ID: 1113484286

View in Genome Browser
Species Human (GRCh38)
Location 13:110642900-110642922
Sequence GCGCTTGCACACGTGTGTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113484277_1113484286 26 Left 1113484277 13:110642851-110642873 CCGAGGTATCAGGAGCAACCTGA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1113484286 13:110642900-110642922 GCGCTTGCACACGTGTGTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1113484285_1113484286 8 Left 1113484285 13:110642869-110642891 CCTGAGGATGAGGCTGGGGGGCA 0: 1
1: 1
2: 3
3: 41
4: 441
Right 1113484286 13:110642900-110642922 GCGCTTGCACACGTGTGTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113484286 Original CRISPR GCGCTTGCACACGTGTGTTT CGG Intronic
900297935 1:1961572-1961594 GCGCGTGCAGAGGTGGGTTTAGG - Intronic
902987765 1:20165825-20165847 GCGCGCGCGCATGTGTGTTTAGG + Intronic
907977001 1:59441220-59441242 GTGCTTGCAGAAATGTGTTTGGG + Intronic
915593553 1:156883911-156883933 GTGTTTGCACATGTGTGTCTAGG - Intergenic
920250738 1:204620736-204620758 GTACATGCACATGTGTGTTTGGG + Exonic
922347544 1:224708780-224708802 GCGCATGAACACCTGTATTTGGG - Intronic
922348547 1:224717132-224717154 GTGCATGCACACGTGTGCTTGGG + Intronic
924014574 1:239706693-239706715 GTACATGCACACGTGTGTGTGGG - Intronic
1065286145 10:24189474-24189496 GTGTGTGCACATGTGTGTTTGGG - Intronic
1069896462 10:71683219-71683241 GTGCATGCACAGGTGTGTGTGGG - Intronic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1074915720 10:117952995-117953017 ATGCATGCACACGTGTGTGTGGG + Intergenic
1075831530 10:125416069-125416091 GTGTGTGCACACGTGTGTATGGG - Intergenic
1076778876 10:132713212-132713234 GGGTGTGCACACGTGTGTGTAGG + Intronic
1077236791 11:1485738-1485760 GAGCGTGCACCCGTGTGTGTGGG - Intronic
1085933627 11:81117649-81117671 GCGCACACACACGTGTGTGTTGG + Intergenic
1091562972 12:1628941-1628963 GCGCGTGCATATGTGTGTATGGG + Intronic
1092299743 12:7235551-7235573 GTGTGTGCACACGTGTGTGTTGG - Intergenic
1098724193 12:73941556-73941578 GCGCTTTCACACATGACTTTAGG - Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1113484286 13:110642900-110642922 GCGCTTGCACACGTGTGTTTCGG + Intronic
1113542883 13:111122678-111122700 GCGCTTCCATGCGTGTGATTGGG - Intronic
1126685562 15:51246264-51246286 GTGCATGTACATGTGTGTTTGGG - Intronic
1126698937 15:51350475-51350497 GCGTGTGCACACGTGCATTTAGG + Intronic
1137016131 16:35377288-35377310 AGGCTGGCACAGGTGTGTTTTGG - Intergenic
1141805561 16:86339086-86339108 GAGCTTGCCCAGGTGGGTTTTGG + Intergenic
1143319379 17:6058286-6058308 GTGCTTGCATATGTGTGTCTGGG + Intronic
1145799616 17:27674525-27674547 GTGCATGCACACGTGTATGTGGG + Intergenic
1146844981 17:36176748-36176770 GTGCGTGCACACGTGTATGTGGG + Intronic
1146880556 17:36439679-36439701 GTGCGTGCACACGTGTATGTGGG + Intergenic
1147149587 17:38506774-38506796 GGGCTTCCACATGTGAGTTTGGG + Intronic
1147257917 17:39193035-39193057 GCGCATGCCCGCGTGTGTGTTGG - Intronic
1151201066 17:72468364-72468386 CAGCTTGCACATGTGTGGTTGGG - Intergenic
1154394299 18:13972917-13972939 GCACTTGCTCACTTGTATTTGGG + Intergenic
1166009853 19:39934336-39934358 GTTCTTGCACACTTGAGTTTGGG + Intronic
1166197712 19:41217947-41217969 GCTCTTGGCCACCTGTGTTTGGG - Intergenic
1166805503 19:45484681-45484703 GCCGTTGGACACGTGGGTTTGGG + Intergenic
1167716627 19:51146339-51146361 GGGCCTGGACAGGTGTGTTTGGG + Intronic
1167768136 19:51497827-51497849 GGGCCTGGACAAGTGTGTTTGGG - Intronic
939148924 2:138449885-138449907 ACGTATGCACATGTGTGTTTGGG + Intergenic
941190034 2:162369983-162370005 GCACTTGAACATTTGTGTTTTGG + Intronic
943845967 2:192648759-192648781 ACGCATGCACACGTGTGTGCTGG - Intergenic
1168850595 20:974025-974047 GCGCCTGCACCCGTGACTTTAGG - Intronic
1173054322 20:39596761-39596783 GTGTGTGCACACGTGTGTGTGGG + Intergenic
1175657352 20:60782620-60782642 GAGCGTGCACACGTGTGTGGCGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1177566579 21:22830839-22830861 GCGCTTGCGCAAATGTGGTTTGG - Intergenic
1181307886 22:21927304-21927326 GCGCCTTCACGCGTGTGTGTGGG - Intronic
1183700954 22:39450672-39450694 GCACGTGCACATGCGTGTTTTGG - Intergenic
1184890453 22:47375921-47375943 GCGCGCGCACATGTGTGTTTGGG - Intergenic
950189335 3:10965844-10965866 GTGCATGCACATGTGTGTGTTGG - Intergenic
954631555 3:52050575-52050597 GCTCTTGGACACGTGGCTTTGGG - Exonic
958778542 3:98513967-98513989 GCACATGCACACGTGCGTTAAGG - Intronic
967044142 3:185721005-185721027 ACGCTTGCACACATGTGAGTGGG + Intronic
977650544 4:99463857-99463879 GAACTTGCTCACGTGTTTTTGGG + Intergenic
983826503 4:172268633-172268655 GGGCTTCCACATGTGAGTTTTGG - Intronic
1001334904 5:170789033-170789055 GTGTTTGCCCACGTGTGTGTGGG - Intronic
1002939886 6:1706689-1706711 GCGTTTGCTCACCTGTGTGTAGG + Intronic
1006204686 6:32330042-32330064 GCGCGCGCGCACGTGTGTTGGGG + Intronic
1015513706 6:134064195-134064217 ACGCCTGCCCAGGTGTGTTTGGG + Intergenic
1018194861 6:161346679-161346701 GCTCTTACACAGGTGCGTTTTGG + Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1027138324 7:75639621-75639643 GTGCATGCATGCGTGTGTTTTGG + Intronic
1027653059 7:80895083-80895105 GTGCATGCTCACGTGTGTGTGGG - Intronic
1029715021 7:102321092-102321114 GGGCGTGCACACGCGTGGTTAGG + Intronic
1031001260 7:116417820-116417842 GTGCATGCACGCGTGTGTTTGGG - Intronic
1035166251 7:156991964-156991986 GCCTTTGCACACATCTGTTTGGG - Intergenic
1035907039 8:3523834-3523856 GCGCATGCACATGTGTCTCTGGG - Intronic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1038680259 8:29660379-29660401 GTGTGTGCACACGTGTGTATGGG - Intergenic
1042522255 8:69726084-69726106 GAGCGTGCACACATGTGCTTGGG + Intronic
1048316869 8:133369374-133369396 GTTCTTGGACACGTGTGTCTTGG + Intergenic
1052230767 9:26149535-26149557 ACCCTTTCACACGTATGTTTTGG + Intergenic
1054948553 9:70823558-70823580 GTGCATGCACACGTGTGCATTGG - Intronic
1062285042 9:135769101-135769123 GCGTGTGCACACGTGGGTGTCGG + Intronic
1192168012 X:68838179-68838201 GCGCGCGCGCACGTGTGTATGGG + Intronic
1192929157 X:75786478-75786500 GTGCCAGCACACGTGTGTTTGGG + Intergenic