ID: 1113480418

View in Genome Browser
Species Human (GRCh38)
Location 13:110616021-110616043
Sequence CGCGGTGGCCGGGGAACGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113480405_1113480418 -3 Left 1113480405 13:110616001-110616023 CCCAGGAGCGGCGGAGCCCGCGC 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480400_1113480418 14 Left 1113480400 13:110615984-110616006 CCGGAGCCAGTGCGCGTCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 824
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480399_1113480418 19 Left 1113480399 13:110615979-110616001 CCGGGCCGGAGCCAGTGCGCGTC 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480406_1113480418 -4 Left 1113480406 13:110616002-110616024 CCAGGAGCGGCGGAGCCCGCGCG 0: 1
1: 0
2: 0
3: 26
4: 197
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212
1113480403_1113480418 8 Left 1113480403 13:110615990-110616012 CCAGTGCGCGTCCCAGGAGCGGC 0: 1
1: 0
2: 0
3: 15
4: 769
Right 1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG 0: 1
1: 0
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113480418 Original CRISPR CGCGGTGGCCGGGGAACGGG GGG Intronic