525 X:3826343-3826365 GCTCTCTTGCTCTGTCGCCCAGG - Intronic
1185896633 X:3864757-3864779 GCTCTCTTGCTCTGTCGCCCAGG - Intergenic
1185901751 X:3903184-3903206 GCTCTCTTGCTCTGTCGCCCAGG - Intergenic
1186016024 X:5194958-5194980 GAGGTCTTGCTCTGCTGCCCTGG - Intergenic
1186206216 X:7203808-7203830 AGGGTCCTGCTCTGCTGCCCAGG + Intergenic
1186220965 X:7349005-7349027 GGGGTCTTGCTCTGCCACCCAGG + Intronic
1186413962 X:9367405-9367427 GGGTTCTTGCTATGCTGCCCAGG - Intergenic
1186454406 X:9699794-9699816 CTGTTTCTGCTCTGCTGCCCTGG + Intronic
1186464004 X:9770282-9770304 CTGTTCTTGCTCTGTCGCCCAGG - Intronic
1186487110 X:9941943-9941965 GAGTCTCTGCTCTGCCACCCAGG - Intronic
1187274161 X:17803983-17804005 GGAGTCCTGCTCTGCAGCCCAGG + Intronic
1187380721 X:18799205-18799227 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1187463299 X:19506544-19506566 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1187850506 X:23587074-23587096 GAGTCTCTGCTCTGTCGCCCAGG - Intergenic
1187876351 X:23807145-23807167 ACGGTCTTGCTCTGCCGTCCAGG - Intergenic
1187916597 X:24158660-24158682 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1187916639 X:24159026-24159048 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1188354645 X:29176117-29176139 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1189125739 X:38443954-38443976 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1189317037 X:40063748-40063770 TCCTTCCTGCTTTGCCGGCCAGG + Exonic
1189394751 X:40611387-40611409 GGGTTCTTGCTCTGTCACCCAGG + Intergenic
1189432522 X:40960339-40960361 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1189845940 X:45138625-45138647 GCGGTCTTGCTCTGTTGCCCAGG - Intergenic
1190196805 X:48326890-48326912 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1190201150 X:48362442-48362464 GCATTCTTGCTCTGTTGCCCAGG + Intergenic
1190234838 X:48607391-48607413 GGGGTCTTGCTCTGACGCCCAGG + Exonic
1190419488 X:50215013-50215035 GCAGTCTTGCTCTGTCGCCCGGG + Intronic
1190571018 X:51781575-51781597 GAGTTCCTGCTATGTTGCCCAGG - Intergenic
1190596284 X:52054727-52054749 GGGTTCTCGCTCTGTCGCCCAGG + Intergenic
1190612540 X:52199346-52199368 GGGTTCTCGCTCTGTCGCCCAGG - Intergenic
1190663538 X:52677245-52677267 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1190664393 X:52683826-52683848 GCGGTCTTGCTCTGTCACCCAGG + Intronic
1190665226 X:52690511-52690533 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1190674196 X:52767908-52767930 GGATTCTTGCTCTGTCGCCCAGG + Intronic
1190675029 X:52774596-52774618 GCGGTCTTGCTCTGTCACCCAGG - Intronic
1190675885 X:52781177-52781199 GGATTCTTGCTCTGTCGCCCAGG - Intronic
1190679795 X:52815975-52815997 GAGGTCTCGCTCTGCCGCCCAGG + Intronic
1190835291 X:54095039-54095061 AAGTTCTTGCTCTGTCGCCCAGG - Intronic
1190860303 X:54338394-54338416 AGGTTCTTGCTCTGTCGCCCAGG - Intronic
1191685807 X:63889104-63889126 AGGTTCCTGCTCTGTCACCCAGG - Intergenic
1192488299 X:71550407-71550429 GAGGTCCTGCTCTGTTGCCCAGG + Intronic
1192489023 X:71557978-71558000 GGGGTCTTGCTCTGTCGCCCAGG + Intronic
1192500687 X:71649488-71649510 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1192577576 X:72255242-72255264 GGGGTCTTGCTCTGTCGCCCAGG - Intronic
1194825228 X:98554069-98554091 AGATTCCTGCTCTGTCGCCCAGG + Intergenic
1195350101 X:103987459-103987481 GCGTCATTGCTCTGCAGCCCGGG - Intergenic
1195351820 X:104003653-104003675 GCGTCATTGCTCTGCAGCCCGGG + Intergenic
1195357343 X:104051380-104051402 GCGTCATTGCTCTGCAGCCCGGG + Intergenic
1195892591 X:109712122-109712144 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
1196280301 X:113816278-113816300 AGGTTCTTGCTCTGTCGCCCAGG - Intergenic
1196706323 X:118720703-118720725 ACAATCCTGCTCTGTCGCCCAGG + Intergenic
1196740760 X:119023999-119024021 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1197207579 X:123803059-123803081 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1197331699 X:125160517-125160539 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1197401038 X:125991265-125991287 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1197434445 X:126408333-126408355 GGATTCCCGCTCTGTCGCCCAGG - Intergenic
1197609293 X:128621095-128621117 GGGGTCTTGCTCTGTCGCCCAGG - Intergenic
1197992493 X:132332942-132332964 TGGGTCTTGCTCTGCCGCCCAGG - Intergenic
1198303025 X:135350030-135350052 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1198467657 X:136917804-136917826 GGATTCTTGCTCTGTCGCCCAGG - Intergenic
1199084030 X:143608532-143608554 GCGGTCTTGCTCTGCCACCCAGG - Intergenic
1199345138 X:146730529-146730551 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1199607983 X:149592047-149592069 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1199631137 X:149777313-149777335 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1200149752 X:153945452-153945474 GGGGTCTTGCTCTGTCGCCCAGG + Intergenic
1200786745 Y:7267373-7267395 ACGGTCTTGCTCTGCCACCCAGG + Intergenic
1201180997 Y:11345412-11345434 GGATTCTTGCTCTGTCGCCCAGG + Intergenic
1201358740 Y:13123414-13123436 GGATTCTTGCTCTGCCACCCAGG + Intergenic
1202296398 Y:23362153-23362175 GAGGTCTTGCTCTGCCACCCAGG - Intergenic
1202574409 Y:26308443-26308465 GAGGTCTTGCTCTGCCACCCAGG + Intergenic
1202575794 Y:26323395-26323417 GGATTCTTGCTCTGTCGCCCAGG + Intergenic