ID: 1113479486

View in Genome Browser
Species Human (GRCh38)
Location 13:110610054-110610076
Sequence TTGGCCATTGACACTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 23 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113479468_1113479486 20 Left 1113479468 13:110610011-110610033 CCCCCCCCCCCCCCCCGGCATCA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479460_1113479486 27 Left 1113479460 13:110610004-110610026 CCCCCCCCCCCCCCCCCCCCCCC 0: 338
1: 643
2: 2692
3: 20931
4: 72602
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479484_1113479486 6 Left 1113479484 13:110610025-110610047 CCGGCATCAATATGGGACAAAAT No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479471_1113479486 17 Left 1113479471 13:110610014-110610036 CCCCCCCCCCCCCGGCATCAATA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479473_1113479486 15 Left 1113479473 13:110610016-110610038 CCCCCCCCCCCGGCATCAATATG No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479469_1113479486 19 Left 1113479469 13:110610012-110610034 CCCCCCCCCCCCCCCGGCATCAA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479462_1113479486 25 Left 1113479462 13:110610006-110610028 CCCCCCCCCCCCCCCCCCCCCGG No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479478_1113479486 12 Left 1113479478 13:110610019-110610041 CCCCCCCCGGCATCAATATGGGA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479464_1113479486 24 Left 1113479464 13:110610007-110610029 CCCCCCCCCCCCCCCCCCCCGGC 0: 9
1: 128
2: 853
3: 3209
4: 23659
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479474_1113479486 14 Left 1113479474 13:110610017-110610039 CCCCCCCCCCGGCATCAATATGG No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479467_1113479486 21 Left 1113479467 13:110610010-110610032 CCCCCCCCCCCCCCCCCGGCATC No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479483_1113479486 7 Left 1113479483 13:110610024-110610046 CCCGGCATCAATATGGGACAAAA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479459_1113479486 28 Left 1113479459 13:110610003-110610025 CCCCCCCCCCCCCCCCCCCCCCC 0: 338
1: 643
2: 2692
3: 20931
4: 72602
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479461_1113479486 26 Left 1113479461 13:110610005-110610027 CCCCCCCCCCCCCCCCCCCCCCG 0: 48
1: 488
2: 1282
3: 6495
4: 46181
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479481_1113479486 9 Left 1113479481 13:110610022-110610044 CCCCCGGCATCAATATGGGACAA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479466_1113479486 22 Left 1113479466 13:110610009-110610031 CCCCCCCCCCCCCCCCCCGGCAT No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479480_1113479486 10 Left 1113479480 13:110610021-110610043 CCCCCCGGCATCAATATGGGACA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479465_1113479486 23 Left 1113479465 13:110610008-110610030 CCCCCCCCCCCCCCCCCCCGGCA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479470_1113479486 18 Left 1113479470 13:110610013-110610035 CCCCCCCCCCCCCCGGCATCAAT No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479476_1113479486 13 Left 1113479476 13:110610018-110610040 CCCCCCCCCGGCATCAATATGGG No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479472_1113479486 16 Left 1113479472 13:110610015-110610037 CCCCCCCCCCCCGGCATCAATAT No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479479_1113479486 11 Left 1113479479 13:110610020-110610042 CCCCCCCGGCATCAATATGGGAC No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data
1113479482_1113479486 8 Left 1113479482 13:110610023-110610045 CCCCGGCATCAATATGGGACAAA No data
Right 1113479486 13:110610054-110610076 TTGGCCATTGACACTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113479486 Original CRISPR TTGGCCATTGACACTGCCTC TGG Intergenic
No off target data available for this crispr