ID: 1113484613

View in Genome Browser
Species Human (GRCh38)
Location 13:110645151-110645173
Sequence TTTGAGTCACAGCCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113484613_1113484615 -4 Left 1113484613 13:110645151-110645173 CCTGCAGCCGGCTGTGACTCAAA 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1113484615 13:110645170-110645192 CAAATGCCCGCCCCCCTCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 76
1113484613_1113484624 23 Left 1113484613 13:110645151-110645173 CCTGCAGCCGGCTGTGACTCAAA 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1113484624 13:110645197-110645219 CCCTGCGCGTCTGCAGTATTTGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113484613 Original CRISPR TTTGAGTCACAGCCGGCTGC AGG (reversed) Intronic
900989849 1:6093442-6093464 TTTGAGACACAGCAATCTGCTGG - Intronic
902394493 1:16125248-16125270 CTTGAGTCCCAGCAGGCTGTAGG + Exonic
904785628 1:32980481-32980503 TTTGAGGCACAGCCGGGCGAGGG - Intergenic
905798925 1:40831080-40831102 TTTGATGCCCATCCGGCTGCTGG - Exonic
907425269 1:54375536-54375558 CTGGAGTCACAGTCAGCTGCTGG - Intronic
907726584 1:57025880-57025902 TTTGAGTGAAAGAGGGCTGCTGG - Intronic
908730842 1:67225104-67225126 TTTGTTTCACAGGCGGATGCAGG - Intronic
909765835 1:79354850-79354872 TTTGAAACACAGCTGCCTGCTGG + Intergenic
916524372 1:165595696-165595718 TTTGAAACATAGCCAGCTGCTGG - Intergenic
916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG + Intronic
923628405 1:235633180-235633202 AATGAGTGACAGCCTGCTGCTGG + Intronic
924558993 1:245142269-245142291 TGTGTGTAACAGCAGGCTGCAGG - Intergenic
1062942553 10:1435127-1435149 TTGGAGGCACAGCCGGCCTCGGG - Intronic
1069036612 10:63652077-63652099 TTTGAATCACAGACAGATGCTGG + Intergenic
1073449991 10:103603515-103603537 TCTGAGTCAAAGCCGAATGCAGG + Exonic
1074350070 10:112728032-112728054 TCTGTGACACAGCAGGCTGCTGG + Intronic
1074573997 10:114651425-114651447 TCTGAGGCCCAGCAGGCTGCAGG - Intronic
1075714124 10:124546100-124546122 TTTGAGGCAGAGTCGCCTGCAGG + Intronic
1077583069 11:3429702-3429724 TTTGTGTCTCACCTGGCTGCTGG + Intergenic
1079898661 11:26153314-26153336 TCTGAGTCACAGCACGCTGTTGG - Intergenic
1081773436 11:45663396-45663418 TGTGAGTCACAGGCCCCTGCTGG - Intronic
1083886938 11:65577531-65577553 GCTGAGTCACAGGCGGCTGTGGG + Intronic
1084239982 11:67812505-67812527 TTTGTGTCTCACCTGGCTGCTGG + Intergenic
1084832461 11:71780329-71780351 TTTGTGTCTCACCTGGCTGCTGG - Intergenic
1085181002 11:74535976-74535998 ATGGAGTCACAGCTGGCTCCAGG + Intronic
1090167079 11:124561145-124561167 TTTGTGACCCAGCCAGCTGCAGG + Intergenic
1103824083 12:123721987-123722009 TTTGAGTCGCAGCCATCTACAGG - Intronic
1105753275 13:23441416-23441438 GCTGAGTCACAGCCAGCTGATGG + Intergenic
1110239669 13:73253470-73253492 TTTAAGTCACAGCCAGCTACTGG + Intergenic
1113484613 13:110645151-110645173 TTTGAGTCACAGCCGGCTGCAGG - Intronic
1114082609 14:19214293-19214315 TAAGAGTAACAGCTGGCTGCAGG - Intergenic
1122842355 14:104472642-104472664 TCTGCGTCACAGCCGGCTGCAGG - Intergenic
1123774204 15:23562140-23562162 CTTTAGGCACTGCCGGCTGCCGG - Intergenic
1126322275 15:47437715-47437737 TCTGAGTCATAGCCTGGTGCAGG + Intronic
1127126757 15:55819577-55819599 TTAGATCCACAGCCGCCTGCCGG + Intergenic
1134039999 16:11061036-11061058 TCTGAGTCACAGCAGGGGGCTGG + Intronic
1141144377 16:81518633-81518655 TTTGAGTCCCAGCTGGCTAGTGG - Intronic
1141848923 16:86630740-86630762 CATGAGCCACAGCCTGCTGCTGG - Intergenic
1142031144 16:87839146-87839168 TCTGACTCCCAGCCCGCTGCCGG - Intronic
1142182806 16:88679388-88679410 TCTGAGTCACACCTGGGTGCAGG - Intronic
1147594697 17:41709280-41709302 TCTGAGTCACAGCTGGCAGGAGG + Intergenic
1150634533 17:66903742-66903764 TTTGAGTCAAAGCGTCCTGCTGG - Intergenic
1151283405 17:73092782-73092804 TCTGGTTCACAGCCGTCTGCAGG + Intergenic
1155403970 18:25467604-25467626 TCTATGTCACAGCAGGCTGCTGG + Intergenic
1156504315 18:37579489-37579511 GTTGGGGCACAGCCAGCTGCTGG - Intergenic
1158763005 18:60412589-60412611 TTTGAGTCACAACCAGCAGTAGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1162194887 19:8976895-8976917 TTTGAGACACAGTCAGCTCCAGG - Exonic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
925055136 2:851384-851406 TTTGAGACACACCCTGCTACTGG - Intergenic
930223776 2:48771407-48771429 TTTGAGTCAAAGCTGGCTGTTGG + Intronic
934712931 2:96527536-96527558 TTTGAGTCAGATCCGGCGGCAGG + Intergenic
937871539 2:126789575-126789597 TGTGAGTCACAGCATGATGCTGG + Intergenic
938493967 2:131782313-131782335 TAAGAGTAACAGCTGGCTGCAGG + Intergenic
938940789 2:136167990-136168012 TTTCAGGCACAGCCTGCTGCAGG - Intergenic
947083932 2:226429691-226429713 TCTGATTCACAGCCTGTTGCTGG - Intergenic
948805070 2:240450356-240450378 TTGGAGTCAGGGCAGGCTGCAGG + Intronic
948854364 2:240723274-240723296 TGGGAGTCACAGCCACCTGCAGG - Intronic
1169610123 20:7369569-7369591 TTTGAGTCACACTCAGCAGCTGG - Intergenic
1169970780 20:11267501-11267523 TATGAGTCACAGCTGACTGAAGG - Intergenic
1170736698 20:19019060-19019082 TTTCAGACACAGACCGCTGCGGG + Intergenic
1176613952 21:9012055-9012077 TAAGAGTGACAGCTGGCTGCAGG - Intergenic
1176711251 21:10151834-10151856 TAAGAGTAACAGCTGGCTGCAGG + Intergenic
1177557711 21:22713730-22713752 GCTGAGTCAGAGCAGGCTGCTGG - Intergenic
1179716415 21:43291021-43291043 TGCGACTCACAGCCGGCCGCTGG + Intergenic
1180498168 22:15908377-15908399 TAAGAGTAACAGCTGGCTGCAGG + Intergenic
1181633569 22:24163983-24164005 GCTGAGTCAAAGCAGGCTGCAGG - Intronic
1184799667 22:46751912-46751934 TTTGGGACACAGCCTGCTGCAGG + Intergenic
951464650 3:22989224-22989246 TTTGAGTCACTGCAGCCAGCAGG + Intergenic
960916429 3:122699994-122700016 TTTGTGTCACAGCAGTCTACTGG + Exonic
961298934 3:125909429-125909451 TTTGTGTCTCACCTGGCTGCTGG - Intergenic
969815618 4:9685232-9685254 TTTGTGTCTCACCTGGCTGCTGG - Intergenic
977666177 4:99649677-99649699 TGGGAGCCACAGCCTGCTGCTGG + Exonic
978279148 4:106988717-106988739 TTTAAGTCACAGTCAGATGCAGG + Intronic
979503042 4:121461609-121461631 CTTGAGTGAGAGCAGGCTGCAGG - Intergenic
980894249 4:138846226-138846248 TTAGAGTCACAGTCATCTGCTGG - Intergenic
985822097 5:2167268-2167290 CTTGGGTCACACCAGGCTGCAGG - Intergenic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
994214701 5:97124524-97124546 TATGAGTCACTGCCAGCTCCTGG - Exonic
999648657 5:153744098-153744120 TTGGAGACACAGCCGGCTCTGGG - Intronic
1010474836 6:76274603-76274625 TTTGAGTGCCAGCTTGCTGCAGG - Intergenic
1014296145 6:119620387-119620409 TTTGTGCCACAGAAGGCTGCAGG + Intergenic
1019161834 6:170074100-170074122 TGTGAGTCACTGCAGGGTGCAGG + Intergenic
1019469615 7:1211750-1211772 TTAGAGGAAGAGCCGGCTGCTGG + Intergenic
1026057357 7:66996330-66996352 TTTGAGTCACAGCGCCCGGCCGG + Intronic
1026720756 7:72828722-72828744 TTTGAGTCACAGCGCCCGGCCGG - Intergenic
1031038821 7:116817398-116817420 TTTTAGTCACAGTTGGCTGGGGG + Intronic
1037834215 8:22206847-22206869 TTGTGGTCACAGCCGGCTGCAGG - Exonic
1038397516 8:27257992-27258014 TTCAGGTCACAGCCAGCTGCAGG + Intronic
1047517068 8:125564212-125564234 TTTCAGCCACAGCCTGCTGAAGG - Intergenic
1050176755 9:2876539-2876561 TCTGCGTCACAGCCCGCGGCTGG + Intergenic
1051453360 9:17223245-17223267 TTTGGATCACAGTTGGCTGCTGG + Intronic
1051636399 9:19184438-19184460 TCTGAGTCACTGTGGGCTGCAGG + Intergenic
1053648241 9:40137525-40137547 TAAGAGTAACAGCTGGCTGCAGG + Intergenic
1053757497 9:41326316-41326338 TAAGAGTAACAGCTGGCTGCAGG - Intergenic
1054329215 9:63735468-63735490 TAAGAGTAACAGCTGGCTGCAGG + Intergenic
1054536342 9:66238645-66238667 TAAGAGTAACAGCTGGCTGCAGG - Intergenic
1058742921 9:107962167-107962189 TTTGAGGCAGAGCCGGCATCAGG + Intergenic
1059379926 9:113915227-113915249 TTTGAGTGACACCTGGCTGGTGG - Intronic
1202796006 9_KI270719v1_random:120823-120845 TAAGAGTAACAGCTGGCTGCAGG + Intergenic
1195351479 X:104000536-104000558 TTTGAGTCACAGCAGGCGTCTGG - Intergenic