ID: 1113483763

View in Genome Browser
Species Human (GRCh38)
Location 13:110640144-110640166
Sequence GCTGCAATAAAGCACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113483754_1113483763 24 Left 1113483754 13:110640097-110640119 CCTGTCTGTGTGAGATTGGCCTC 0: 1
1: 0
2: 0
3: 13
4: 104
Right 1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1113483755_1113483763 5 Left 1113483755 13:110640116-110640138 CCTCCTCGCCAGCGCCTCTCCCG 0: 1
1: 0
2: 1
3: 24
4: 305
Right 1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1113483759_1113483763 -3 Left 1113483759 13:110640124-110640146 CCAGCGCCTCTCCCGTGGTGGCT 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1113483756_1113483763 2 Left 1113483756 13:110640119-110640141 CCTCGCCAGCGCCTCTCCCGTGG 0: 1
1: 0
2: 1
3: 18
4: 133
Right 1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1113483760_1113483763 -9 Left 1113483760 13:110640130-110640152 CCTCTCCCGTGGTGGCTGCAATA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113483763 Original CRISPR GCTGCAATAAAGCACCTTGA AGG Intergenic
900382819 1:2393304-2393326 GCTAGAATGAAGCTCCTTGAGGG - Intronic
901779122 1:11581180-11581202 GCTGCAATACAATACCTTCAGGG - Intergenic
902538808 1:17137886-17137908 GCTCCAATCAAGAACCTAGAAGG + Intergenic
912487862 1:110043306-110043328 GCTGCAAGCATGCACCTTGAGGG - Intronic
913539450 1:119804894-119804916 GCATCAAGAAAGCACCTTGCAGG - Intronic
914451938 1:147800250-147800272 CCAGGAATAAAGCATCTTGAAGG - Intergenic
918574120 1:186034974-186034996 GCTGCAATAAAACACTATGATGG - Intronic
920371082 1:205479743-205479765 GCTGCACTAGAGGTCCTTGAGGG - Intergenic
924944491 1:248837525-248837547 ACAGCAGTAAAGGACCTTGAGGG + Intergenic
1064527656 10:16274812-16274834 GCTGCAGTTCAGCAACTTGATGG + Intergenic
1072288236 10:93937616-93937638 TTTGCAATAAAGGACATTGATGG + Intronic
1074864985 10:117539698-117539720 GCTGCACTCCAGCCCCTTGAAGG - Intergenic
1087204444 11:95379015-95379037 CCTGCTCTAAAGCACCCTGAGGG + Intergenic
1093960134 12:25263572-25263594 GCTTCAGTAAGGCACCTTAAGGG - Intergenic
1098213075 12:68186532-68186554 ACTCCAATAAACCACCTTCAGGG + Intergenic
1098271989 12:68778055-68778077 GCTGCAATGAGCCACCGTGATGG + Exonic
1101591401 12:106128588-106128610 GCTGCAATCAAGCACCTTTGTGG + Intronic
1106885227 13:34177207-34177229 GCTGCTATAAATCAACTTGTAGG - Intergenic
1112368737 13:98776373-98776395 GCTGCAAGAGAGCACCCAGAGGG + Intergenic
1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG + Intergenic
1115146323 14:30230131-30230153 TCTCAAATAAAGCACCTTGAGGG + Intergenic
1117499853 14:56340699-56340721 GCTGCAATCCAGCTCCTTGGTGG + Intergenic
1118765737 14:68908244-68908266 GCTGCCAAAAAGGATCTTGAGGG - Intronic
1120549702 14:85855125-85855147 ACTGCAATATAGCTCCTTGAGGG + Intergenic
1121959681 14:98247786-98247808 TATGCAAGAAATCACCTTGAGGG - Intergenic
1122815877 14:104313767-104313789 GCTACAAAAGAGCACCCTGAGGG + Intergenic
1125189298 15:36971260-36971282 GCTGGTATAAAACACCTTTAAGG + Intronic
1134753767 16:16648284-16648306 GCTGATATAAACCAACTTGACGG - Intergenic
1134992292 16:18710759-18710781 GCTGATATAAACCAACTTGACGG + Intergenic
1139668477 16:68474847-68474869 GTTGCATTCAAGCACCATGAGGG - Intergenic
1146062929 17:29616471-29616493 TCTGCAATAAAACACCCTGATGG + Intronic
1146379734 17:32319777-32319799 ACTGAAATAAAGCCCTTTGAGGG - Intronic
1155751593 18:29429535-29429557 GCTGGAATAAAGCACATTTTAGG + Intergenic
1156407604 18:36797708-36797730 GCTGCAAGAAACCACCACGAAGG + Intronic
1157147130 18:45175164-45175186 GCTGCAATTAACAACCTTGTAGG - Intergenic
1157923654 18:51740258-51740280 GCTCCAATATATCAACTTGAAGG - Intergenic
1163537094 19:17883262-17883284 GCTGCAAAAAAGTCCCCTGATGG - Intronic
1163939726 19:20480508-20480530 GCTGCTATATAGTACCTGGACGG + Intergenic
1167824424 19:51959361-51959383 GCAGCAGCACAGCACCTTGAGGG - Intergenic
1202645614 1_KI270706v1_random:137909-137931 GTTGCAAGAAAGAACCTTGGAGG - Intergenic
925402261 2:3583765-3583787 GCTGCACTAATGTACCTAGAAGG - Intergenic
927735562 2:25517913-25517935 ACTGCAACACAGAACCTTGAGGG + Intronic
929756849 2:44773481-44773503 GCTCCATTAGAGCACCTAGATGG + Intergenic
931080864 2:58768836-58768858 GCTGCAATCAAGTAATTTGAGGG - Intergenic
934914912 2:98293295-98293317 ACTTCAATAAATCAGCTTGAAGG + Intronic
935616743 2:105093332-105093354 GATGCAATAAAGCTCATTGTGGG - Intronic
939351796 2:141047662-141047684 GCTAAAATAAAGGGCCTTGAAGG - Intronic
945780914 2:214170977-214170999 GCTGCCATATAGCACTGTGATGG + Intronic
1171895577 20:30756825-30756847 GTTGCAAGAAAGAACCTTGGAGG - Intergenic
1171993821 20:31717181-31717203 GCTTCAAGAAAGCCCCATGATGG + Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1176606271 21:8834839-8834861 GTTGCAAGAAAGAACCTTGGAGG + Intergenic
1180356344 22:11844537-11844559 GTTGCAAGAAAGAACCTTGGAGG + Intergenic
1180381916 22:12147789-12147811 GTTGCAAGAAAGAACCTTGGAGG - Intergenic
1185407314 22:50660421-50660443 GCTGCACTAAAGCACTTGGCAGG + Intergenic
951980129 3:28556676-28556698 GCTACAACAAACCAACTTGATGG - Intergenic
954853066 3:53619474-53619496 GCAGCAACCAAGCACCTTCATGG + Intronic
957498869 3:81027527-81027549 ACTGCAGTAATGCACCTTGTGGG - Intergenic
957682289 3:83452375-83452397 GTTGGAATAAAGCTCCATGAAGG + Intergenic
959955269 3:112230469-112230491 GGTGGAATAAAGCACCATGTGGG + Intronic
965788643 3:172363751-172363773 TCTGCAGTCAAGCACTTTGATGG + Intronic
969664492 4:8549344-8549366 GCTGAATGAAAGCACCTTGCAGG + Intergenic
969693632 4:8722810-8722832 GTTTCAAGACAGCACCTTGAGGG - Intergenic
970894101 4:21082507-21082529 GCTGTAATAAAGCAAATTGTTGG - Intronic
972154375 4:36140629-36140651 GCTGCTATAAAACACATTCAAGG + Intronic
973371836 4:49256327-49256349 GTTGCAAGAAAGAACCTTGGAGG - Intergenic
973550978 4:52036018-52036040 CCTGTAATTAAGCTCCTTGAGGG - Intronic
975179192 4:71323983-71324005 TCTGCAAAAAAACACCTGGAAGG - Intronic
975427058 4:74241990-74242012 GCTGTAATAAGGCAACATGAGGG + Intronic
978632765 4:110766311-110766333 TTTGCAACAAAGCCCCTTGAAGG + Intergenic
978703109 4:111673125-111673147 TCTGCTATAAAGCCCCTTGTTGG - Intergenic
979313852 4:119236137-119236159 ACTGCAATAAAGCAAGTTGCAGG + Intronic
985585530 5:731387-731409 GCTGCAAGAAAGCAGATTAAGGG - Intronic
987310860 5:16679908-16679930 GCTGTAATCACCCACCTTGATGG + Intronic
990607403 5:57424066-57424088 GATGCAGTAATGCATCTTGAGGG - Intergenic
991391770 5:66151579-66151601 GCTGGAATATTACACCTTGATGG - Intronic
991488506 5:67162873-67162895 GCTGAAAGAAAGCAGGTTGAAGG + Intronic
994676797 5:102833381-102833403 TCTACAAAAAAGCCCCTTGAAGG - Intronic
995769999 5:115658142-115658164 GCTAAAAGAAAGCACCTTCAAGG + Intergenic
1007372980 6:41438949-41438971 GCAGCAAAAAGGAACCTTGAAGG + Intergenic
1007625846 6:43246061-43246083 GAGGCACTAAAGCCCCTTGAGGG - Intronic
1015259808 6:131223973-131223995 ACAGCAATAAAGAAGCTTGATGG - Intronic
1020055179 7:5113035-5113057 CCTGCAATAAATCAGCTTCATGG - Intergenic
1021183329 7:17533785-17533807 GCTGCAATACAGCATCTTAGGGG + Intergenic
1032286750 7:130543416-130543438 GCTTCCTTAAAGCTCCTTGAGGG + Intronic
1034110726 7:148535359-148535381 GCTGTAATTAAGCATTTTGACGG + Intergenic
1034245054 7:149637673-149637695 GCTGCAATGGAGCCCATTGAGGG - Intergenic
1045032943 8:98154689-98154711 GCTGCAATTAATGATCTTGACGG - Intronic
1045065761 8:98442469-98442491 CCTGAAATAACGCACCTTGGTGG - Intronic
1045404066 8:101847691-101847713 GCTGCACCAAAGCTCTTTGAGGG - Intronic
1045657844 8:104405543-104405565 CCTGAAATAAAGCATCTTGGAGG + Intronic
1050259329 9:3824798-3824820 GCTGACATAAAGCACTTTGGGGG - Intronic
1054353070 9:64035947-64035969 GTTGCAAGAAAGAACCTTGGAGG + Intergenic
1058948513 9:109881259-109881281 GCTGTAATACAGCACAGTGATGG + Intronic
1203696275 Un_GL000214v1:101388-101410 GTTGCAAGAAAGAACCTTGGAGG - Intergenic
1203741404 Un_GL000218v1:5057-5079 GTTGCAAGAAAGAACCTTGGAGG + Intergenic
1203553664 Un_KI270743v1:186676-186698 GTTGCAAGAAAGAACCTTGGAGG + Intergenic
1203639998 Un_KI270751v1:2675-2697 GTTGCAAGAAAGAACCTTGGAGG + Intergenic
1185686172 X:1930614-1930636 GCAGCAATAAATCACATGGAAGG - Intergenic
1186913155 X:14191677-14191699 TCTTCAATACAGCACATTGATGG + Intergenic
1188340016 X:28987935-28987957 GCTGCAATATAGCCCTTTGAAGG - Intronic
1198298419 X:135309650-135309672 GCTGCCATAAAGCAACTCCAGGG + Intronic