ID: 1113488008

View in Genome Browser
Species Human (GRCh38)
Location 13:110669312-110669334
Sequence AATGGAGCAGAGTCCTCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113488002_1113488008 19 Left 1113488002 13:110669270-110669292 CCCTACTCGGCGCTGAATACTCA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1113488008 13:110669312-110669334 AATGGAGCAGAGTCCTCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 101
1113488003_1113488008 18 Left 1113488003 13:110669271-110669293 CCTACTCGGCGCTGAATACTCAA 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1113488008 13:110669312-110669334 AATGGAGCAGAGTCCTCGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113488008 Original CRISPR AATGGAGCAGAGTCCTCGTG TGG Intronic
900951010 1:5858344-5858366 CATGGAGCCCAGTCCTCGTGGGG - Intergenic
903704054 1:25272018-25272040 AATGGAGCTGAGCCCTGGGGAGG - Intronic
903723182 1:25421294-25421316 AATGGAGCTGAGCCCTGGGGAGG + Intronic
904181251 1:28668449-28668471 AATGGAGTAGAGTCCTCCAGAGG + Intergenic
905280228 1:36844336-36844358 GTTGGAGAAGAGTCCACGTGGGG + Intronic
905484843 1:38288220-38288242 CATGGAGTAGAGTCCTGGAGAGG + Intergenic
906152641 1:43596440-43596462 ATTGCAGCAGAGTCCTCGGTGGG + Intronic
907317849 1:53583924-53583946 AATGGAGCTGGGTCCTCCTTCGG - Intronic
907388586 1:54141648-54141670 ACTGCAGCACAGTCCTTGTGCGG - Intronic
908961025 1:69696665-69696687 CATGGGGCAGATTCCTCATGAGG + Intronic
915259268 1:154664631-154664653 AAAGGAGCAGGGTCCTCCTGGGG - Intergenic
920586466 1:207167861-207167883 ATGGGAGCGGAGTCCTCATGTGG + Intergenic
923285719 1:232493002-232493024 ATTGGAGAAGAGGCCTCGTAGGG + Intronic
924510652 1:244726888-244726910 GTTGGAGCTGAGTCCTCCTGTGG - Intergenic
1070345790 10:75540557-75540579 AGTGGAGCAGAGTGCTAGTGGGG - Intronic
1075893240 10:125972288-125972310 AATGGAGCAGAGGCCCGGGGCGG - Intronic
1076534042 10:131164849-131164871 AATGCTCCAAAGTCCTCGTGGGG + Intronic
1077573574 11:3359325-3359347 AATGTGGCAGAGTCTTCATGTGG - Exonic
1080860767 11:36148446-36148468 AAGGCAGCAAAGTCCTCGTTAGG - Intronic
1083221499 11:61255864-61255886 AAGGGAGCAGAGGCCTGGCGCGG + Intergenic
1085257571 11:75184623-75184645 CTTGGAGCAGAGTCTTGGTGAGG + Intronic
1086846896 11:91761606-91761628 AAAGGAGCAGAGTCCTGATGAGG + Intergenic
1088885223 11:114000935-114000957 CATGGTGCAGAGTCCTGGAGGGG + Intergenic
1092909680 12:13135828-13135850 AATGCAGGAGAGTCCTTGAGAGG + Intronic
1095885026 12:47179627-47179649 TATGAAGCAGAGGCATCGTGAGG - Intronic
1098387465 12:69934346-69934368 AATGGGGCAGTGCCCTGGTGAGG + Intronic
1102644838 12:114397103-114397125 AAAGGAGCAGATTTCTCGTTTGG + Intronic
1104834140 12:131776467-131776489 AATTCAGCAGAGCCCTGGTGGGG - Intronic
1105381453 13:19891251-19891273 CATGGAGAAGAGGCCGCGTGAGG + Intergenic
1105502831 13:20988141-20988163 CATGGAGCAGAGCCTCCGTGCGG - Exonic
1111047118 13:82828927-82828949 ACAGGAGCAGACTCCACGTGGGG + Intergenic
1113488008 13:110669312-110669334 AATGGAGCAGAGTCCTCGTGTGG + Intronic
1124753294 15:32387357-32387379 AAGGGAGCAGAGAGCTGGTGAGG - Intergenic
1124975035 15:34523057-34523079 AAGGGAGCAGAGAGCTGGTGAGG - Intergenic
1128690989 15:69724850-69724872 CAAGGAACAGAGTCCTCCTGGGG + Intergenic
1129227772 15:74179898-74179920 GGTGGAGCAGAGCCCTCCTGAGG + Intronic
1129714616 15:77839881-77839903 ACTGGAGCAGGGGCCTAGTGGGG - Intergenic
1129943843 15:79522247-79522269 AATCGAGCAGAGGCCTCTTTGGG + Intergenic
1130687460 15:86051382-86051404 AAGGGAACAGAGTCCTCATGAGG + Intergenic
1143570795 17:7756959-7756981 AATGAAGCAGAGGCCTGGTATGG - Intronic
1152645159 17:81465372-81465394 ACTGGGGCAGAGCCCTCGAGGGG - Exonic
1158318086 18:56234606-56234628 AATGGAGTAGAGACCTTGTGTGG + Intergenic
1160532670 18:79574789-79574811 AATGGAGCAGAGGCCTCTCCAGG + Intergenic
1161559149 19:4961473-4961495 CGTGGAGCAGAGTCCCCTTGAGG - Exonic
1162149350 19:8633750-8633772 AAGGGAGCAGGGTCCTGGGGAGG + Intergenic
1163745427 19:19043762-19043784 AAGGGAGCAGAGTGGTAGTGAGG - Intronic
1166438140 19:42786917-42786939 AATTGAGCAGAGCCCAAGTGAGG + Intronic
1166457094 19:42950711-42950733 AATTGAGAAGAGTCCAAGTGAGG + Intronic
1166467040 19:43041570-43041592 AATTGAGCAGAGTCCAAGTGAGG + Intronic
1166473172 19:43097656-43097678 AATTGAGAAGAGTCCAAGTGAGG + Intronic
1168154105 19:54463669-54463691 ACTGGGCCAGAGTCCTCGCGAGG - Exonic
928154158 2:28860605-28860627 AGTGGAGCAGAGACATTGTGAGG - Intronic
935997454 2:108789254-108789276 AAGGGAGCAGAGTCTTCATTTGG - Intronic
936385454 2:112024593-112024615 AATGGAACAGAGGCCTCTTTGGG - Intronic
939592458 2:144082291-144082313 AAGGGAGCTCAGTGCTCGTGTGG + Intronic
940109879 2:150139993-150140015 CATGGAGCAGATTCCTAGTGGGG - Intergenic
941416975 2:165233083-165233105 AATGGGGCAGAGTTTTCCTGGGG - Intergenic
943983942 2:194594979-194595001 CATGGAGAAAAGTCCACGTGAGG - Intergenic
944060507 2:195567041-195567063 AATGGAGCAGAGGTCTCCAGAGG + Intergenic
945789295 2:214284543-214284565 AAAGGAGCAGAGTGCTCCTGAGG - Intronic
946034304 2:216729699-216729721 AATGGGGCAGAGACCCAGTGGGG - Intergenic
948111949 2:235463527-235463549 AATGGAGAAGAGTCCAACTGAGG + Intergenic
948495989 2:238350331-238350353 GGTGGAGCAGAGTCCCCGTGTGG + Intronic
948528279 2:238586970-238586992 CAGTGAGCAGAGTCCTGGTGTGG + Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1173490445 20:43475489-43475511 AATGGTGCAGACTGCTTGTGGGG - Intergenic
1182135690 22:27900824-27900846 AATGCAGCAGATTCCTCATTTGG + Intronic
1183164026 22:36133925-36133947 GATGGAGCAGAGTCCTCCAGCGG - Intergenic
952698454 3:36298346-36298368 AATGCAGCAGAGACTTCGTCTGG + Intergenic
954082864 3:48222651-48222673 GATGGAGCAGAGCCTTCGTCTGG + Intergenic
954433292 3:50482746-50482768 AATGCAGCAGAGACCTGGTGGGG + Intronic
954504403 3:51055170-51055192 AATGGAGAAGATTCCTCTTTAGG - Intronic
954873299 3:53784272-53784294 GATGGAGGAGAGTCCTGGGGAGG - Intronic
959975015 3:112448862-112448884 AATGGAGCAGAATACTTGTTAGG - Intergenic
961438074 3:126932949-126932971 AAAGGAGCATGGTCCTTGTGGGG + Intronic
965439043 3:168690836-168690858 AATGGAGCAGAGACTGAGTGGGG + Intergenic
966163750 3:176993968-176993990 AATGGAGCTGAGGCCGGGTGCGG - Intergenic
968115408 3:196085584-196085606 GTTGAATCAGAGTCCTCGTGGGG + Intergenic
972368110 4:38394795-38394817 GATGGAGCAGGGTCCTCTTCAGG - Intergenic
974992070 4:69105133-69105155 GATAGTGCAGAGTCCTTGTGGGG - Intronic
981857026 4:149307030-149307052 AAAGGAGAGGAGTCCTCGTCTGG - Intergenic
986741385 5:10708693-10708715 AATGGGGGAAAGTCCTTGTGCGG + Intronic
996466784 5:123811875-123811897 AATTGAGCACAGTCATTGTGTGG + Intergenic
998230393 5:140357804-140357826 AGGGGAGCAGTGCCCTCGTGTGG + Intergenic
999208942 5:149871024-149871046 AATGGAGCAAAGGCCTTGAGGGG + Intronic
999689636 5:154135556-154135578 AAAGGAGCACAGGCCTGGTGGGG - Intronic
999884625 5:155907734-155907756 AATGGAGCCTACTCCTGGTGAGG + Intronic
1000694038 5:164358307-164358329 CAGGGAGCAGAGTCCTCAGGTGG - Intergenic
1002057560 5:176607303-176607325 AATGGAGCTGGGTTCTAGTGGGG - Intronic
1004454542 6:15779707-15779729 AATGGGGCTGTGTCCTGGTGTGG - Intergenic
1005576819 6:27197670-27197692 AGTGGAGGAGAGACCACGTGTGG - Intergenic
1006999662 6:38298143-38298165 ACTGGAGCAGAGGCCAGGTGTGG - Intronic
1014798798 6:125755133-125755155 AATGGAGCAGAGTCATTCTTGGG + Intronic
1021795027 7:24245830-24245852 TATGGAGCAGTGTGCTTGTGAGG + Intergenic
1022377961 7:29832471-29832493 AATTGAGCAGAGATCTCATGGGG - Intronic
1026270657 7:68833728-68833750 AATGGAGAAGAGTGATCATGAGG - Intergenic
1028032436 7:85933010-85933032 ATAGGAGCAGAGACCTCATGGGG + Intergenic
1029292852 7:99515857-99515879 AATTAAGCTGAGTCCTCGAGAGG + Intronic
1030050392 7:105532286-105532308 AATGGAGCCGAGGACTCGCGCGG + Exonic
1031570681 7:123355724-123355746 AATGGAGAAAAGTCATGGTGGGG - Intergenic
1031775524 7:125904000-125904022 GATGGAGCAGAGCCCTAATGAGG + Intergenic
1034341832 7:150362151-150362173 ACTGCTGCAGAGTCCTGGTGAGG + Intergenic
1037734058 8:21552975-21552997 AGTCTAGCAGAGTCCTCCTGGGG + Intergenic
1038504166 8:28070255-28070277 CATGGAGCAGAGTGCTCTTAAGG - Exonic
1040493144 8:47942957-47942979 AATGGAGCAAAGACGTGGTGAGG - Intronic
1047857153 8:128923563-128923585 AATGGAGCAGAGACTTTTTGCGG - Intergenic
1048215035 8:132486411-132486433 GATGGAGCAGAGGCCACATGGGG + Intergenic
1049016864 8:139926175-139926197 AATGCAGCAGAGGCCTGGGGAGG + Intronic
1049189078 8:141276600-141276622 ACTGGGGCAGAGTCCGAGTGAGG - Intronic
1051672171 9:19521944-19521966 AATGGAGGAGCTTCCACGTGAGG - Intronic
1055734683 9:79314272-79314294 AATGCAGCAGGGTTCTCCTGAGG + Intergenic
1057906016 9:98984090-98984112 AATCGAGCAGTGTCCTCCTCTGG - Intronic
1058672991 9:107376436-107376458 AATGGAGCAGAGTTCTAAAGGGG + Intergenic
1061721242 9:132552726-132552748 ACTGGATCAGAGTCCTGGAGAGG - Intronic
1062214988 9:135384312-135384334 ACTGAGGCAGGGTCCTCGTGCGG - Intergenic
1190969474 X:55334745-55334767 AATGGAGCAGAGACCTGGAGTGG + Intergenic