ID: 1113493735

View in Genome Browser
Species Human (GRCh38)
Location 13:110712779-110712801
Sequence GCCTAGGGAAGGCGCCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113493729_1113493735 4 Left 1113493729 13:110712752-110712774 CCATGACACAGGGCGGGAAGAGA 0: 1
1: 0
2: 0
3: 9
4: 191
Right 1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 102
1113493724_1113493735 17 Left 1113493724 13:110712739-110712761 CCGAGAACGGTGTCCATGACACA 0: 1
1: 0
2: 2
3: 4
4: 132
Right 1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 102
1113493723_1113493735 20 Left 1113493723 13:110712736-110712758 CCTCCGAGAACGGTGTCCATGAC 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113493735 Original CRISPR GCCTAGGGAAGGCGCCCCTC GGG Intronic
900202857 1:1419158-1419180 GCCTGGGGCAGGTCCCCCTCAGG + Exonic
901728676 1:11262347-11262369 GCCAGGGGAAGCCGCCCGTCTGG - Intronic
904563291 1:31413051-31413073 CCCTAGGGAAGGGGCCGGTCGGG - Intronic
911100970 1:94095563-94095585 GGCCAGGGAAGGGGCCCCGCTGG - Intronic
911669580 1:100592648-100592670 GCATCTGGAAGGGGCCCCTCTGG + Intergenic
920046310 1:203134995-203135017 GCTCAGGGAAGGCCCCCCTAAGG - Intronic
1071076283 10:81757004-81757026 GCCTGGGGAAGGGCCCTCTCTGG - Intergenic
1075864257 10:125704256-125704278 GCCCAGGGCAGGCACCTCTCTGG - Intergenic
1077078252 11:710890-710912 GGCCGGGGAAAGCGCCCCTCTGG + Intronic
1078023645 11:7674225-7674247 GCCCAGGGTAGGCGCCCATGAGG - Intronic
1079518008 11:21290603-21290625 GCATATGGCAGGTGCCCCTCTGG + Intronic
1083295695 11:61714313-61714335 GCCCAGGGAAGGTGGCTCTCTGG + Intronic
1083731372 11:64654233-64654255 GCCTCGGGAAGGGGGCCCTGGGG - Intronic
1084474773 11:69382515-69382537 GCCTGGGGCAGGCGCACTTCCGG - Intergenic
1084720016 11:70899501-70899523 CCCAAGGGAAGCCGCCACTCAGG - Intronic
1090860582 11:130648969-130648991 GCCTAGGAAGGAGGCCCCTCAGG - Intergenic
1096598630 12:52714230-52714252 GCGGAGGGAAGGGGCCCCGCGGG + Intergenic
1103410560 12:120708917-120708939 CCCTAGAGAAGGAGCCCCTCAGG + Intergenic
1111114293 13:83755184-83755206 GCATCTGGCAGGCGCCCCTCTGG + Intergenic
1112231688 13:97593979-97594001 GCATCGGGCAGGTGCCCCTCTGG + Intergenic
1113493735 13:110712779-110712801 GCCTAGGGAAGGCGCCCCTCGGG + Intronic
1115174540 14:30547552-30547574 AGCAAGGGACGGCGCCCCTCTGG + Intergenic
1117512955 14:56471509-56471531 GCCTAGGGCAGGAGGCTCTCAGG + Intergenic
1121636282 14:95455846-95455868 CCCTTGGGAAGGCCCCTCTCTGG - Intronic
1122934633 14:104950250-104950272 CCCTCGGGAAGGGGGCCCTCCGG + Exonic
1124352091 15:28963359-28963381 GCACAGGGAAGGCGCCTCACTGG - Intronic
1128654866 15:69453148-69453170 GCATAGGGCGGGCGCTCCTCGGG + Intronic
1129868908 15:78928711-78928733 GCCTGGGGGAGGCCACCCTCAGG + Intronic
1134676980 16:16097669-16097691 GCCTATGAGAGGGGCCCCTCTGG + Intronic
1138229152 16:55324886-55324908 CGCTCCGGAAGGCGCCCCTCCGG - Exonic
1138419743 16:56891747-56891769 GGCCAGGGAAGGCCTCCCTCAGG + Intronic
1141480049 16:84300399-84300421 GGAAAGGGAAGGCGCCCTTCAGG - Intronic
1141547168 16:84777903-84777925 GCCTCGGGAAGGCGGCTGTCCGG - Intronic
1142283825 16:89162929-89162951 GGCTGGGGAAGGCGCCCACCTGG - Intergenic
1147384238 17:40072198-40072220 GCCTGGGGGAGGGGACCCTCAGG + Intronic
1147811241 17:43171268-43171290 GCCTCCGGCAGGCGCCCCCCGGG + Intronic
1147877522 17:43632222-43632244 GTCTCTGGAAGGAGCCCCTCTGG + Intergenic
1147925379 17:43942471-43942493 GCCGAGGGCAGGGGCCCATCCGG - Intergenic
1151818056 17:76481269-76481291 GGCTCAGGAAGGAGCCCCTCTGG + Intronic
1160449187 18:78950527-78950549 GCCCAGGGAAGGCGGCCATATGG + Intergenic
1161593148 19:5137708-5137730 GCCCAGGGCAGGCTCCCCTCCGG - Intronic
1162341356 19:10093250-10093272 GGGTAGGTAAGACGCCCCTCTGG - Intronic
1163505973 19:17706521-17706543 GCCCAGGGAGGTCGCACCTCTGG + Intergenic
1165459397 19:35935725-35935747 GCCTTGGGAAGGAGCCCCTCTGG + Exonic
928389658 2:30899321-30899343 ACCCAGGGAAGGCTCCGCTCTGG + Intergenic
930705571 2:54501777-54501799 GCCTGGGGATGGAGCCTCTCTGG + Intronic
931434014 2:62231688-62231710 GCCTTGGGAAGGGGCCTCTGGGG + Intergenic
931717170 2:65038309-65038331 GACCAGGGAAGGCTCCCCTGAGG - Intergenic
932523346 2:72437278-72437300 GCATTGGGCAGGTGCCCCTCTGG - Intronic
934098156 2:88626858-88626880 GCCGAGGGAAGACGCCCGCCCGG + Intronic
940946593 2:159624452-159624474 GCCTCTGGCAGGTGCCCCTCTGG + Intergenic
944445540 2:199784745-199784767 GCCTGGGTAAGGCGACTCTCCGG + Intronic
1170567914 20:17617076-17617098 TCCCAGGGAGGGCTCCCCTCCGG - Intronic
1172512739 20:35511850-35511872 GCCAGGGCAAGGCACCCCTCTGG - Exonic
1172663867 20:36585944-36585966 GCTTTGGGAAGGCTTCCCTCAGG - Intronic
1173298948 20:41783281-41783303 GGGTATGGAAGGTGCCCCTCAGG - Intergenic
1179708349 21:43195225-43195247 GCCCTGCCAAGGCGCCCCTCGGG - Intergenic
1180162486 21:46004396-46004418 GCCTAGGGAAGGAGCTGCGCAGG - Exonic
1184504351 22:44891971-44891993 ACCTGGGGAAGGGCCCCCTCGGG + Intronic
1184718323 22:46294752-46294774 GGGTAGAGAAGGCGCCTCTCTGG - Intergenic
1184728378 22:46358933-46358955 GCCTCGGGAAGGAGCCTCCCAGG - Intergenic
1184998536 22:48227688-48227710 GCCTGGGGCAGGCTCCCCTAGGG - Intergenic
1185088500 22:48753323-48753345 GCCCTGGGAAGGCGGCTCTCAGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949683327 3:6540868-6540890 GCATCTGGAAGGTGCCCCTCTGG - Intergenic
950118577 3:10467125-10467147 GCCCAGGGGAGGGGCCTCTCTGG + Intronic
950331418 3:12158892-12158914 GCCTTGGGAAGGAGCCCTGCTGG - Exonic
957256541 3:77844758-77844780 GCATATGGCAGGTGCCCCTCTGG - Intergenic
961374077 3:126450871-126450893 GCCTAGGGAGTGGGCCCCTATGG - Intronic
961480628 3:127177527-127177549 GCCTTGGGAAGGCCACCCTTGGG - Intergenic
962693659 3:137926682-137926704 GCCTATGGAAGGGGACACTCTGG - Intergenic
967939671 3:194756305-194756327 GCACAGGGAAGGTGACCCTCTGG - Intergenic
969517738 4:7656928-7656950 GCCGGGGGCAGGCGGCCCTCAGG - Intronic
970727261 4:19060900-19060922 GCCTCTGGCAGGTGCCCCTCTGG + Intergenic
971480660 4:27111960-27111982 GCCTAGGGATGGCTTCCCTATGG - Intergenic
972831488 4:42819251-42819273 GATTAGGGAAGGCTCCCCTGAGG + Intergenic
974326226 4:60418741-60418763 GCCTCTGGCAGGTGCCCCTCTGG - Intergenic
975149326 4:71004339-71004361 GCCTCTGGCAGGTGCCCCTCTGG - Intronic
975166787 4:71186818-71186840 GCCCAGCCCAGGCGCCCCTCGGG - Intergenic
978371523 4:108034110-108034132 CCCCAGGCATGGCGCCCCTCCGG - Intronic
987594665 5:19981741-19981763 CCCTAGGGAAGGAGCACCCCTGG - Intronic
991522831 5:67519440-67519462 ACCTAGGGAAGGGGTCCCACAGG - Intergenic
992038790 5:72808408-72808430 GCATATGGCAGGTGCCCCTCTGG - Intergenic
997519870 5:134516064-134516086 GCCTGGGAGAGGCACCCCTCTGG - Intergenic
998133100 5:139660908-139660930 GCCCAGGCAAGCTGCCCCTCAGG - Intronic
1002189727 5:177472381-177472403 TTCTAGGGAAGGTGCCCATCTGG - Exonic
1006409283 6:33862997-33863019 TCCTAGGGAAGAGGCCCCTCAGG + Intergenic
1007252523 6:40505686-40505708 GCCTAGGGCAGGGGCCTCTAGGG + Intronic
1008077318 6:47158884-47158906 GGCTAGGGAAGGCTTCCCTAAGG + Intergenic
1012401856 6:98848027-98848049 GCCTAGGCCAGGCACCCCTTTGG + Intergenic
1016863893 6:148747487-148747509 CCCTATGGGGGGCGCCCCTCCGG + Exonic
1017234028 6:152100506-152100528 GCCCAGGGAAGGCTGCCCTGTGG - Exonic
1018619470 6:165715976-165715998 GCCCACGGAAGCCTCCCCTCCGG + Intronic
1019624819 7:2010805-2010827 CCCTGGGGAAGGCGCCTCTCGGG - Intronic
1020428702 7:8096900-8096922 GCATTGGGCAGGTGCCCCTCTGG + Intergenic
1030187859 7:106780775-106780797 CCCCAGGGCAGGAGCCCCTCCGG + Intergenic
1031928521 7:127661459-127661481 GCCTAGGGATGAAGCTCCTCAGG - Intronic
1035742621 8:1939607-1939629 GCCTAGGGATGGTGCCCATGTGG + Intronic
1045044309 8:98259801-98259823 CTCTAGGGATGGCCCCCCTCTGG - Intronic
1048214845 8:132484683-132484705 CCCTAGGGAAGGTGCCCCACTGG - Intergenic
1049397229 8:142406651-142406673 GCCTAGAGAAGGTGTGCCTCAGG - Intergenic
1053313990 9:37036748-37036770 GCCGAGGGGAGCCGCCCCTTGGG - Intergenic
1057412071 9:94825546-94825568 GCCTAGGGAGGGCGCTCCCCTGG - Intronic
1060665103 9:125428145-125428167 GCCCAGGGAAGGGGCCTCACAGG - Intergenic
1062577023 9:137213657-137213679 GCCTGGGGAGGGCCTCCCTCGGG - Intronic
1186486266 X:9936649-9936671 GCCTGGGGAGGGCTCCTCTCCGG - Intronic
1188893210 X:35635755-35635777 GCATCTGGTAGGCGCCCCTCTGG - Intergenic
1189879942 X:45480240-45480262 GCCTAGGGAAGGGGCAACACTGG + Intergenic
1192234409 X:69286548-69286570 GCCTAGGGAAGCAGGCCCTTGGG - Intergenic
1200267322 X:154653329-154653351 GCCGAGAGGAGGCGCCCCGCGGG - Exonic