ID: 1113479487

View in Genome Browser
Species Human (GRCh38)
Location 13:110610058-110610080
Sequence TATGCCAGAGGCAGTGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113479487_1113479489 -7 Left 1113479487 13:110610058-110610080 CCATTGACACTGCCTCTGGCATA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113479487 Original CRISPR TATGCCAGAGGCAGTGTCAA TGG (reversed) Intergenic
No off target data available for this crispr