ID: 1113488793

View in Genome Browser
Species Human (GRCh38)
Location 13:110676307-110676329
Sequence GTCCAAGGGGACCAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113488779_1113488793 22 Left 1113488779 13:110676262-110676284 CCCCTGGCTGTGGGCAGAGCCAC 0: 1
1: 0
2: 3
3: 31
4: 371
Right 1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 357
1113488778_1113488793 30 Left 1113488778 13:110676254-110676276 CCAAGGTGCCCCTGGCTGTGGGC 0: 1
1: 0
2: 4
3: 39
4: 397
Right 1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 357
1113488780_1113488793 21 Left 1113488780 13:110676263-110676285 CCCTGGCTGTGGGCAGAGCCACA 0: 1
1: 0
2: 5
3: 33
4: 385
Right 1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 357
1113488785_1113488793 3 Left 1113488785 13:110676281-110676303 CCACAGGGTGTGGACACCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 357
1113488781_1113488793 20 Left 1113488781 13:110676264-110676286 CCTGGCTGTGGGCAGAGCCACAG 0: 2
1: 0
2: 8
3: 53
4: 514
Right 1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113488793 Original CRISPR GTCCAAGGGGACCAGGGAGA AGG Intronic
900490463 1:2946322-2946344 ATCCATGGGGGCCCGGGAGAAGG - Intergenic
900693556 1:3996158-3996180 GTGCCAGGTGACCAGAGAGACGG - Intergenic
900951079 1:5858601-5858623 GTCTGAGGGGAGCAGGGGGATGG - Intergenic
900992872 1:6106053-6106075 GGCCAAGGGGGCAAGGTAGAGGG + Intronic
901065630 1:6492912-6492934 GGCCAGGGGGCACAGGGAGAAGG - Intronic
901200693 1:7465481-7465503 ATCCAAGGAGACCAGGGGCATGG + Intronic
901457557 1:9371924-9371946 GTCTGAGTGCACCAGGGAGATGG - Intergenic
902372490 1:16015182-16015204 GGGCAAGGGGACCAGGGACCTGG - Exonic
903008831 1:20316276-20316298 GTCCAAAGGGAGCACGGACAGGG + Intronic
903382425 1:22906438-22906460 GTGCAGGGGAACCTGGGAGATGG - Intronic
903815376 1:26060777-26060799 GGCCCAGGGACCCAGGGAGAAGG + Intronic
904900406 1:33852589-33852611 GTCCACTGGGGGCAGGGAGAGGG - Intronic
905631810 1:39522987-39523009 GTCCTGGGGGGCAAGGGAGAAGG - Exonic
905665951 1:39763200-39763222 GTCCTGGGGGGCAAGGGAGAAGG + Exonic
906943332 1:50275058-50275080 TGCCAGGGGGACCAGAGAGAGGG - Intergenic
908038506 1:60082184-60082206 TTCCAAGAGCAGCAGGGAGATGG - Intergenic
913412132 1:118563740-118563762 CTCCAGGGGGACCCTGGAGATGG + Intergenic
913457770 1:119051168-119051190 GTCGAATGGGAGGAGGGAGAAGG - Intronic
914753221 1:150549534-150549556 GTCTAACGGGACCCGGGAGAGGG - Intronic
915251397 1:154591523-154591545 GCCCAAGTGGAGCAGGGAGGTGG + Intronic
915326205 1:155082369-155082391 GTCCAACAAGACCAGGGAGTAGG - Intronic
915474748 1:156147030-156147052 GCCCAAGGGGAACAGGGGGCAGG + Intergenic
917445080 1:175099941-175099963 GTCCAAGAGGACCACCTAGAGGG - Intronic
917863942 1:179175369-179175391 ATTCAAGGGGACCAGGGAAAAGG - Intronic
918887307 1:190211691-190211713 GGCCAACTGGAACAGGGAGAAGG + Intronic
920044801 1:203126409-203126431 GTGCAAGGGGACGAGGAGGAAGG + Intronic
923349882 1:233093652-233093674 GTCCATGGGTACGGGGGAGAGGG + Intronic
924062791 1:240193678-240193700 GGCCAAGGAGGCCCGGGAGAAGG - Intronic
1063953638 10:11246681-11246703 GTCCAAGGAGAGCAGAGTGAGGG - Intronic
1064156739 10:12909043-12909065 GTCCAAGGATACCAGGAAGATGG - Intronic
1065915799 10:30354149-30354171 GCCCCTGGGGACCAGGGACATGG - Intronic
1067178907 10:43970401-43970423 GTCCAAGGGATCCAAGGGGAAGG - Intergenic
1067375966 10:45727698-45727720 GTCCCCGGCCACCAGGGAGAGGG + Intronic
1067883668 10:50068386-50068408 GTCCCCGGCCACCAGGGAGAGGG + Intronic
1068136083 10:52952337-52952359 CTCCCAGGGGCCAAGGGAGAGGG + Intergenic
1069775167 10:70922652-70922674 GTCCCATGGGCCCTGGGAGAGGG + Intergenic
1070781681 10:79141126-79141148 GACACAGGGGACGAGGGAGAGGG + Intronic
1071429422 10:85595105-85595127 GGGCAAGGGGTGCAGGGAGAAGG - Intergenic
1071526834 10:86364137-86364159 GGCCAAGGGAAGCGGGGAGAGGG - Intronic
1072199555 10:93145906-93145928 GGCCACAGGGACCAGGGAGCTGG - Intergenic
1072895104 10:99359813-99359835 CACTAAGGGGAACAGGGAGAGGG - Intronic
1073115651 10:101090066-101090088 GTCCTAGGGAGCCTGGGAGAGGG - Exonic
1074372093 10:112908500-112908522 GCCCAGGGGGAAAAGGGAGACGG - Intergenic
1074434022 10:113418479-113418501 GTCCAAAAGGACCTGGGAGATGG + Intergenic
1074474597 10:113758716-113758738 GTCCAAGGAGAGGAGAGAGATGG + Intronic
1074819230 10:117166478-117166500 GTCCAAGGGCACCTGAGAGATGG + Intergenic
1074944070 10:118264308-118264330 TTCCAAAGGGAATAGGGAGATGG + Intergenic
1075521791 10:123147847-123147869 GTCCAAGGGGTCCAAGGAGTCGG + Intergenic
1075677649 10:124307350-124307372 GTCTAATGGGACCATGGAGTGGG - Intergenic
1075863317 10:125696351-125696373 GTCCACAGGGACCAGGGAATTGG - Intergenic
1076061982 10:127420158-127420180 GTGCACGGAGAACAGGGAGAGGG - Intronic
1076545110 10:131240039-131240061 GTCAGCGGGGTCCAGGGAGAAGG - Intronic
1076601694 10:131660856-131660878 GTGCTAGTGGACCAGGAAGAAGG + Intergenic
1076785695 10:132748855-132748877 GACCAGGAGGACCAAGGAGAGGG - Intronic
1077233978 11:1471059-1471081 GGCCCAGAGGGCCAGGGAGATGG + Intronic
1077320158 11:1937386-1937408 CTCCAAGGGGACCTAGGACAGGG + Intronic
1077339294 11:2018830-2018852 ATCCGAGGGGACCTGGGCGAAGG - Intergenic
1077750013 11:4956685-4956707 GTCTAATGGGTCCGGGGAGATGG - Intronic
1078907366 11:15699998-15700020 GTCCCAGGAGTCCAGGGAGGGGG - Intergenic
1079140228 11:17803808-17803830 ATGCAAGGGGTCCATGGAGATGG - Intronic
1079801417 11:24874291-24874313 GTCCAAGGGGAGTTGGTAGATGG + Intronic
1082786940 11:57322464-57322486 GTGGAAGGAGAACAGGGAGAGGG - Intronic
1083886883 11:65577291-65577313 GACCATGGGGTCCAGGGGGAGGG + Intronic
1084007794 11:66332418-66332440 GAGCAAGGGTGCCAGGGAGATGG - Exonic
1084169768 11:67395500-67395522 GACCATGCAGACCAGGGAGAGGG - Intronic
1084266716 11:68008784-68008806 GGCCCAGGGCACCAGGGAGATGG + Intronic
1085458434 11:76678855-76678877 GTCCAAGAGGCCAAGTGAGAGGG + Intergenic
1085557459 11:77438003-77438025 GTCCAAGGAGAAGAGGGAGAAGG - Intronic
1085690115 11:78657571-78657593 TTCCAAGGGGGCCTGGGAGGAGG - Exonic
1087059873 11:93967003-93967025 GATCAAGGGGGCCTGGGAGAAGG - Intergenic
1089381736 11:118037669-118037691 TTGCAAGGTGACCAGGGAGTCGG + Intergenic
1089779151 11:120860946-120860968 ATACAAGGGGGCCTGGGAGAGGG - Intronic
1090243670 11:125201093-125201115 GTCCTGGGAGACCAGTGAGAAGG - Intronic
1090372809 11:126268621-126268643 GTCGAAGGGGACCATGGATCGGG + Intronic
1091205992 11:133821564-133821586 GTCCAATGTGACCACGGAGGGGG + Intergenic
1202822278 11_KI270721v1_random:74012-74034 ATCCGAGGGGACCTGGGCGAAGG - Intergenic
1096077017 12:48812369-48812391 GGACAAGGTGAGCAGGGAGAAGG + Intergenic
1096351371 12:50903834-50903856 TTGCAAGGTGACCAGGGAGTTGG + Intergenic
1096565007 12:52471116-52471138 GACCAAGGTGAGCAGGGAGTGGG - Exonic
1096567020 12:52490553-52490575 GACCAAGGTGAGCAGGGAGTGGG - Exonic
1100608073 12:96168273-96168295 TTCCAAGGGGACCAGTTAGATGG - Intergenic
1100608433 12:96170641-96170663 GTCCGGGGGGAGAAGGGAGAAGG + Intergenic
1101741036 12:107500291-107500313 GTCATGGGGGGCCAGGGAGAGGG - Intronic
1102224088 12:111215759-111215781 GTCTAAGCTGACCAGGGAGAGGG - Intronic
1102739947 12:115198286-115198308 GTCCAGGGAGGCCAGTGAGAAGG + Intergenic
1103054517 12:117808215-117808237 GTCCAAGGGGCCCCTGGACAGGG - Intronic
1103398930 12:120629160-120629182 GGCCAAGGGCAGCACGGAGAAGG + Intergenic
1104639340 12:130457488-130457510 GTCCCAGGGGAGCAGGGAGCGGG - Intronic
1104854027 12:131894102-131894124 GTAGAAGGGGAACAGGGAGCGGG + Intergenic
1107733960 13:43376733-43376755 GGCCAAGGGGAACAGTGTGAGGG - Intronic
1109924571 13:69119800-69119822 CTCCAAGGGGTCCTTGGAGAAGG + Intergenic
1110130279 13:72000815-72000837 GTCCAAGGCAAGCAGGGTGATGG + Intergenic
1110321670 13:74167056-74167078 GTTCAAGGTGAGCAGAGAGAAGG - Intergenic
1113002838 13:105662763-105662785 CTGCAAGGGGAGCAGGCAGAAGG + Intergenic
1113308760 13:109108821-109108843 GACCAAGGGGCCCAGGGTGAGGG + Intronic
1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG + Intronic
1114062997 14:19037537-19037559 GTCCATGGGTACCAGGGCGGGGG + Intergenic
1114099262 14:19362460-19362482 GTCCATGGGTACCAGGGCGGGGG - Intergenic
1114255238 14:20996112-20996134 GTCAAAAGGGGCCAGGGAGAAGG - Intronic
1114648111 14:24266923-24266945 TTCCCAGGAGACCTGGGAGAGGG + Intronic
1116214346 14:41992012-41992034 GTGAAAGGGCACCAGAGAGAGGG - Intergenic
1116446745 14:45020392-45020414 TTGCAAGGTGACCAGGGAGTCGG + Intronic
1118359149 14:65041499-65041521 CTCCACGGCCACCAGGGAGAAGG + Intronic
1118461997 14:65995843-65995865 GACCCAGGAGTCCAGGGAGAAGG + Intronic
1118465252 14:66024833-66024855 GTGCAAGGGGATCTGGGTGATGG - Intergenic
1118711178 14:68520928-68520950 GTCCATGGAGACCAGGCTGATGG + Intronic
1118925517 14:70187762-70187784 GGCCAAGGGGGCGAGGGAGAAGG - Intronic
1121336363 14:93079788-93079810 GCCAAAGGGGAAGAGGGAGAAGG + Intronic
1121751603 14:96362821-96362843 GTCCAAGGGGACCTGGGCGAGGG + Exonic
1121904039 14:97723524-97723546 GTCTTAGGGGTCCTGGGAGAAGG - Intergenic
1122666785 14:103335041-103335063 AGCCATGGGGACCAGGGCGAAGG + Intronic
1122691714 14:103534830-103534852 CTCCCAGGGCACCAGGGAGCTGG + Exonic
1122871101 14:104639419-104639441 CTCCAGGGGGACCTGGGAGTGGG - Intergenic
1123192066 14:106580973-106580995 GAGCAAAGGCACCAGGGAGAAGG + Intergenic
1202921727 14_KI270723v1_random:34340-34362 GAGCAAGGGGACGAGGGGGAAGG - Intergenic
1124625515 15:31305457-31305479 GTCCACTGGGCCCAGGGAAAAGG - Intergenic
1125115002 15:36080305-36080327 TTCATAGGGGAGCAGGGAGATGG + Intergenic
1125748897 15:42015357-42015379 GGCCAAGGGCAACAGGCAGAGGG - Intronic
1127610006 15:60627441-60627463 GTCCAAGGTGATCAGACAGATGG + Exonic
1127968477 15:63941528-63941550 AGCCAGGGGGACCTGGGAGAAGG - Intronic
1128677888 15:69625093-69625115 GTCCAAGGGGATCTGGGTGGTGG - Intergenic
1129760292 15:78125305-78125327 GTCTAAGGTGCCCAGTGAGAAGG + Intronic
1130691111 15:86082231-86082253 GTCCATGGGGAGCAGGGATGGGG - Intergenic
1131332001 15:91509553-91509575 GTCCAAGGGGATAAGGGTGAGGG - Intergenic
1132500051 16:281105-281127 TGCCCAGGGCACCAGGGAGAGGG + Intronic
1132713410 16:1279089-1279111 TTCCGAGGGGCCCAGGGAGCAGG + Intergenic
1132718836 16:1306078-1306100 TCCCAAGGGGACCAGGGCAAAGG + Intergenic
1132723315 16:1327495-1327517 GTCCCAAGGGACCTGAGAGACGG - Intergenic
1133328439 16:4956645-4956667 GTCAGAGGTGGCCAGGGAGATGG - Intronic
1133740405 16:8646985-8647007 GGCCAAGGGTAGCAGGAAGATGG - Exonic
1134052382 16:11145954-11145976 GGCCAAGGGGACCATGGCGGGGG - Intronic
1134331282 16:13253371-13253393 GTCCAAAGGTACAAGGGAGATGG + Intergenic
1134862919 16:17576743-17576765 TTTCAAGGGAGCCAGGGAGAAGG + Intergenic
1135499471 16:22981300-22981322 TTCCCAGGAGACCAGGGAGAAGG + Intergenic
1135636757 16:24083939-24083961 GTCCAAGATGAAGAGGGAGATGG + Intronic
1135822041 16:25692945-25692967 GGCCAACGGGAGCAGCGAGAGGG + Exonic
1136450664 16:30352786-30352808 GTCCAAAGGGACTGTGGAGAAGG + Exonic
1136929986 16:34410049-34410071 GTCAAACAGGGCCAGGGAGAAGG - Intergenic
1136974588 16:35001756-35001778 GTCAAACAGGGCCAGGGAGAAGG + Intergenic
1137366440 16:47863569-47863591 TTCCAAGGTGACCAAGGACAAGG - Intergenic
1139288421 16:65835740-65835762 GTCCAAGAGAACCAGGCAGGAGG - Intergenic
1140780444 16:78291765-78291787 TTCCAAGGCCACCAGGGAGCAGG + Intronic
1141065934 16:80913857-80913879 GTCCAAGGAAGCCATGGAGATGG + Intergenic
1141385317 16:83617112-83617134 TTCCAAGCGGATTAGGGAGAGGG - Intronic
1142024252 16:87804102-87804124 GTGCCAGGAGACCATGGAGAAGG + Intergenic
1142895571 17:2975653-2975675 GTCCAAGAGGAAAAGGGGGAAGG - Intronic
1143321733 17:6072728-6072750 GACCAGGAGGCCCAGGGAGAAGG - Intronic
1143480111 17:7223255-7223277 GCCCCAGGGCTCCAGGGAGAGGG - Intronic
1143591683 17:7888901-7888923 TCCCAAAGGGAGCAGGGAGATGG + Intronic
1144833150 17:18142863-18142885 GTCCAAGGGGACAGCAGAGAAGG + Intronic
1145995974 17:29105251-29105273 GTGCCAGGGCATCAGGGAGAGGG + Intronic
1147132180 17:38415897-38415919 CTCCCTGGGGAACAGGGAGAAGG - Intergenic
1147334039 17:39716229-39716251 GTCCAAGTGAACCAGGGAACTGG - Intronic
1147617451 17:41837920-41837942 GTCCCAGGGTGCCATGGAGATGG + Exonic
1147689075 17:42304493-42304515 GTGACAGGGGAACAGGGAGATGG - Intronic
1147741518 17:42673294-42673316 TTCCTAGGGGGCCAGGGAGAGGG + Exonic
1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG + Exonic
1148044873 17:44737275-44737297 GTCCAAGAGGAACCAGGAGACGG - Intronic
1148047058 17:44750707-44750729 GCCCAAGGGCTCCAGGGAGCAGG + Exonic
1149566276 17:57642897-57642919 GTAGAATGGGCCCAGGGAGAAGG + Intronic
1149656245 17:58310925-58310947 TTCCAAGGGGAGCAGGGTGCTGG + Exonic
1150456995 17:65314173-65314195 GTCCAGGAGGTCCTGGGAGAGGG - Intergenic
1151215023 17:72571467-72571489 GTCCATGGTGACCAGGGGAAGGG + Intergenic
1151438612 17:74114088-74114110 TTCCAAGGGGATCGGGGAGCCGG - Intergenic
1151577341 17:74959354-74959376 GTCCAAGGTGGGCAGGGACAAGG - Intronic
1151823321 17:76509072-76509094 GAATAAAGGGACCAGGGAGAGGG + Intergenic
1151825067 17:76519430-76519452 GAATAAAGGGACCAGGGAGAGGG - Intergenic
1152251797 17:79216355-79216377 GACCATGGGGACCACGGAGCAGG + Intronic
1152570991 17:81121215-81121237 GTCCAGGGAGTCCAGGGAGTCGG + Exonic
1152645233 17:81465648-81465670 GGCCAAGGGGACCTGGGATTGGG - Exonic
1152923377 17:83076924-83076946 CTCCCAGAGGACCAGGGGGAGGG + Intergenic
1152927950 17:83096196-83096218 AGCAAAGGGGACCTGGGAGAGGG + Intergenic
1153528193 18:6017054-6017076 GACCACGGGCTCCAGGGAGATGG - Intronic
1154063818 18:11088051-11088073 GTCCAGGGGGAGCAGAGACAAGG - Intronic
1154213676 18:12400056-12400078 GTCAACGGGGTTCAGGGAGAAGG - Intergenic
1154232460 18:12569744-12569766 GTCCAAGGGGGCAAGGGGGCTGG - Intronic
1155176527 18:23306090-23306112 ATCCAAGGCCACCTGGGAGATGG + Intronic
1157745129 18:50128667-50128689 GGCCAAAGAGCCCAGGGAGAAGG + Intronic
1157779739 18:50427729-50427751 GCCCCAGGGGGCCAGGGAGGAGG + Intergenic
1157901767 18:51524913-51524935 GTCCAAGTAGTCCAGGCAGAAGG - Intergenic
1159085219 18:63782485-63782507 GCCCAAGCGGACCAGGGCCAGGG - Exonic
1159182566 18:64927793-64927815 GTACAAGGGGAGCAGGTAGAAGG - Intergenic
1160081000 18:75727037-75727059 GTCCCAGGAGCACAGGGAGAGGG - Intergenic
1160329476 18:77978444-77978466 GTTCATGGGGACCAGGGGTAAGG - Intergenic
1161052755 19:2173490-2173512 GTCCTCGGGGAGCAGGCAGAGGG + Intronic
1161063952 19:2228504-2228526 AGCCAGGGAGACCAGGGAGATGG + Intronic
1161706601 19:5825062-5825084 GACCAAGGGGAGGCGGGAGATGG + Intronic
1162784014 19:13022989-13023011 GTCCAAGGGGAGGAGGGAACCGG - Intronic
1162792909 19:13072216-13072238 GACCAGGGGGACCAGGGTGGGGG + Intronic
1162911224 19:13848845-13848867 GTCGGAGAGGACCAGGGAGGTGG - Intergenic
1162932263 19:13963004-13963026 GTCCAGGGGGTTCAGGGAGGTGG + Exonic
1162958424 19:14112565-14112587 GCCTCAGGGGACCAGGGAGGAGG + Intronic
1163019492 19:14474837-14474859 GTCCATGGGGGACAGGGACATGG - Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1164538694 19:29106184-29106206 GACCAAGGGGGTCAGGGAGGTGG - Intergenic
1165049446 19:33132268-33132290 GTCCTGGGGGACCATGGCGAGGG + Exonic
1165308103 19:35014301-35014323 ATCCAAGGGGCCCAGGGTGGTGG - Exonic
1165406291 19:35633153-35633175 GTCCAGGGGGCCCAGGCAGAGGG - Exonic
1165860872 19:38908703-38908725 GGCAAAGGGGACCAGGCAGAGGG - Intronic
1167217029 19:48171578-48171600 CTCCAAGTGAACCAGGGATAAGG + Intronic
1168231127 19:55032341-55032363 CTCCAGGGGCACCAGGGAGCTGG + Exonic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
925392584 2:3507143-3507165 GTCCATGGGGAGCAGGGATTGGG + Intronic
926119691 2:10235261-10235283 GTCCAATGGGACCATAAAGAAGG + Intergenic
926720991 2:15959969-15959991 GACCTATGAGACCAGGGAGATGG - Intergenic
927215953 2:20667857-20667879 GGCCAGGGAGACCTGGGAGAGGG - Intronic
927468937 2:23357802-23357824 GGCCAAGTGGAGAAGGGAGATGG + Intergenic
928558284 2:32448638-32448660 GTGGAAGGGGACCGTGGAGAGGG + Intronic
929770623 2:44888627-44888649 GCCCAATGTCACCAGGGAGATGG - Intergenic
929835012 2:45387697-45387719 ATCCGAAGTGACCAGGGAGAAGG + Intergenic
930708484 2:54527694-54527716 GTCCAAGGGGGCCAGGGACCTGG - Intronic
931286254 2:60834549-60834571 CTCCCAGGGGGCCAGGGAGATGG - Intergenic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932674042 2:73762795-73762817 CTCCAGGGGGACCAGGAGGAGGG + Exonic
932852499 2:75200439-75200461 CTGGAAGGGGAACAGGGAGAAGG - Intergenic
933967833 2:87444511-87444533 GGCCATGGTGACCAGGGAGATGG - Intergenic
936325965 2:111505988-111506010 GGCCATGGTGACCAGGGAGATGG + Intergenic
938106049 2:128530491-128530513 GTCCCTGGGGACCAGGGACCAGG - Intergenic
938780657 2:134581848-134581870 GTTCAAGGGCAGGAGGGAGATGG - Intronic
939204021 2:139076737-139076759 GTTCCATGGGACCAGGTAGAGGG + Intergenic
939234834 2:139477689-139477711 GTGGAAGGGGACCCGGAAGAGGG - Intergenic
939873122 2:147547324-147547346 GTCCAAGAGGACCTGGTAGAAGG + Intergenic
942232220 2:173871119-173871141 GTCCAATGTGTCAAGGGAGAGGG - Intergenic
942241675 2:173967987-173968009 GTTCAAGGTGACAGGGGAGAGGG + Intergenic
942374759 2:175325602-175325624 TTGCAAGGTGACCAGGGAGTCGG - Intergenic
943763608 2:191636347-191636369 GTCCTAGGGGAGCACAGAGAAGG + Intergenic
944413008 2:199460015-199460037 GTCCGAGGCGACCTGGGAGTCGG + Intronic
947050133 2:226032285-226032307 GACAAGGGGGACCAGAGAGAGGG - Intergenic
947731659 2:232434735-232434757 GGTCAAGGGGCCCAGGGAGGTGG + Intergenic
948655893 2:239476508-239476530 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655899 2:239476530-239476552 GTCCAAGGTCAGCAGGGAGACGG + Intergenic
948655909 2:239476574-239476596 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655920 2:239476618-239476640 GCCCAAGGTCAGCAGGGAGACGG + Intergenic
948655931 2:239476662-239476684 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655942 2:239476706-239476728 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655954 2:239476750-239476772 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655964 2:239476794-239476816 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655976 2:239476838-239476860 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948655986 2:239476882-239476904 GCCCAAGGTCAGCAGGGAGATGG + Intergenic
948821748 2:240553349-240553371 GATCAAGGTCACCAGGGAGAAGG - Intronic
949031666 2:241800044-241800066 GTGCCTGGGCACCAGGGAGAAGG + Intronic
1169030402 20:2402387-2402409 GGCCAAGGGGAGCAAAGAGATGG - Intronic
1170575291 20:17658157-17658179 GTCCACTGTGTCCAGGGAGAAGG - Intronic
1173834374 20:46115651-46115673 GTCAAATGGGACCAGGCAGAAGG + Intergenic
1173909204 20:46651531-46651553 CTCCAGGAGGAGCAGGGAGAGGG - Intronic
1173916001 20:46709431-46709453 AACGAAGGGGACCCGGGAGATGG + Intergenic
1173949574 20:46979354-46979376 GGCCAAGGGGGCCAGAGGGAGGG + Intronic
1174209299 20:48864821-48864843 GTCCCTGTGGACCAGGGGGAAGG + Intergenic
1175633513 20:60561324-60561346 CTCCAAGGGGACCCTGGAGATGG - Intergenic
1175692143 20:61073232-61073254 GTCAGAGGGGGCCAGGGGGATGG - Intergenic
1176515462 21:7780478-7780500 GTCCCATGGGAGCAGGGAGGAGG - Intergenic
1178380079 21:32100467-32100489 CTCGAAGGGGACCAGGGAAGGGG - Intergenic
1178649490 21:34410490-34410512 GTCCCATGGGAGCAGGGAGGAGG - Intergenic
1179595130 21:42438227-42438249 CTCCATGGTGACAAGGGAGAGGG + Intronic
1179894234 21:44352320-44352342 GGCAAAGGGGAGGAGGGAGAGGG + Intronic
1180481490 22:15760164-15760186 GTCCATGGGTACCAGGGCGGGGG + Intergenic
1181044872 22:20209749-20209771 GTCCAGGTGGCCCAGGGAGGTGG + Intergenic
1181148633 22:20866718-20866740 GGGCAAGGGCACCAGGCAGAGGG - Intronic
1181934671 22:26429776-26429798 GTCACAGGGGAGAAGGGAGATGG - Intronic
1182848119 22:33448077-33448099 GTCAATGGGGGACAGGGAGAGGG + Intronic
1183646921 22:39132406-39132428 GCCCAAGGGGAGCATGGAAAAGG - Exonic
1184019412 22:41810406-41810428 GCCCAAGGGGACCACTTAGAAGG - Intronic
1185281756 22:49972648-49972670 CTCCAGTGGGACCAGGGAGGAGG - Intergenic
950216572 3:11163998-11164020 GTCGATGGGTACCAGGGATATGG - Intronic
950446437 3:13041556-13041578 GTTCAAGGTGACCATGGCGACGG + Intronic
950707353 3:14791378-14791400 ATCCCAGAGGACAAGGGAGAGGG - Intergenic
950939037 3:16874705-16874727 CTTTAATGGGACCAGGGAGAAGG + Intronic
951178498 3:19630709-19630731 GTCTCCGGGGAGCAGGGAGAAGG + Intergenic
951282684 3:20771987-20772009 GTCTCAGGAGACCAGGGAGAGGG + Intergenic
951838362 3:27006140-27006162 TTGCAAGGTGACCAGGGAGTCGG - Intergenic
952389067 3:32864511-32864533 GTCCAAAGGGCCTAGGGAGCTGG + Intronic
952923784 3:38307149-38307171 GGCCAAGGGGACCTGGGGTAGGG - Intronic
953006026 3:38980052-38980074 GGCCCAGGGGACCAGGCAGAAGG + Intergenic
954414154 3:50384809-50384831 TTCCTCTGGGACCAGGGAGAGGG + Intronic
954417749 3:50402203-50402225 GTCCAGTGTGAACAGGGAGAGGG + Intronic
954422162 3:50424522-50424544 GGCCTAGGGGACCTGGGAGGAGG - Intronic
954631388 3:52049562-52049584 TTCCAAGGGGACAAGGGGGCTGG + Exonic
956738230 3:72255488-72255510 GTCATAGGGGAGCAGGGAGGTGG + Intergenic
960538767 3:118842437-118842459 GTGCAAGGGGACCTGGAAGGTGG - Intergenic
960942890 3:122946004-122946026 GGCCAAGGGGACCAGAGGGAAGG + Intronic
961038687 3:123661807-123661829 GACACAGGGGACCCGGGAGAGGG - Intronic
961586640 3:127933632-127933654 ATCCAAGAGGACCAGGCAGAAGG + Intronic
961816049 3:129550946-129550968 GTGCCAGGGGACCAGAGAGAAGG - Intronic
963126365 3:141820601-141820623 TTGCAAGGTGACCAGGGAGTCGG - Intergenic
963606188 3:147413252-147413274 CTCCAAGGGGTCCAGGAGGAAGG + Intronic
963829102 3:149988049-149988071 CACCTAGGGGAGCAGGGAGAAGG - Intronic
964472973 3:157073755-157073777 GTCGAAGGGAGCCTGGGAGAGGG + Intergenic
965300147 3:166998247-166998269 GTCAGAGGGGACCAGGGTGATGG - Intergenic
966743008 3:183251359-183251381 GTACAAGAGAACCTGGGAGATGG - Intronic
969518771 4:7663756-7663778 ATCCAAGGGGACCAAGGGAAGGG - Intronic
969759857 4:9173983-9174005 GACCAAGGTGAGCAGTGAGAGGG + Exonic
972835885 4:42869388-42869410 GGCAAAGTGGACCAGGAAGAGGG + Intergenic
973639891 4:52892270-52892292 GGCCAAGGGGACAAGGGGGCAGG - Intronic
975313354 4:72927003-72927025 TTGCAAGGTGACCAGGGAGTCGG + Intergenic
981362386 4:143862629-143862651 ATCCAACGGGAGGAGGGAGAGGG + Intergenic
983117797 4:163841103-163841125 ATACATGGGGACCAGGGAGGAGG + Intronic
984081731 4:175255459-175255481 CTCCAGGGGGACCATGCAGATGG - Intergenic
985584671 5:724141-724163 GTCCAAGGGGAACTGAGTGAGGG - Intronic
986858104 5:11894998-11895020 GTCCTATGTGACCAGAGAGAAGG + Intronic
987072938 5:14354844-14354866 GTCCAATGGGACCTAGGAAATGG - Intronic
988868948 5:35366949-35366971 GTCCAAAGGGCTAAGGGAGAAGG + Intergenic
989588170 5:43089106-43089128 GTGGAAGGAGACCGGGGAGAGGG + Intronic
989688298 5:44113694-44113716 TTCCTAGGTGACCAGGGAGTTGG - Intergenic
990468036 5:56087862-56087884 GAGCAAGGGGAAGAGGGAGAAGG - Intergenic
991005677 5:61825715-61825737 ATCCAAGGAGAGCAAGGAGAAGG + Intergenic
991053710 5:62299894-62299916 AACAAAGGGGACCAGGGAGTAGG - Intergenic
992586536 5:78245719-78245741 GTACAAGGGGACCAGGAACAGGG - Intronic
993574742 5:89587077-89587099 GTCCCAGGGTCCCAGGGACAAGG - Intergenic
995012619 5:107274747-107274769 GTCCAGGGAGAAAAGGGAGAAGG + Intergenic
995125713 5:108575464-108575486 TTGCAAGGTGACCAGGGAGTCGG + Intergenic
995271147 5:110220625-110220647 GTCCAAGGTGACCAGAGACTGGG - Intergenic
995623085 5:114049340-114049362 GAGCAAGGAGACCAGTGAGAAGG + Intergenic
996182467 5:120436415-120436437 GCCCAAGGGTTCCAGGGAGATGG - Intergenic
997448601 5:133962942-133962964 GTCAAAGTGGACAAGGGGGAAGG - Intronic
1000495073 5:161972251-161972273 CACCAAGGAGACCAAGGAGATGG - Intergenic
1001293932 5:170485643-170485665 TCCCAAAGGGGCCAGGGAGAGGG + Intronic
1001371994 5:171213939-171213961 GTCTATGGGGACTAGGGAAATGG + Intronic
1002419034 5:179135992-179136014 GTCCAGGGAGACCGGGGAGGTGG - Exonic
1002460946 5:179373545-179373567 GTCCAAGGGGCCCCGGCAGTAGG - Intergenic
1003734310 6:8860704-8860726 CTCCAAGGGCACAGGGGAGAAGG - Intergenic
1004619342 6:17319597-17319619 GCCCAAGAGGGCCAGGTAGAGGG + Intergenic
1005356081 6:24984845-24984867 GTACCAGGGTACCAGGGAAAAGG - Intronic
1005521464 6:26604524-26604546 GGGTAAGGGGACCAGGGAGTGGG + Intergenic
1006491567 6:34392457-34392479 GGCCAAGGGAAGCAGGGAGGGGG + Exonic
1007231930 6:40354308-40354330 GCCCAAGAGGACAAGGGGGAGGG - Intergenic
1007350732 6:41271875-41271897 GGAAGAGGGGACCAGGGAGAGGG - Intronic
1007409479 6:41653678-41653700 GTAGGAGAGGACCAGGGAGAGGG - Exonic
1008087815 6:47262776-47262798 GAGCAAGTGGGCCAGGGAGAGGG + Intronic
1008283566 6:49623395-49623417 GTGGGTGGGGACCAGGGAGAGGG + Intronic
1009320874 6:62286512-62286534 GTACAAGTGGACAGGGGAGATGG + Intergenic
1013007586 6:106088254-106088276 GACCAAGGGGACCATGAAAATGG + Exonic
1013022692 6:106234851-106234873 TTGCAAGGTGACCAGGGAGTCGG - Intronic
1016834811 6:148466478-148466500 ATCTAAGGTGACCAGAGAGAGGG - Intronic
1016886907 6:148967496-148967518 GTCTAATGGGACCAAGGAGATGG - Intronic
1018074769 6:160201900-160201922 GAACAAGGGAACCTGGGAGATGG + Intronic
1018132636 6:160747363-160747385 GGCCAAGGGGACTAGGCTGATGG - Intronic
1019154327 6:170029136-170029158 GTCAAAGGGGGCCTGGGAGCTGG + Intergenic
1019805131 7:3117985-3118007 GTGCAAGGGGAGCAGAGAGAAGG - Intergenic
1019994194 7:4713024-4713046 GCCTAAGGGGGCCAGGAAGAAGG - Intronic
1023542624 7:41282668-41282690 CTCAAAAGGGAACAGGGAGAAGG + Intergenic
1023542692 7:41283137-41283159 CTCAAGGGGGAACAGGGAGAGGG + Intergenic
1024220295 7:47281791-47281813 TTCCAAGGGCAGCAGGGAGGAGG + Intronic
1026895892 7:74009946-74009968 GTCCCCGTGGAGCAGGGAGATGG + Intergenic
1026967243 7:74448038-74448060 TGCCAAGGGGACCTGGGAGCAGG - Intergenic
1028446943 7:90935083-90935105 ATCCAAGGGCAGCAGGTAGAAGG + Intronic
1028587862 7:92469275-92469297 TTGCAAGGTGACCAGGGAGTCGG + Exonic
1029448071 7:100625899-100625921 GGCCAAGGGGGACAGGCAGAGGG + Intronic
1029591686 7:101511273-101511295 GGCCAAGGGAGGCAGGGAGAGGG - Intronic
1031946095 7:127842254-127842276 GTGCATGGGGATCAAGGAGACGG - Intronic
1033648613 7:143323298-143323320 GACGAAGGGGCCCTGGGAGAGGG - Exonic
1033705123 7:143879086-143879108 GTCCAAGGGCGCCTGGCAGACGG - Intronic
1034448869 7:151126865-151126887 GGCCAAGGGGGCCAGGTAGCAGG + Intronic
1034696560 7:153059225-153059247 GTCCATGGTGACCCAGGAGAGGG + Intergenic
1034849860 7:154483473-154483495 TACCAAGGGAACAAGGGAGAAGG + Intronic
1035698819 8:1622357-1622379 TTCCAAGGTAACAAGGGAGATGG + Intronic
1037595073 8:20348150-20348172 GTCACAGGGGAGCATGGAGAAGG + Intergenic
1037648580 8:20816258-20816280 GCTGAAGGGGACCAGGCAGAGGG - Intergenic
1037813322 8:22099119-22099141 GACCAAGTGGAGCAGGGACATGG + Intronic
1041018557 8:53615630-53615652 GTCCAAGGGGTCAGGTGAGATGG + Intergenic
1042310508 8:67374703-67374725 GTTCAGGTGGACCAGAGAGAAGG - Intergenic
1042956612 8:74257807-74257829 GTCCAAGGCAACCACTGAGAAGG - Intronic
1043472797 8:80578630-80578652 GGAGAAGGGGAGCAGGGAGAAGG - Intergenic
1044188787 8:89288557-89288579 GTCTAAGGGGACCATGGATAGGG + Intergenic
1044972009 8:97628891-97628913 GTCCAAGTGGCCCAGAGAAAAGG - Intergenic
1047773072 8:128046180-128046202 AACCAAGGGGACAAGAGAGATGG + Intergenic
1048147760 8:131862370-131862392 ATGCAAGGGGGCCAGGGAGATGG - Intergenic
1048442789 8:134472261-134472283 GGCTAAGGGGAGCAGGGAGGAGG - Intergenic
1048449912 8:134524130-134524152 GTCCAAGGAGAGCAGGGGGATGG - Intronic
1049346373 8:142141290-142141312 ATCCATGGGGGCCAGGGAGCAGG - Intergenic
1049744222 8:144256396-144256418 GGCCAAGGGGGGCAGGGGGAGGG - Intronic
1050767057 9:9147759-9147781 GTAGAAGGGAAGCAGGGAGAGGG - Intronic
1052816721 9:33107515-33107537 GGCCAAGGGGCCCAAGGAGGCGG - Intronic
1052832695 9:33228927-33228949 TTCCAGGGGGTCCAGGCAGAAGG - Intronic
1052924858 9:34006597-34006619 GTCCAGGAGGTCAAGGGAGAAGG + Intronic
1056020441 9:82433338-82433360 GTCCAGGGGGACCAGTGGAAGGG - Intergenic
1056027536 9:82514736-82514758 GGCAAAGGGGAAGAGGGAGAAGG - Intergenic
1057058331 9:91981152-91981174 TTGCAAGGTGACCAGGGAGTCGG - Intergenic
1057787111 9:98095657-98095679 GTGCAAAGGGAGCTGGGAGAGGG - Intronic
1059089171 9:111337254-111337276 TTTCAAGGTGACCAGGGAGTCGG - Intergenic
1059113802 9:111582804-111582826 GTCCTAGGGGACAAGTTAGATGG - Intronic
1059151881 9:111956422-111956444 GAGCAAGGAGATCAGGGAGAAGG - Intergenic
1059530383 9:115030200-115030222 GGCCTAGGGGAAGAGGGAGAGGG - Intronic
1060034451 9:120242904-120242926 GCCCAAGGGAAGCAGGGAGATGG + Intergenic
1060282278 9:122222637-122222659 CTCCAAGTTCACCAGGGAGAGGG - Intronic
1060484931 9:124040957-124040979 GTCCCTGGGGACTGGGGAGAGGG + Intergenic
1061051434 9:128198238-128198260 GGCTAAGGGGACCAGGAACATGG - Intronic
1061365683 9:130171750-130171772 GGCACAGGGGACCTGGGAGAAGG - Intergenic
1061919843 9:133776674-133776696 GACCAAGGGGACCAGGCGGCAGG - Intronic
1062626997 9:137447931-137447953 GCCTGAGGGCACCAGGGAGAGGG - Exonic
1186378358 X:9032927-9032949 GCCCAAGGGGACCCAGAAGAAGG - Intronic
1186795459 X:13043697-13043719 GCCCAAGGGGACCTAGAAGAAGG - Intronic
1187234726 X:17456608-17456630 GACCCAGGGCACCAAGGAGAAGG - Intronic
1187841372 X:23492462-23492484 TTCAGAGGGGAGCAGGGAGATGG + Intergenic
1188513572 X:30961697-30961719 GTCAAAGAGAACAAGGGAGAAGG - Intronic
1189326857 X:40117845-40117867 GTCCAAGGGCACCATCAAGAAGG + Intronic
1193070777 X:77303561-77303583 GTTCATGGGCACCAGGGAAATGG - Intergenic
1194953467 X:100153383-100153405 GTCCAAGCTGACCAGGGAAGAGG - Intergenic
1198280383 X:135135931-135135953 CTCCAAGGAGAACAGAGAGATGG - Intergenic
1198290576 X:135236583-135236605 CTCCAAGGAGAACAGAGAGATGG + Intergenic
1198766005 X:140079897-140079919 TTGCAAGGTGACCAGGGAGTCGG - Intergenic
1199238903 X:145524177-145524199 GAGCAAGGAGACCAGCGAGAAGG + Intergenic
1200223801 X:154405454-154405476 GGCCAAGGTGGCCAGGGAGCAGG - Exonic
1201622047 Y:15970181-15970203 GGCTAGGGGCACCAGGGAGAAGG - Intergenic