ID: 1113480604

View in Genome Browser
Species Human (GRCh38)
Location 13:110617321-110617343
Sequence AAGAACAGGTTAAATTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113480604_1113480607 12 Left 1113480604 13:110617321-110617343 CCAAACAAATTTAACCTGTTCTT 0: 1
1: 0
2: 3
3: 21
4: 366
Right 1113480607 13:110617356-110617378 TTGTCTGAAGAGTTACCGAATGG 0: 1
1: 0
2: 0
3: 4
4: 72
1113480604_1113480608 13 Left 1113480604 13:110617321-110617343 CCAAACAAATTTAACCTGTTCTT 0: 1
1: 0
2: 3
3: 21
4: 366
Right 1113480608 13:110617357-110617379 TGTCTGAAGAGTTACCGAATGGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113480604 Original CRISPR AAGAACAGGTTAAATTTGTT TGG (reversed) Intronic
900011319 1:111987-112009 AAATACAGGTTAAATGTGTGTGG - Intergenic
900027423 1:288553-288575 AAATACAGGTTAAATGTGTGTGG - Intergenic
900041378 1:467995-468017 AAATACAGGTTAAATGTGTGTGG - Intergenic
900062812 1:702972-702994 AAATACAGGTTAAATGTGTGTGG - Intergenic
903109600 1:21119565-21119587 AAGAATAAGTTAACTTTATTTGG + Intronic
903117941 1:21193519-21193541 AAGAACAGGTTAGATTAGACTGG - Intergenic
903759710 1:25689445-25689467 ACGAACAGGTTCTATTTGTCAGG - Intronic
905033346 1:34902199-34902221 AAGAACAGGTTAAATGGGGTAGG + Intronic
905572605 1:39017595-39017617 AAGAAAAGGTAAAAATTCTTGGG - Intergenic
908703598 1:66926967-66926989 AATAAAAGGTTATATTTCTTAGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909611916 1:77560218-77560240 AAGAAGAAATTAAATTTCTTTGG + Intergenic
909796614 1:79747374-79747396 AAGGACAGGCTGACTTTGTTAGG - Intergenic
910046459 1:82923591-82923613 AAGAACATGTGAAAATTCTTTGG + Intergenic
910491573 1:87778279-87778301 AAGAAAGGATTAAATTTGCTGGG - Intergenic
910555679 1:88529728-88529750 CAGGAGAGGTTACATTTGTTTGG + Intergenic
910567440 1:88660758-88660780 AAGCACACATTAAATTTCTTTGG - Intergenic
910824994 1:91397369-91397391 AAGAACAAGTCAACTTTGATGGG - Intronic
911928507 1:103869140-103869162 AAAAACAGGCTACATTTGGTGGG - Intergenic
913452572 1:119001870-119001892 AAGGAGAGGTTGAATTTGTCAGG + Intergenic
914855702 1:151348775-151348797 AATAACAGCTAAAATTTATTTGG + Intergenic
915298038 1:154935535-154935557 AAGATAAAGTTGAATTTGTTTGG + Intronic
916464268 1:165058208-165058230 AAGAATAGGTTTAATTAATTAGG + Intergenic
916996410 1:170306497-170306519 AAGAAAAGGTTAACTATTTTGGG + Intergenic
918899114 1:190389803-190389825 AAGAACAGGATAAATGGTTTGGG + Intronic
920270564 1:204760225-204760247 CAGACCAGGTTAAATTTTATGGG + Intergenic
920628042 1:207623088-207623110 AAGTACAGTTTACATTTCTTGGG - Intronic
920638101 1:207724728-207724750 AAGTACAGTTTACATTTCTTGGG - Intronic
921598308 1:217079361-217079383 AAGACCATGTTAAATGTGTCAGG + Intronic
922259758 1:223927997-223928019 AAATACAGGTTAAATGTGTGTGG - Intergenic
922681283 1:227598856-227598878 AAGAAAAGAATAAATTTGGTAGG - Intronic
923826399 1:237505218-237505240 AACAACAGCTAACATTTGTTGGG - Intronic
923894136 1:238250294-238250316 AAGAACAGTTTAACTTTGGGAGG + Intergenic
924054350 1:240111074-240111096 AATAACAGGTAACATTTATTGGG + Intronic
924340922 1:243030559-243030581 AAATACAGGTTAAATGTGTGTGG - Intergenic
1063604997 10:7515360-7515382 AAGAAGAGGTTGAATTCGATGGG + Intergenic
1064308642 10:14191017-14191039 AAGAACTGGCTAAAGTTGGTTGG - Intronic
1064819032 10:19303034-19303056 AACAAAAGATTAAATATGTTTGG + Intronic
1064932748 10:20644931-20644953 AAGAAAAGGTTATATCTGTCAGG - Intergenic
1066098982 10:32100031-32100053 AATTACAGTTTAAAATTGTTTGG - Intergenic
1066356881 10:34693257-34693279 CAGAACAGTTTATATTTCTTTGG - Intronic
1066620621 10:37345333-37345355 AAGAACAGCATAAATTTCTCAGG - Intronic
1067514512 10:46926290-46926312 CAGAACAAGTTAAATTTTGTTGG + Intronic
1067647748 10:48125523-48125545 CAGAACAAGTTAAATTTTGTTGG - Intergenic
1068779980 10:60909057-60909079 AAGAGCAGCTTATTTTTGTTGGG + Intronic
1069301912 10:66918719-66918741 AAGAACTTGTTAATTTTATTAGG + Intronic
1070070446 10:73084094-73084116 AAAAATAGGTGAAATTTGTTTGG - Intronic
1072985412 10:100135313-100135335 AAATACAGGTTAATTTTCTTTGG - Intergenic
1076279827 10:129237020-129237042 AAGAAGAGATTTAATTTCTTGGG + Intergenic
1076967652 11:104223-104245 AAATACAGGTTAAATGTGTGTGG - Intergenic
1077948775 11:6931546-6931568 ATGAAAAGTTTATATTTGTTAGG - Intronic
1080540945 11:33264475-33264497 AAAAACAGTTTAGATTTGATAGG + Intronic
1080544024 11:33298089-33298111 CAGAACAGGCTAGCTTTGTTGGG + Intronic
1082120005 11:48370021-48370043 AAGAACAGGATAAATTGGTTTGG - Intergenic
1082254283 11:50015205-50015227 GAGAACAGGATAAATTGTTTTGG + Intergenic
1082297214 11:50456407-50456429 AATAAGAGTTTAAATTTGTGAGG - Intergenic
1082306064 11:50576943-50576965 AAGAAAAGTTTAACTTTGCTGGG + Intergenic
1082306101 11:50577628-50577650 AAGAAAAGTTTAACTTTGCTGGG + Intergenic
1082311893 11:50660286-50660308 AAGAACAGTTTAACTCTGTGAGG + Intergenic
1082585461 11:54932673-54932695 AAGAAAGGTTTAATTTTGTTAGG + Intergenic
1082593089 11:55038946-55038968 AAGAACAGTTTAACTCTGCTAGG + Intergenic
1085136158 11:74090581-74090603 AGGCACAGGATAAAATTGTTGGG + Intronic
1085495230 11:76962909-76962931 AAGAAAAGGAAAAATTAGTTAGG + Intronic
1087091309 11:94276225-94276247 AAGAACACTTTACATTTGTAGGG + Intergenic
1087428842 11:98024947-98024969 AAGGACAGATCCAATTTGTTTGG - Intergenic
1087946107 11:104162916-104162938 CAGAACAGCTAAAATTTGCTGGG + Intronic
1088395830 11:109367831-109367853 AAGAATAGGTTAAAAATCTTTGG - Intergenic
1088758834 11:112910274-112910296 ATGAACAGGTCAAATTTGTTAGG + Intergenic
1089153186 11:116380427-116380449 AAGAACAAATTAAATTGGGTGGG + Intergenic
1089864840 11:121622746-121622768 AAGAACACCTTGATTTTGTTTGG + Intronic
1089899569 11:121966645-121966667 AAGAACAGTTTACATTGGGTTGG + Intergenic
1089913902 11:122132715-122132737 AAGAACAGGTAAAATTTTGATGG - Intergenic
1090755402 11:129785734-129785756 AGGAACTGTTTAAATATGTTGGG + Intergenic
1092070606 12:5628397-5628419 CAGAAAAGTTTAAATTTATTGGG - Intronic
1092894342 12:12998611-12998633 AAGAACAGGTGAAAGGTCTTTGG + Intronic
1093132753 12:15412425-15412447 AAAAACAGGAAAAATATGTTTGG - Intronic
1094182467 12:27606629-27606651 ATAAACAGATAAAATTTGTTAGG + Intronic
1094448027 12:30553821-30553843 AATAACAGCTAAAATGTGTTGGG + Intergenic
1094561827 12:31561994-31562016 AATAACAGGTTACATTAATTGGG + Intronic
1095082187 12:38016127-38016149 AGGAACAGTTTAACTTTGTGAGG - Intergenic
1095590096 12:43893635-43893657 AAGAACAGGTAACATTTGGATGG - Intronic
1095770954 12:45956498-45956520 AAGAACTGGTTAAATGTGATAGG - Intronic
1098775842 12:74614907-74614929 AAAACCATGTTAAAATTGTTTGG + Intergenic
1098869597 12:75802059-75802081 AGAAATAGGTTATATTTGTTGGG + Intergenic
1099142179 12:78992332-78992354 AAGAACAAGTCAAAATAGTTTGG - Intronic
1100029366 12:90167292-90167314 AAGAACATGTTAAATGTTCTTGG + Intergenic
1102290276 12:111693558-111693580 AAGAAGTGGTTAAATTCTTTGGG - Intronic
1103713245 12:122928689-122928711 AAGAACAGGTGGCATTTGTTGGG + Intronic
1105626353 13:22116788-22116810 AAAATCAGGTTATATTTCTTAGG + Intergenic
1106273758 13:28182544-28182566 AATAACAAGTTAAATTCTTTGGG + Intronic
1107441921 13:40435468-40435490 AAGAGCAGATTAATTTTGCTTGG + Intergenic
1107582547 13:41806611-41806633 AAGAACAGCTTAAATCTGGGAGG + Intronic
1107953059 13:45483453-45483475 AACAAAAGGTTAAAATTTTTTGG - Intronic
1108486139 13:50927756-50927778 AAAAACAGATTAATTTTCTTTGG + Intronic
1109024056 13:57138558-57138580 AAGAACTTGTTAAAATTCTTGGG + Intergenic
1109318910 13:60785412-60785434 AAGAAAATGATAAATTTTTTTGG + Intergenic
1109665179 13:65525180-65525202 AAGAACACTTTAAATTCCTTTGG - Intergenic
1110498060 13:76191913-76191935 AAGGAGAGCTTAAAATTGTTTGG - Intergenic
1110529434 13:76579019-76579041 AAGAATAGGTTATATATGGTTGG - Intergenic
1110844451 13:80178132-80178154 AAGAAAAGGATAAAAATGTTTGG - Intergenic
1111305173 13:86402343-86402365 AAGAAGTGATTAACTTTGTTGGG + Intergenic
1111768587 13:92567259-92567281 AAGAACAGGGTAAAGATGATGGG - Intronic
1111813900 13:93126051-93126073 AAGAACAAGCTAAATTACTTTGG - Intergenic
1111951999 13:94715990-94716012 AAGAACAGTATAGATTTGATCGG + Intergenic
1112209326 13:97359667-97359689 AAGAACAGCTTAAGTGTGTCTGG + Intronic
1113480604 13:110617321-110617343 AAGAACAGGTTAAATTTGTTTGG - Intronic
1114536019 14:23423192-23423214 AAGAACATGATAAATTTCTTTGG - Intronic
1114598245 14:23932806-23932828 AAAAATAGGTTTAATTTCTTCGG - Intergenic
1116367156 14:44081894-44081916 AAAAACATGTAAAACTTGTTGGG - Intergenic
1116920948 14:50573858-50573880 AATAAAAGGTTAAACTTATTAGG - Intronic
1117305101 14:54466284-54466306 AAGTACTGGTAAAATTTGGTAGG + Intergenic
1117967011 14:61216591-61216613 AAGTAGAGGTGAAATTTGCTGGG - Intronic
1118432358 14:65732083-65732105 AAGAAAATGTCACATTTGTTCGG - Intronic
1118937880 14:70304535-70304557 AATAAAATGTAAAATTTGTTAGG - Intergenic
1119457318 14:74767215-74767237 AAGAAACTGTTAACTTTGTTAGG - Intronic
1119565036 14:75621434-75621456 AAGAAATGGTTTAATTTGTTGGG + Intronic
1120116260 14:80621281-80621303 AAGAACAGGCTAAATTAGTCAGG + Intronic
1120641345 14:87016970-87016992 AAGAAAAGCTTATATATGTTAGG + Intergenic
1122278225 14:100606134-100606156 ACGAACATGTTAACTGTGTTAGG + Intergenic
1124643624 15:31417937-31417959 AAAAAAAGGTAAAGTTTGTTAGG - Intronic
1125237025 15:37526691-37526713 AAGAACAGGATCTATTTGATAGG + Intergenic
1126403915 15:48303197-48303219 AACAAAAGGTTAAGTTTGTCTGG - Exonic
1126607577 15:50494062-50494084 TTGCACAGGTCAAATTTGTTGGG + Exonic
1127057030 15:55142744-55142766 AAAAACAGGTTCAAGTTGATTGG - Intergenic
1128157876 15:65403171-65403193 GGGAACTGGCTAAATTTGTTTGG + Intronic
1129905977 15:79187477-79187499 ACGAGCATGTTACATTTGTTGGG - Intergenic
1132832208 16:1933907-1933929 ACGAACAGGATAAATTTGGGGGG + Intergenic
1133760465 16:8794658-8794680 ATTAAAAGGATAAATTTGTTAGG + Intronic
1135514976 16:23124330-23124352 AAGAAAAGGTTAAAATTGTAAGG + Intronic
1136721599 16:32323181-32323203 AAGAACATTTTTAATTTGTAAGG - Intergenic
1136839979 16:33529469-33529491 AAGAACATTTTTAATTTGTAAGG - Intergenic
1137619878 16:49869239-49869261 ATGAAAATGTTACATTTGTTGGG + Intergenic
1138076974 16:54052350-54052372 AAGAGCTGATTAAATTTGTATGG + Intronic
1138330411 16:56210458-56210480 AAGAACAGGTTTAGTTTTGTAGG + Intronic
1138480830 16:57302183-57302205 AAATACAGGTGAATTTTGTTAGG + Intergenic
1138700703 16:58859968-58859990 AGGAACAGGTTCAATTCATTAGG - Intergenic
1142453029 16:90194916-90194938 AAATACAGGTTAAATGTGTGTGG + Intergenic
1203004833 16_KI270728v1_random:194589-194611 AAGAACATTTTTAATTTGTAAGG + Intergenic
1203136383 16_KI270728v1_random:1730708-1730730 AAGAACATTTTTAATTTGTAAGG + Intergenic
1203150146 16_KI270728v1_random:1829754-1829776 AAGAACATTTTTAATTTGTAAGG - Intergenic
1143983352 17:10890079-10890101 TAGAACAGTTTATATTTCTTTGG + Intergenic
1148056736 17:44802692-44802714 AAGATAAGGTTAAATTTTCTAGG + Exonic
1149400707 17:56293282-56293304 AAGATTAGGATAAATATGTTTGG - Intronic
1149713419 17:58763644-58763666 AAGTACATTTTAAATTTATTAGG + Intronic
1149989613 17:61375297-61375319 AAAAACAGCTCATATTTGTTGGG - Intronic
1150668915 17:67172149-67172171 AAAAACAGGTAAGATTTGTCAGG - Intronic
1150738986 17:67764564-67764586 AAGATCAGGTTAAAACTCTTTGG - Intergenic
1152803600 17:82343929-82343951 AAGAAAAGGAAAAATTAGTTGGG + Intergenic
1152934489 17:83128075-83128097 AAGATCAGCTTAAAATAGTTTGG + Intergenic
1155118650 18:22796272-22796294 AAGTACATGTTTAATTTGATAGG - Intergenic
1155626193 18:27837802-27837824 AAAAAAAGGTTAATTTTATTTGG + Intergenic
1156201464 18:34836662-34836684 AAAAAAAGGTCAATTTTGTTGGG + Intronic
1157098170 18:44706138-44706160 AAGAACAAGTTACATGTGTGGGG - Intronic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1157814114 18:50718784-50718806 AAGAAAAGGTAAAATAGGTTGGG + Intronic
1159683673 18:71388919-71388941 AAGCACAACTTATATTTGTTAGG - Intergenic
1159969539 18:74632340-74632362 AAGAAAAGGTTTAATCTTTTAGG + Exonic
1160644456 19:173846-173868 AAATACAGGTTAAATGTGTGTGG - Intergenic
1161160528 19:2759298-2759320 AAGAACAGAACAAATTTGTCAGG + Intronic
1162758202 19:12873067-12873089 CAGAACAGGTTGGTTTTGTTTGG + Intronic
1163299433 19:16434464-16434486 AAGAAAAGGCCAAATTTGATGGG - Exonic
1164833758 19:31343246-31343268 AAGAATAATTTAAATTTGTTTGG - Intronic
925939840 2:8806576-8806598 AAGAAAAGGTTAAATAAGGTTGG - Intronic
926421813 2:12707397-12707419 AAGAACGAGTTACTTTTGTTGGG - Intergenic
927030420 2:19115769-19115791 AAGAACAAGTTTAATGTTTTGGG + Intergenic
927366254 2:22300211-22300233 AATATCAGGGTAAATGTGTTAGG + Intergenic
928081928 2:28319533-28319555 AACAACAGGTTAACTCTGCTTGG + Intronic
930175112 2:48293652-48293674 AAGAAAAGGTGGAATTTGATTGG - Intergenic
930573790 2:53120886-53120908 AAATACAGGTTAATTTTGTATGG - Intergenic
931542706 2:63347090-63347112 AACAACAGGTAATATTTATTAGG + Intronic
932003763 2:67907671-67907693 AAGTTTAGGGTAAATTTGTTTGG - Intergenic
932746656 2:74339263-74339285 AAGAACAGCTAATATTTGCTGGG + Intronic
933301381 2:80545016-80545038 AAGAAGGGGTGAAATTAGTTCGG + Exonic
935535087 2:104284567-104284589 GATAACATGGTAAATTTGTTAGG + Intergenic
937720778 2:125092899-125092921 AAGAACAGCATAAATATGTTGGG + Intergenic
937729803 2:125214878-125214900 AAGAAGAAGACAAATTTGTTTGG - Intergenic
939113665 2:138036828-138036850 AGGCAAAAGTTAAATTTGTTGGG + Intergenic
939605674 2:144252693-144252715 AAGAGCATGTTAAATTTTGTAGG - Intronic
939858954 2:147394680-147394702 GAGAAGAGGTTATATTTGGTGGG - Intergenic
940182581 2:150952288-150952310 AAGAATAGGTTAAATGTATAAGG + Intergenic
940457910 2:153924543-153924565 AAGAACAGTTTATATTCCTTTGG + Intronic
940536068 2:154946075-154946097 AAGAACAGCTTGAATTTTATAGG + Intergenic
940599009 2:155834271-155834293 AGGACCAAGTTAAATTTGGTTGG - Intergenic
940831710 2:158473885-158473907 AAAATCAGGTAAAATTTGTGTGG + Intronic
940964183 2:159819372-159819394 AAGAAGAGGTGAAACTTGGTTGG - Intronic
942250748 2:174045795-174045817 AAGTATATGTTAAATGTGTTGGG + Intergenic
942683000 2:178498028-178498050 AAGATCAGATTAAATTGTTTTGG - Intronic
942825533 2:180170441-180170463 AAGCATAGGTTAAAATAGTTTGG - Intergenic
944156716 2:196614944-196614966 GAGAACATGTGAAATTTGTCTGG + Intergenic
946101549 2:217329271-217329293 AAGAACAGGATAAATTATTCAGG + Intronic
946956147 2:224931885-224931907 AAGAACAGCTTGAATTTCTGAGG - Intronic
949084469 2:242139579-242139601 AAATACAGGTTAAATGTGTGTGG + Intergenic
1170646409 20:18199760-18199782 ATAAACATTTTAAATTTGTTTGG - Intergenic
1172564336 20:35917142-35917164 AAGAACATGTTAGAGTTGTCAGG + Intronic
1173228826 20:41178388-41178410 AAGAACAAGTGAAATGTTTTTGG + Intronic
1173989419 20:47289274-47289296 AAGAACAGGTAAAATTTAAAAGG + Intronic
1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG + Intergenic
1174762711 20:53222196-53222218 CAGAAGAGGTAAAATTTGTGGGG - Intronic
1175470672 20:59224818-59224840 AATAACATATTTAATTTGTTTGG - Intronic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1176281050 20:64312062-64312084 AAATACAGGTTAAATGTGTGTGG + Intergenic
1176588366 21:8613079-8613101 CAGAACAGGTGAAAGTGGTTTGG + Intergenic
1176670436 21:9729091-9729113 CAGAAAAGTCTAAATTTGTTAGG - Intergenic
1177871431 21:26577840-26577862 AAAAACAGTTTACATTTGATGGG - Intergenic
1177947828 21:27493991-27494013 GAGAACAGGTTGAATTTTATAGG + Intergenic
1179810745 21:43867460-43867482 ATGAACAGGGTAAATGTGATTGG - Intronic
1180271198 22:10590075-10590097 CAGAACAGGTGAAAGTGGTTTGG + Intergenic
1181296436 22:21843658-21843680 AAGAACAGGTGAGATTTATTAGG + Intronic
1184107845 22:42378879-42378901 AAGATCAGGTGAGACTTGTTTGG + Intergenic
1184939383 22:47749931-47749953 AAGTACAGGTCAAAGTTGTGAGG + Intergenic
949138964 3:608686-608708 TAGAACAGGTAAAAGTGGTTTGG - Intergenic
949806085 3:7957263-7957285 AAGATCAGATTAATTTTCTTTGG - Intergenic
953431399 3:42843627-42843649 AGAAACAGGTTAATTTTGCTGGG + Intronic
955088361 3:55724903-55724925 ATGAACAGGTTAAAGTTGAAGGG + Intronic
956345233 3:68271020-68271042 AAAAATAGGTAAAATTTATTGGG + Intronic
957104823 3:75873424-75873446 AAGAAAAGGGTTAATTTGTTTGG - Intergenic
957494044 3:80967471-80967493 AAAAACAGGTTCCATTTGGTGGG + Intergenic
959084713 3:101839544-101839566 AAGAAAAGGCTAAATTTGGAAGG - Intronic
959156985 3:102678987-102679009 AAGCACAGGATGAAGTTGTTCGG + Intergenic
959395448 3:105831605-105831627 AAAGACAGTTAAAATTTGTTGGG + Intronic
959521839 3:107330479-107330501 AGGAAAAGGTGAAAGTTGTTTGG - Intergenic
959608922 3:108272191-108272213 ATGAAGAGGATAAATGTGTTAGG + Intergenic
960124157 3:113979873-113979895 ATGCACTGGATAAATTTGTTAGG + Intronic
962907287 3:139815946-139815968 AAGAACAACTTAAATATGGTAGG - Intergenic
963502122 3:146140776-146140798 AAGAAGAGGTTATATTTGTTTGG - Intronic
964678665 3:159313041-159313063 AAGAACCTATTAAATCTGTTTGG + Intronic
965952546 3:174328149-174328171 AAGAGCAAGTTAAATTGGTAAGG - Intergenic
966581419 3:181569837-181569859 AAGAACAAATTAAATCTTTTTGG - Intergenic
967414639 3:189202549-189202571 AAGAAAAAGTAAAATTTGTAAGG - Intronic
970631642 4:17953229-17953251 CAGAACAGTTTATATTTCTTTGG + Intronic
971796987 4:31240874-31240896 AACAACAGTTCCAATTTGTTGGG - Intergenic
971898135 4:32623026-32623048 AAGAACAAGCCAAATTTGATTGG + Intergenic
971915319 4:32862776-32862798 GAGAACATTTTAAATTTATTAGG + Intergenic
972034408 4:34503420-34503442 GACAACAGGTAAAATTTATTTGG + Intergenic
972218352 4:36922742-36922764 GAGAACAGGCAAAATATGTTTGG - Intergenic
973059214 4:45699444-45699466 AAGAAAATTTTAAATTTGTATGG - Intergenic
973886550 4:55327850-55327872 AAGAACAGGTAAAGTTTGAAAGG - Intergenic
974680598 4:65156110-65156132 CAAAAAAGGTTAAATTTGATTGG - Intergenic
974798974 4:66790552-66790574 AAGAACATATTAAATGTGTAAGG + Intergenic
975515924 4:75248148-75248170 AACAACAGTTTAAATCTGTCAGG - Intergenic
975956491 4:79846858-79846880 ATGTTCAGGTTAAATTTATTAGG - Intergenic
975992121 4:80268009-80268031 ACGCAGAGGTTAAATTTGGTAGG + Intronic
976474342 4:85466002-85466024 AAGAACTGGTTACATTTCCTAGG - Intergenic
977183042 4:93901421-93901443 GGGAGCAGGTTAAATTAGTTAGG - Intergenic
979038680 4:115759070-115759092 AAAAAGAAGATAAATTTGTTAGG + Intergenic
979046228 4:115869098-115869120 AAGAAAAGGTTAAATGTTTGGGG - Intergenic
979261901 4:118657816-118657838 AAATACAGGTTAAATGTGTGTGG + Intergenic
979500584 4:121435222-121435244 AAGCAGAGGTTGAAATTGTTTGG - Intergenic
980264529 4:130498072-130498094 AAGGAAATGTTAAATTTTTTTGG + Intergenic
980340303 4:131535792-131535814 AAAAACTGGATAAATTTGTGAGG + Intergenic
981405903 4:144368839-144368861 AAGAACAGTCTAAAGTTGATTGG + Intergenic
981407527 4:144388375-144388397 GAGAACAGGTTAAAGGTGTTGGG + Intergenic
982957532 4:161791447-161791469 AGGAACAGCGTAAATATGTTAGG + Intronic
983149925 4:164265505-164265527 AAATACAGGTTAAATGTGTGTGG - Intronic
983492830 4:168409106-168409128 GACAACTGGTTAAATTTGTGAGG - Intronic
983875602 4:172871291-172871313 AAGAACATGTTCAACTTGTGGGG - Intronic
984045130 4:174788107-174788129 AAGAACATGTTAAATAAGTTGGG + Intronic
985485867 5:148678-148700 AACAACAGCTTAATTTTGATAGG - Intronic
986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG + Intergenic
987444088 5:17994945-17994967 AATAAAAGTTTAATTTTGTTTGG + Intergenic
990152720 5:52838050-52838072 AATAACAAGTTACATTCGTTTGG + Intronic
990199940 5:53360535-53360557 AAGATCAGGTTAATTTTAATAGG + Intergenic
990336774 5:54781239-54781261 AAGAATAAGTTAAATTCATTTGG + Intergenic
991094443 5:62724492-62724514 TAGAACAGGATAAATTCCTTTGG - Intergenic
992562891 5:77969712-77969734 AAGAAAAGGTAATATTTGGTAGG - Intergenic
992901979 5:81305849-81305871 TAGAACAGGTTAAATGTGTGTGG + Intronic
992912078 5:81405711-81405733 AATAACACGATAAATGTGTTTGG + Intergenic
993143510 5:84064941-84064963 AAGAACAGATTACATTATTTGGG + Intronic
994526198 5:100908039-100908061 AACAAAAGGTTAAATATATTTGG + Intergenic
994827679 5:104735929-104735951 AAGGACAGCTTGAACTTGTTGGG - Intergenic
995227858 5:109723304-109723326 AAAAACAGGTTAGATTATTTTGG + Intronic
996647823 5:125838292-125838314 AAGGAAAGATTAAATTTATTTGG - Intergenic
998355283 5:141530191-141530213 AAAAACAGGATGTATTTGTTAGG - Intronic
998554932 5:143114177-143114199 AGGAAGATGTTAAATGTGTTTGG + Intronic
998798756 5:145846399-145846421 AATAACAGCTAAAATTTATTGGG + Intergenic
998828555 5:146132458-146132480 AAGAAAAGGATAAATATCTTTGG - Intronic
998842250 5:146267080-146267102 AATAATAAGTTGAATTTGTTTGG - Intronic
999102929 5:149041979-149042001 AAGAATTGATTAAATTAGTTTGG + Intronic
1002097760 5:176841629-176841651 AAGCACATGTTTAATTTGATAGG - Intronic
1002732468 5:181350933-181350955 AAATACAGGTTAAATGTGTGTGG + Intergenic
1002752071 6:123173-123195 AAATACAGGTTAAATGTGTGTGG - Intergenic
1003433236 6:6059853-6059875 AAGAAAATGTTAATTTTGTTAGG - Intergenic
1004960374 6:20781958-20781980 CAGAACAGCTTAAATCTGTGGGG - Intronic
1006043949 6:31277844-31277866 ATTAACAAGTCAAATTTGTTAGG + Intronic
1006874219 6:37281462-37281484 AAGAACTGGTTGATTTTGGTGGG + Intronic
1008306834 6:49913675-49913697 AGAAACAGGTTAAATTTATCTGG + Intergenic
1008803062 6:55393600-55393622 AAGAAAATGTTTAATGTGTTTGG + Intronic
1009436995 6:63630312-63630334 AAGAAAATGTAAAATTTGCTTGG - Intergenic
1010666219 6:78632968-78632990 TAGAATAGGTTACATTTGTTGGG - Intergenic
1010929969 6:81790008-81790030 AAGAATAGGTTACTTTAGTTTGG + Intergenic
1011135632 6:84096944-84096966 AATAACAGGTGACATTTATTAGG + Intergenic
1011213108 6:84975622-84975644 AAGAACAACTTAACCTTGTTTGG + Intergenic
1011963754 6:93125806-93125828 AAGAACAGGATAAAGCTGTCAGG - Intergenic
1012384790 6:98667516-98667538 GAAAACAGGTTACATTTATTAGG - Intergenic
1012694264 6:102357195-102357217 AAGTACAGGAGCAATTTGTTTGG - Intergenic
1013483146 6:110569295-110569317 AAGAACAGGTTAAGGTTCCTGGG - Intergenic
1013568018 6:111389259-111389281 AAGAAAAGTTTAGATTTTTTAGG - Intronic
1014244740 6:119055846-119055868 AAGAAGAGGGTAGATTTATTAGG - Intronic
1014646924 6:123985237-123985259 AAAAACACGTAAAATTAGTTGGG + Intronic
1014687542 6:124521722-124521744 AAGAACAGGTAAAATATTTGGGG + Intronic
1014801694 6:125785788-125785810 AAGAAAAGGAAAAATTTATTGGG + Intronic
1014990515 6:128069608-128069630 AATATAAGGTTACATTTGTTTGG - Intronic
1015103647 6:129510680-129510702 AAAAAAAGATTAATTTTGTTTGG + Intronic
1015343960 6:132133570-132133592 AAGAAAAGGAAAAAGTTGTTGGG - Intergenic
1015600547 6:134906109-134906131 AAGAAATGGTTAAATTTGGGGGG - Intergenic
1015747384 6:136524945-136524967 AAGAACAGCTTATATATTTTGGG + Intronic
1016201422 6:141414869-141414891 AAGTACAATTTAATTTTGTTTGG - Intergenic
1016407615 6:143746773-143746795 AAATACAGTTTCAATTTGTTCGG - Intronic
1016628623 6:146201369-146201391 AACAACATGATAAATTTGGTGGG + Intronic
1017078680 6:150644952-150644974 AAAAACATGTTGAATTTGATTGG - Intronic
1018321412 6:162613284-162613306 AAAAACAGGTTTACTTTGGTTGG - Intronic
1018556761 6:165058764-165058786 AAGAACTTGTTAGATTTCTTTGG + Intergenic
1018973033 6:168541772-168541794 AAGATCAGATTAACTTTGTGTGG + Intronic
1019236720 6:170623249-170623271 AAATACAGGTTAAATGTGTGTGG + Intergenic
1019389135 7:775651-775673 AAGCAAAGCTTGAATTTGTTGGG + Intronic
1020484060 7:8699075-8699097 TAGAACAGATCAAATTTTTTTGG + Intronic
1020914248 7:14172133-14172155 AAGAAGAGGAAAAATTTGTTTGG + Intronic
1021206091 7:17782838-17782860 AATCACAGGTTAAATTTTCTGGG + Intergenic
1021365714 7:19774666-19774688 AAGAAGAGTTACAATTTGTTAGG + Intergenic
1022763514 7:33382979-33383001 AAGAACAGCTATTATTTGTTGGG - Intronic
1025529418 7:61859565-61859587 AAGAAAAGTTTAAATCTGTCAGG + Intergenic
1025584989 7:62772749-62772771 AAGAAAAGTTTAAACTTGTGAGG + Intergenic
1025585660 7:62782813-62782835 AAGAAAAGTTTAATTTTGTGAGG - Intergenic
1027482213 7:78712350-78712372 AAGACAAGTCTAAATTTGTTTGG - Intronic
1027506718 7:79025011-79025033 TAGAACAGTTTATATTTCTTTGG - Intronic
1028380551 7:90194540-90194562 CAGAAAAGGACAAATTTGTTTGG + Intronic
1030444859 7:109636889-109636911 ATGAATAGATTAAATTTCTTTGG - Intergenic
1033672075 7:143502899-143502921 AATACCAAGTTAAATTTTTTAGG + Intergenic
1034146952 7:148882869-148882891 CAGCACACGTTAAATTTCTTAGG + Intronic
1035511052 8:183359-183381 AAATACAGGTTAAATGTGTGTGG - Intergenic
1037573910 8:20183023-20183045 AAGGAAAGATTAAATTTGTCCGG + Intronic
1038429414 8:27487733-27487755 AAGAAAAGGTTATAGATGTTAGG + Intergenic
1039464531 8:37774906-37774928 AAGTACATGTTAAATATTTTTGG - Intronic
1041819562 8:62015381-62015403 AAGAAAAGTTAAAATGTGTTGGG - Intergenic
1043089986 8:75888182-75888204 AAGAAAAGTTTAAATTATTTTGG - Intergenic
1043571106 8:81603217-81603239 AAGGACAAATTAAATTTGCTAGG - Intergenic
1044422435 8:92013036-92013058 AAGAACATGTCAAATTTATAAGG + Intronic
1044765390 8:95566804-95566826 AAAAACAGGTAAAATATCTTTGG - Intergenic
1045914163 8:107446461-107446483 AGGAACAGTTTAATTTTCTTGGG + Intronic
1046083296 8:109399161-109399183 ATGAACCTCTTAAATTTGTTTGG + Intronic
1046301489 8:112298102-112298124 ATGAACAGAGTACATTTGTTTGG - Intronic
1046306517 8:112373948-112373970 AATAACAGTTAAAATCTGTTTGG - Intronic
1046517985 8:115288214-115288236 AAGAACAGGAGAAATATGGTTGG + Intergenic
1048500110 8:134967707-134967729 AAGAACTGGGTAAATCTGTCAGG + Intergenic
1048692406 8:136982392-136982414 AAAAACAATTTACATTTGTTTGG - Intergenic
1049168985 8:141146436-141146458 AAGTACAGTTAAAATTAGTTTGG - Intronic
1049455932 8:142687470-142687492 AATAAAATGTTAAATCTGTTAGG + Intergenic
1049942123 9:556973-556995 AAGAAATTGTTAATTTTGTTAGG + Intronic
1050866321 9:10504566-10504588 AATATCAAGATAAATTTGTTTGG + Intronic
1050871833 9:10581419-10581441 AAGAGAAGGTTTAAATTGTTTGG - Intronic
1051087225 9:13363692-13363714 AAGAATCAGTTAAATTTGTGTGG - Intergenic
1051780012 9:20680026-20680048 AAGATCAGTTTAACTTAGTTGGG - Intronic
1051798810 9:20907755-20907777 AAGAACAAGTAAAATTAGGTGGG - Intronic
1054163017 9:61691719-61691741 AACAACAGTTTAAATCTGTGAGG - Intergenic
1055064967 9:72109684-72109706 AGGAAAAGATTAAATTTGGTTGG + Intergenic
1055791229 9:79925171-79925193 AAGTACAGACTAAATGTGTTGGG + Intergenic
1058404705 9:104659584-104659606 AAGAACAGGTTGAATGAGGTTGG - Intergenic
1058654601 9:107208382-107208404 AAGAACTGGTTAAAGGTCTTGGG - Intergenic
1059827106 9:118043242-118043264 AAGTTCAGGTTTAATTTTTTTGG - Intergenic
1060116118 9:120942432-120942454 AAGATCAGTTTTCATTTGTTGGG + Intergenic
1062756870 9:138303260-138303282 AAATACAGGTTAAATGTGTGTGG + Intergenic
1203618375 Un_KI270749v1:91641-91663 CAGAACAGGTGAAAGTGGTTTGG + Intergenic
1186020952 X:5254596-5254618 ATGAAGAGCTTCAATTTGTTTGG + Intergenic
1186358132 X:8808940-8808962 AAGAACAGTTTGCATTTGTTAGG + Intergenic
1188027368 X:25224265-25224287 AAGAAAAGGGTTAATTAGTTAGG - Intergenic
1188481127 X:30637986-30638008 AGGAACAGGTCATATTTGCTTGG + Intergenic
1188512438 X:30950716-30950738 AACAAAAGCTTAAATTTGTAGGG + Intronic
1188595284 X:31892923-31892945 ATAAACAGGTGAAATTTATTTGG - Intronic
1188816704 X:34723868-34723890 TAGAACAGTTTATATTTGCTTGG + Intergenic
1189316384 X:40059676-40059698 AAAAACAGTTTGATTTTGTTTGG - Intronic
1190843126 X:54165152-54165174 AAGAAATTGTTAATTTTGTTGGG - Intronic
1191575755 X:62703373-62703395 AAGAAAGGTTTAACTTTGTTAGG + Intergenic
1191631525 X:63327104-63327126 AAGAAAAGGTAAAGTTTTTTTGG - Intergenic
1192057901 X:67791737-67791759 AAAAAAAATTTAAATTTGTTGGG + Intergenic
1192415495 X:70976581-70976603 AAGAACAGTTACAATCTGTTGGG - Intergenic
1193809115 X:86030708-86030730 AAGAACAGGAGAAATTAGCTGGG + Intronic
1195063099 X:101215623-101215645 AGGAACAGGTTAAAAATGTAGGG - Intergenic
1195514861 X:105762573-105762595 ATGAACAGGTTAAATGTACTTGG + Intronic
1195898816 X:109775743-109775765 AAGAACAGGATATTTTTGTTTGG + Intergenic
1196065092 X:111455460-111455482 TAGAACAATTTAAATTTGTTTGG - Intergenic
1196627330 X:117891309-117891331 TAGAACATGCTAAATGTGTTTGG + Intergenic
1197288047 X:124619399-124619421 AAGAACAAGTTAATTTTATATGG - Intronic
1198611486 X:138406186-138406208 AAGAACATGATAAATTTTTCAGG + Intergenic
1199399476 X:147380446-147380468 ATGAAAATGTTACATTTGTTGGG - Intergenic
1199882636 X:151986751-151986773 AGGAACAGGTTACATATGTCTGG - Intergenic
1200689029 Y:6287426-6287448 AAGAGTATGTTAAATTTTTTTGG - Intergenic
1201046243 Y:9887296-9887318 AAGAGTATGTTAAATTTTTTTGG + Intergenic
1201975472 Y:19843985-19844007 AAAAACTGTTTAAATTTATTGGG + Intergenic
1202086202 Y:21139508-21139530 AAGAATTGTTTAAATTTATTGGG - Intergenic
1202383989 Y:24306281-24306303 AAATACAGGTTAAATGTGTGTGG + Intergenic
1202486794 Y:25363839-25363861 AAATACAGGTTAAATGTGTGTGG - Intergenic