ID: 1113503804

View in Genome Browser
Species Human (GRCh38)
Location 13:110799147-110799169
Sequence TGCACCGGAAACCGCACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113503804_1113503810 28 Left 1113503804 13:110799147-110799169 CCCTCGGTGCGGTTTCCGGTGCA No data
Right 1113503810 13:110799198-110799220 GGCATTTTTCTAGGCAGCTCTGG No data
1113503804_1113503807 4 Left 1113503804 13:110799147-110799169 CCCTCGGTGCGGTTTCCGGTGCA No data
Right 1113503807 13:110799174-110799196 GACACTCAGTAAGTGACAGCTGG No data
1113503804_1113503808 7 Left 1113503804 13:110799147-110799169 CCCTCGGTGCGGTTTCCGGTGCA No data
Right 1113503808 13:110799177-110799199 ACTCAGTAAGTGACAGCTGGTGG No data
1113503804_1113503809 19 Left 1113503804 13:110799147-110799169 CCCTCGGTGCGGTTTCCGGTGCA No data
Right 1113503809 13:110799189-110799211 ACAGCTGGTGGCATTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113503804 Original CRISPR TGCACCGGAAACCGCACCGA GGG (reversed) Intergenic