ID: 1113480418

View in Genome Browser
Species Human (GRCh38)
Location 13:110616021-110616043
Sequence CGCGGTGGCCGGGGAACGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113480406_1113480418 -4 Left 1113480406 13:110616002-110616024 CCAGGAGCGGCGGAGCCCGCGCG 0: 1
1: 0
2: 0
3: 26
4: 197
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480399_1113480418 19 Left 1113480399 13:110615979-110616001 CCGGGCCGGAGCCAGTGCGCGTC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480400_1113480418 14 Left 1113480400 13:110615984-110616006 CCGGAGCCAGTGCGCGTCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 824
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480403_1113480418 8 Left 1113480403 13:110615990-110616012 CCAGTGCGCGTCCCAGGAGCGGC 0: 1
1: 0
2: 0
3: 15
4: 769
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480405_1113480418 -3 Left 1113480405 13:110616001-110616023 CCCAGGAGCGGCGGAGCCCGCGC 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113480418 Original CRISPR CGCGGTGGCCGGGGAACGGG GGG Intronic
900106913 1:985994-986016 CGAGGTGGCCGGGGTACAGCTGG - Intergenic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900393929 1:2445403-2445425 GGCAGTGGTCGGGGAACTGGTGG + Intronic
902456401 1:16536600-16536622 CGCGGTGCCCGGGGAAGAAGAGG + Intergenic
902495762 1:16871311-16871333 CGCGGTGCCCGGGGAAGAAGAGG - Intronic
902600877 1:17539661-17539683 CGCGGCGCCCCGGGACCGGGCGG + Intergenic
903233846 1:21937281-21937303 CGAGCTGGCCGGCGAGCGGGCGG - Exonic
903324702 1:22563350-22563372 GGCGGTGGCCGCGGGCCGGGTGG + Intergenic
903795096 1:25922822-25922844 CGCGGGGACCTGGGAGCGGGTGG + Intergenic
903953864 1:27011905-27011927 CGGGGTGGAGGGGGAAGGGGGGG + Intronic
906204412 1:43979381-43979403 CGCGGTGGCCGCTGACCGGGCGG + Intronic
906242332 1:44249621-44249643 AGCTGTGGCCTGGGAAAGGGTGG - Intronic
906704482 1:47885004-47885026 CTGGGTGGCAGGGGAAGGGGAGG - Intronic
908131800 1:61082206-61082228 CGGGGGGGCCGGGGAGCGAGCGG + Intronic
912492719 1:110070737-110070759 CGCGGGGGGCGGGGGGCGGGGGG + Intronic
913144640 1:115976873-115976895 CGCGGTGGCCTGGGCCCGGCCGG + Intronic
913516695 1:119611376-119611398 TGCGGTGGCTGGGGAAGGAGGGG - Intergenic
914044075 1:144077110-144077132 CGCGGTGGCGGGGGGGGGGGGGG - Intergenic
915213297 1:154325490-154325512 GGCGGGGGCCGGGGGGCGGGAGG - Intergenic
918015989 1:180632533-180632555 GGCCGGGGCCGGGGAACGGTGGG + Intronic
918282827 1:183023159-183023181 CGAGGTGGGCGGGGAGCCGGGGG - Intergenic
919654015 1:200180271-200180293 CATGGTGGCAGGGGAGCGGGAGG - Intergenic
922739364 1:228006869-228006891 CGCCGGGGCCGGGGCCCGGGCGG - Intergenic
922851282 1:228735763-228735785 CGCAGCGGTCGGGGAACGCGGGG - Exonic
922925118 1:229342129-229342151 CGCGGAGGCCGGGGACGCGGAGG - Exonic
923684124 1:236142365-236142387 CGCGGTGCCCGGGGGAGGGCGGG + Intergenic
924740330 1:246791090-246791112 CCCGCTGGCCTGGGAGCGGGAGG - Intergenic
1063376627 10:5558115-5558137 GGAGGTGGCCGGGGAAGGGCTGG + Intergenic
1065844771 10:29735710-29735732 CGCGGTGGCCGAGGGGCGCGCGG - Intronic
1066758049 10:38730237-38730259 CGGGGTGCGCGGGGAGCGGGGGG + Intergenic
1067980018 10:51074256-51074278 CGCGGTGGCGGGGGAGCGGGAGG - Exonic
1068910553 10:62374512-62374534 CGGGGTGGCCGGGGCTGGGGAGG + Intronic
1072059706 10:91798339-91798361 CGCAGTGGCCGGGCACCGGCTGG - Exonic
1072336493 10:94402835-94402857 CGCGGCGGCCGGGGAGCAGCTGG + Exonic
1073288735 10:102403055-102403077 CGCGGTGTCCGGGGCAGGGCAGG - Exonic
1073461348 10:103667606-103667628 AGCTGTGGGCGGGGAATGGGAGG - Intronic
1076358195 10:129867982-129868004 CGCGGTGGCCGCGGGACGCGCGG - Intronic
1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG + Intronic
1077181610 11:1219534-1219556 CGCTGTGGTCGGGGGAGGGGAGG + Intergenic
1077188069 11:1244310-1244332 GGCGGTGGCCGTGGATCCGGTGG - Exonic
1077188605 11:1246407-1246429 GGCGGTGGCCGTGGATCCGGTGG - Exonic
1077189024 11:1248081-1248103 GGCGGTGGCCGTGGATCCGGTGG - Exonic
1077189587 11:1250265-1250287 GGCGGTGGCCGTGGATCCGGTGG - Exonic
1077189873 11:1251459-1251481 GGCGGTGGCCGTGGAACCGGTGG - Exonic
1077299533 11:1840660-1840682 CGGGGTGGCCGGGGAGGGGCTGG - Intronic
1079004834 11:16784190-16784212 CACTGTGGGCGGGGAACTGGAGG - Intronic
1083741472 11:64713719-64713741 AGCGGGGGCCGGGGGCCGGGCGG - Exonic
1083857425 11:65400052-65400074 TGGGGTGGCCGGGGCAGGGGAGG + Intronic
1084650282 11:70485536-70485558 GGCGGGGGCGGGGGAGCGGGCGG + Intronic
1089619149 11:119712626-119712648 TGTGGTGGCTGGGGAAAGGGAGG - Intronic
1090037488 11:123261610-123261632 CGCGGTGGCCTGCGGAAGGGTGG + Intergenic
1090375167 11:126283166-126283188 CGGGGTCGCGGGGGACCGGGAGG + Intronic
1091740642 12:2958948-2958970 CTGGGAGGCCGGGGAAGGGGCGG - Intergenic
1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG + Intronic
1097101535 12:56593261-56593283 CTTGGTGGCCGGGGAAGGGGTGG - Exonic
1100985656 12:100199830-100199852 CGCGGGGGCCGGGGAACAAACGG - Intronic
1101813708 12:108129620-108129642 AGCGGTGGCCGGGGACGAGGAGG - Intronic
1103377627 12:120469307-120469329 CGCGGAGGCGGGGGGAGGGGAGG + Intronic
1105745725 13:23375525-23375547 CGCGGCGGCCGAGGAGCAGGCGG + Intronic
1109699671 13:66009390-66009412 CGCGGCGGGGGGGGAACCGGGGG + Intergenic
1110572976 13:77026701-77026723 CGCGGGGGCCGGGGCGCGCGCGG - Intronic
1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG + Intronic
1113537466 13:111079573-111079595 CGCGCAGGCCGGGGGACTGGTGG - Intergenic
1113653881 13:112056339-112056361 CGCGGGGGCGGGGGCGCGGGAGG + Intergenic
1117251827 14:53946762-53946784 CGCGGTCGGCGGGGATGGGGAGG + Intergenic
1120941698 14:89955914-89955936 CGCGGCGGCCGCCGAAGGGGCGG + Intronic
1122993220 14:105248657-105248679 GGGGGTGGCAGGGGAGCGGGTGG + Exonic
1124347329 15:28931339-28931361 AGCGGGGGCCTGGGAATGGGAGG + Intronic
1132741269 16:1414507-1414529 CGCGGAGGCCGGGGGGCGCGGGG + Intronic
1133020438 16:2964648-2964670 GGCGGAGGCCGAGGAAGGGGTGG - Intronic
1133036512 16:3036764-3036786 CGGGATCGCCGGGGAACCGGGGG - Intronic
1133156570 16:3880475-3880497 GGCGGCGGCGGCGGAACGGGGGG - Exonic
1133420492 16:5642611-5642633 CTGGGTGGCTGGGGAAGGGGGGG - Intergenic
1134858352 16:17539263-17539285 AGGAATGGCCGGGGAACGGGGGG - Intergenic
1136399796 16:30011071-30011093 CGCGGCGGCGGGGGACGGGGAGG + Exonic
1136478007 16:30525376-30525398 CGGGGTGGCCGGGCCAGGGGTGG - Exonic
1136519452 16:30786700-30786722 CCCGGGGGCCGGGGCAGGGGCGG - Intronic
1136630048 16:31484751-31484773 CGGGCTGGGCCGGGAACGGGAGG + Intronic
1139390640 16:66604868-66604890 CGCGGAGCCCGGGGACCGCGGGG - Exonic
1141805896 16:86341325-86341347 CACAGTGGCCGGGGAACTTGGGG - Intergenic
1141853414 16:86664349-86664371 GGCCGTGGCGGGGGAACAGGTGG - Intergenic
1141959183 16:87392804-87392826 GGCGGTGGCCGGGGTACGGCAGG - Intronic
1142179781 16:88662795-88662817 AGCCGTCGCGGGGGAACGGGTGG + Intronic
1142185633 16:88693538-88693560 CGCGGTGGCCGGGGGTGGGGAGG - Intergenic
1142205242 16:88779805-88779827 CGCGGTGGCCGGGGGTCCGTCGG - Intronic
1142412219 16:89922714-89922736 CGCAGTGGGCGGGGAGGGGGTGG - Intronic
1143584585 17:7844843-7844865 AGCGGTGGCCGGGGGAGGAGGGG - Intronic
1144873333 17:18383412-18383434 CGTGGTGGGCGGGGAAGGGGGGG + Intronic
1147389230 17:40099245-40099267 CCTGGTGGCCGGGGAAGGGCGGG - Intronic
1148060134 17:44830327-44830349 CGCCGCGGCCCGGGAGCGGGGGG + Intronic
1150643630 17:66965243-66965265 CGCGCGGGCCGGGGAGAGGGTGG + Intronic
1151218373 17:72592867-72592889 CGGGGTGGGCGGGGAGGGGGTGG + Intergenic
1151367362 17:73626277-73626299 TGCGTTGGCCGGGGCTCGGGAGG + Intronic
1152433382 17:80261218-80261240 GGAAGTGGCCGGGGCACGGGGGG + Intronic
1152571274 17:81122262-81122284 CGCGGTGGCAGGTGGACTGGGGG + Exonic
1152647735 17:81477561-81477583 CGGGGTAGCCGAGGAAGGGGTGG - Intergenic
1152732103 17:81977504-81977526 CGCCGTGGGTGGGGAAAGGGCGG + Intronic
1152831170 17:82497636-82497658 TGTGGTCGCCGGGGAACGGGCGG + Intergenic
1157136670 18:45063465-45063487 GGCGGTGGCGGGGGCAGGGGCGG - Exonic
1157473728 18:48008413-48008435 GGCGGGGGCCGGGGCATGGGAGG - Intergenic
1158836104 18:61333535-61333557 CGCGGTGGCCGCGGGAGGGCAGG + Intergenic
1159798488 18:72869164-72869186 CGGGGTCGCCGGGGGGCGGGGGG + Intergenic
1160378252 18:78429934-78429956 CCCCGTGGCTGGGGAACGAGAGG - Intergenic
1160659203 19:290692-290714 CGGGGTGGCGGGGGGCCGGGAGG - Intronic
1160861200 19:1237834-1237856 CCCGGTGGCCGCGGAGCAGGCGG + Exonic
1161733752 19:5978013-5978035 GCTGGCGGCCGGGGAACGGGCGG - Intronic
1163435623 19:17293465-17293487 GGGGGTGGGCGGGGAAGGGGCGG + Intronic
1165916526 19:39264402-39264424 CGCGGTGGCCGCGGGACTGTGGG + Intergenic
1166375220 19:42324051-42324073 GGCGGCGGCCGGGGAGCTGGGGG - Intronic
1167437315 19:49486969-49486991 TGTTGTGGCCCGGGAACGGGGGG - Intergenic
1167509475 19:49888518-49888540 CGGGGTGGGCGGGGCCCGGGTGG - Exonic
1168056984 19:53869497-53869519 CGCGGGGGCGGGGGTGCGGGCGG - Exonic
926154736 2:10447787-10447809 CGCGCTGGCCGGGGAGCCGTTGG - Intronic
927156555 2:20224465-20224487 CGCGGTGGCCGGGGCGAGGAGGG + Intronic
927713781 2:25340837-25340859 CGCGGGGGCCGGAAAACGCGGGG - Intronic
929033871 2:37672509-37672531 GGCGGTGGCCGGGTGACCGGCGG - Intronic
929604261 2:43224871-43224893 CGCGGAGGCCGAGGAACAGGAGG + Exonic
929983186 2:46699480-46699502 CGCGGGGGCCGGGGAGCAGGCGG - Intronic
931253270 2:60551411-60551433 CGGGGTTGCCGGGGAAGGGCAGG - Intronic
931364447 2:61606667-61606689 GGGGGTGGCGGGGGAGCGGGTGG + Intergenic
931487196 2:62705637-62705659 CGAGGTGGGCGGGGCACGCGCGG + Intronic
932345850 2:70994769-70994791 CCCGGTGGCCGGGGAGCGGGCGG - Exonic
936104531 2:109613747-109613769 CGCGGGGGCCGGGGAGCGCGGGG + Intronic
936401010 2:112164485-112164507 CACGGTGGCCAGGGAACACGCGG + Intronic
937917461 2:127106159-127106181 TCCGGCGGCCGGGGAGCGGGTGG - Intronic
942891125 2:180990160-180990182 CCTGGTGGCTGGGGAAGGGGAGG - Intronic
944621087 2:201516790-201516812 GGGGGTGGGCGGGGAAGGGGTGG + Intronic
946386416 2:219387044-219387066 AGCGGTGGCCAGGGCAAGGGAGG - Intronic
946422512 2:219572506-219572528 CGCGGTGACCAGGGAAGGTGGGG + Exonic
949047206 2:241877605-241877627 AGCGGTGGCCGGGGAGCTGGGGG - Intergenic
1168760694 20:347792-347814 CTCGGTGGGAGGGGAGCGGGAGG - Intronic
1168765828 20:381200-381222 CCCGGAGGCCGGGGGGCGGGAGG + Intronic
1171963710 20:31514324-31514346 AGCGGTGGCCGAGGGCCGGGCGG - Intergenic
1173488569 20:43458885-43458907 CGCGGGGGACGGGGAAGGGGAGG + Intronic
1174077783 20:47950558-47950580 CTGGGTGTCCTGGGAACGGGTGG - Intergenic
1174140132 20:48406910-48406932 CTGGGTGTCCTGGGAACGGGTGG + Intergenic
1174204348 20:48828036-48828058 CGCGGGGGCCGGGCGAGGGGCGG + Intergenic
1174419720 20:50391635-50391657 CACGGTGGCGGGGGAGCGAGTGG - Intergenic
1174804301 20:53593301-53593323 CGCGATGCCCGGGGAAGGGCCGG - Intronic
1175210437 20:57350857-57350879 CGGGGGGGCGGGGGGACGGGGGG + Intergenic
1176150943 20:63590404-63590426 CGGGGAGGCCGGGGAGCTGGCGG + Exonic
1176431634 21:6579704-6579726 AGCGGTGGCCAGGGGATGGGCGG - Intergenic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1179707028 21:43187166-43187188 AGCGGTGGCCAGGGGATGGGCGG - Intergenic
1180037414 21:45256888-45256910 CTTGGTGGAGGGGGAACGGGAGG - Intergenic
1180109903 21:45642977-45642999 CGCGGTGGGCGGGGATTTGGCGG - Intergenic
1180201594 21:46228044-46228066 CTCGGTGGCCGGGGCTCGGCAGG + Intronic
1183299508 22:37051960-37051982 CGGGGTGGGCGGCGAGCGGGCGG + Intronic
1183575137 22:38683126-38683148 GGGGGTGGCCGGGGGTCGGGGGG + Intronic
1184155208 22:42662586-42662608 CGGGGAGGCCCGGGAGCGGGAGG + Intergenic
1184640235 22:45866709-45866731 CGCCGTGGCCCGGGGACGCGAGG + Intergenic
1185268665 22:49918456-49918478 CGCGAGGGGCGGGGAGCGGGAGG + Exonic
1185417823 22:50719947-50719969 CGTGGTGGGCGGGGAATGGAGGG - Intergenic
958453861 3:94306075-94306097 CGGGGTGGCGGGGGGGCGGGGGG + Intergenic
959256826 3:104025772-104025794 CTCGGTGGCGGGGGCGCGGGTGG + Intergenic
960739593 3:120818541-120818563 CGCGGGGGCAGGGGCAAGGGAGG - Intergenic
961512134 3:127409591-127409613 CACGGGGGCCGGGGGACAGGAGG - Intergenic
961665780 3:128492555-128492577 CGCGGTGGCCTGGGGATTGGGGG + Intronic
966998314 3:185307539-185307561 CGGGGTGGCGGGGGAGGGGGTGG - Intronic
968047349 3:195631722-195631744 CGGGGTGGCGGGGGGGCGGGTGG - Intergenic
968307264 3:197658202-197658224 CGGGGTGGCGGGGGGGCGGGTGG + Intergenic
968473161 4:791176-791198 GGCGGGGGGCGGGGAGCGGGGGG + Intronic
968640437 4:1712004-1712026 CGCGGTCGGCTGGGCACGGGAGG + Intronic
968908052 4:3463557-3463579 CGGGGCGGGCGGGGGACGGGGGG + Intronic
969490430 4:7496445-7496467 GACGGGGGACGGGGAACGGGTGG - Intronic
969734362 4:8977185-8977207 ATCCGGGGCCGGGGAACGGGGGG - Intergenic
975401504 4:73944284-73944306 CGCAGTAGCCGGGGAGCGCGGGG + Intergenic
977689925 4:99894566-99894588 CGCGGTGGGCGGGGGAGGGGCGG - Intergenic
977694330 4:99949894-99949916 CGCGGCGGGGGGCGAACGGGCGG - Intronic
979205613 4:118033794-118033816 CGCGGTGCCCGGGGTCCGGCGGG - Intronic
979523832 4:121697086-121697108 CGCTGAGGCCGGGGCAGGGGCGG - Exonic
986315352 5:6583188-6583210 CGCGGGAGGCGGGGAACGCGGGG + Intergenic
988616419 5:32779469-32779491 CGGGGTGGCCAGAGAACGGAGGG - Intronic
996862784 5:128084137-128084159 CGCGGCGGCCGGGGACGGGCTGG + Exonic
997120050 5:131164764-131164786 CGAGGCAGCCGGGGAACCGGCGG + Intronic
997266326 5:132497114-132497136 GGCGGGGGCCGGGGGACGGGCGG + Intergenic
998406234 5:141876286-141876308 CGCGGTGGCCTGGGTGCGGGGGG - Intronic
1001035052 5:168291639-168291661 CGCGCTGCCCCGGAAACGGGAGG - Intronic
1001673420 5:173492838-173492860 TGCGGGGGGCGGGGAGCGGGGGG - Intergenic
1003868727 6:10385133-10385155 CGTGGCGGCCGGGGAGCGCGAGG - Intergenic
1005826087 6:29632638-29632660 CGCGGGGGCCGGGGGAGAGGAGG - Intronic
1005883247 6:30075606-30075628 CACGGTGGTCGCGGAAGGGGCGG - Exonic
1005953866 6:30649877-30649899 CGGGGTGGCAGGGGAAGGGTGGG - Exonic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1006860689 6:37170087-37170109 CGCGGCGGGCGGGGACGGGGCGG - Intergenic
1007636263 6:43301594-43301616 AGTGGCCGCCGGGGAACGGGTGG + Exonic
1007785387 6:44276628-44276650 CGCGGGGGGCAGGGAAAGGGAGG + Exonic
1013369169 6:109455283-109455305 CGCGGCGGGCTGGGAACGGAGGG - Intronic
1014001237 6:116368927-116368949 GGCGGGGGCGGGGGGACGGGGGG + Intronic
1017163968 6:151390948-151390970 CGCGGTGGCGGCGGGAAGGGAGG + Intronic
1019733561 7:2639861-2639883 CCCGGTGGCCAGAGAAGGGGTGG - Intronic
1019868017 7:3731148-3731170 CGCAGTGGCAGGGTGACGGGCGG + Intronic
1020080330 7:5283086-5283108 AGCGGTGGCCGCGGGACGCGGGG + Intronic
1020274372 7:6615698-6615720 CGCGGGGGCCGGGGCGGGGGCGG - Exonic
1020314613 7:6896440-6896462 CGTGGTGACCTGGGACCGGGGGG + Intergenic
1023381126 7:39609698-39609720 CCATGTGGCCGGGGACCGGGAGG - Intronic
1025198586 7:56949093-56949115 AGCGGTGGCCGCGGGACGCGGGG - Intergenic
1025673366 7:63627843-63627865 AGCGGTGGCCGCGGGACGCGGGG + Intergenic
1026866625 7:73828072-73828094 GGCGGGGGCCGGGGGCCGGGGGG + Intronic
1026892443 7:73990228-73990250 GGCGGTGGCCGGGGTGTGGGTGG - Intergenic
1028641176 7:93043636-93043658 CGCGGGGGCTGCGGAGCGGGCGG + Intergenic
1029896502 7:103989733-103989755 CGCGGGGGCGGGGGAGCGGCCGG - Intergenic
1032263154 7:130352349-130352371 CGCGGGGGCCGGGGATGGAGGGG + Intronic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1033656831 7:143380835-143380857 CGGGGTGGCCGGGTAGCGGGTGG + Intergenic
1034281515 7:149858105-149858127 CGTGGTGGATGGGGAATGGGTGG - Intronic
1034457036 7:151176158-151176180 CGCGGTGGCAGGGGGAGGCGGGG + Exonic
1034470456 7:151251890-151251912 GGCGGCGGCCGGGGAGCTGGGGG + Intronic
1034470512 7:151252033-151252055 CGCGGCGGCCGGGGAGGCGGCGG + Intronic
1035696805 8:1603964-1603986 CGCGGTGGCTGGGGTATGTGGGG - Intronic
1035854500 8:2959637-2959659 CACGCTGGCTGGAGAACGGGAGG + Intronic
1036195299 8:6708562-6708584 CGCGGCGGCCCGGGCCCGGGCGG + Exonic
1036664559 8:10730324-10730346 CCCGGGGGCCGGGGGACGGCCGG + Intronic
1040065453 8:43140813-43140835 CGCGGAGGCGGGGGAGGGGGCGG + Intronic
1040729113 8:50421037-50421059 GGCGGTGGGCGGGGGAGGGGGGG + Intronic
1044685666 8:94823437-94823459 CGCGGAGGCGGCGGACCGGGAGG + Exonic
1047277427 8:123416669-123416691 CGCGGTGGGCGGGGCCAGGGCGG - Intergenic
1049109701 8:140635387-140635409 GGCAGGGGCCGGGGATCGGGGGG - Intronic
1049772784 8:144391483-144391505 CCTGCTGGCCGGGGAAGGGGTGG - Intronic
1053198424 9:36136938-36136960 CGCGGTTTCCGGGGAACCCGGGG + Intronic
1057490632 9:95517031-95517053 CGCGGGGGGCGGGGAGAGGGTGG - Intronic
1057600072 9:96450180-96450202 GGCGGTGGCGGCGGAGCGGGCGG + Intronic
1058416382 9:104793223-104793245 CGCCATGGCCGTGGAAGGGGTGG - Exonic
1059960163 9:119556822-119556844 GGCGGTGGCGGGGGGACAGGGGG - Intergenic
1060813967 9:126625263-126625285 CGTGGGGGCGGGGGAAGGGGTGG + Intronic
1061489821 9:130938736-130938758 CGGGGCGGCCCGGGAGCGGGCGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062230466 9:135479455-135479477 GGAGGTGGCCGCGGTACGGGAGG + Intronic
1062285155 9:135769597-135769619 CCGGGTGCCCGGGGAACGGGGGG + Intronic
1062292958 9:135805605-135805627 GGCGGTGGAAGGGGAAGGGGAGG - Intergenic
1062569953 9:137180416-137180438 CGGGGCGGCCGGGCAGCGGGCGG + Intronic
1188005506 X:25013577-25013599 CGCGCGGCCCGGGGAACGGCCGG - Exonic
1192125621 X:68498653-68498675 CTCGGTAGCCGGGGAAGGGAAGG + Exonic
1197746250 X:129933356-129933378 CGAGGTGGGCGGGTCACGGGAGG + Intergenic
1198394738 X:136209566-136209588 CGTGGTGGCATGGGAACGTGGGG + Intronic