ID: 1113474623

View in Genome Browser
Species Human (GRCh38)
Location 13:110571730-110571752
Sequence CTGGAAATAAATGAGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113474617_1113474623 17 Left 1113474617 13:110571690-110571712 CCTGGGGCAAACATCGTGCGGAT No data
Right 1113474623 13:110571730-110571752 CTGGAAATAAATGAGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113474623 Original CRISPR CTGGAAATAAATGAGGCTGC GGG Intergenic
No off target data available for this crispr