ID: 1113505982

View in Genome Browser
Species Human (GRCh38)
Location 13:110816233-110816255
Sequence CTTTCCAAGGGGTTGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113505982_1113505991 -10 Left 1113505982 13:110816233-110816255 CCTTCCAACAACCCCTTGGAAAG No data
Right 1113505991 13:110816246-110816268 CCTTGGAAAGGCAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113505982 Original CRISPR CTTTCCAAGGGGTTGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr