ID: 1113479489

View in Genome Browser
Species Human (GRCh38)
Location 13:110610074-110610096
Sequence TGGCATACCTTTACAAAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113479487_1113479489 -7 Left 1113479487 13:110610058-110610080 CCATTGACACTGCCTCTGGCATA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data
1113479484_1113479489 26 Left 1113479484 13:110610025-110610047 CCGGCATCAATATGGGACAAAAT No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data
1113479481_1113479489 29 Left 1113479481 13:110610022-110610044 CCCCCGGCATCAATATGGGACAA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data
1113479480_1113479489 30 Left 1113479480 13:110610021-110610043 CCCCCCGGCATCAATATGGGACA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data
1113479483_1113479489 27 Left 1113479483 13:110610024-110610046 CCCGGCATCAATATGGGACAAAA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data
1113479482_1113479489 28 Left 1113479482 13:110610023-110610045 CCCCGGCATCAATATGGGACAAA No data
Right 1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113479489 Original CRISPR TGGCATACCTTTACAAAAAG CGG Intergenic
No off target data available for this crispr