ID: 1113479481

View in Genome Browser
Species Human (GRCh38)
Location 13:110610022-110610044
Sequence TTGTCCCATATTGATGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113479481_1113479485 -10 Left 1113479481 13:110610022-110610044 CCCCCGGCATCAATATGGGACAA No data
Right 1113479485 13:110610035-110610057 TATGGGACAAAATAAAAGCTTGG No data
1113479481_1113479489 29 Left 1113479481 13:110610022-110610044 CCCCCGGCATCAATATGGGACAA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data
1113479481_1113479486 9 Left 1113479481 13:110610022-110610044 CCCCCGGCATCAATATGGGACAA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113479481 Original CRISPR TTGTCCCATATTGATGCCGG GGG (reversed) Intergenic
No off target data available for this crispr