ID: 1113507039

View in Genome Browser
Species Human (GRCh38)
Location 13:110824157-110824179
Sequence GCTTAGAGATTGGACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113507039_1113507049 27 Left 1113507039 13:110824157-110824179 CCAGGCTGGTCCAATCTCTAAGC No data
Right 1113507049 13:110824207-110824229 AAGGCTTTGTGGAATCTAATGGG No data
1113507039_1113507050 28 Left 1113507039 13:110824157-110824179 CCAGGCTGGTCCAATCTCTAAGC No data
Right 1113507050 13:110824208-110824230 AGGCTTTGTGGAATCTAATGGGG No data
1113507039_1113507048 26 Left 1113507039 13:110824157-110824179 CCAGGCTGGTCCAATCTCTAAGC No data
Right 1113507048 13:110824206-110824228 TAAGGCTTTGTGGAATCTAATGG No data
1113507039_1113507044 8 Left 1113507039 13:110824157-110824179 CCAGGCTGGTCCAATCTCTAAGC No data
Right 1113507044 13:110824188-110824210 CTGACCAATCCTTCGCACTAAGG No data
1113507039_1113507051 29 Left 1113507039 13:110824157-110824179 CCAGGCTGGTCCAATCTCTAAGC No data
Right 1113507051 13:110824209-110824231 GGCTTTGTGGAATCTAATGGGGG No data
1113507039_1113507046 16 Left 1113507039 13:110824157-110824179 CCAGGCTGGTCCAATCTCTAAGC No data
Right 1113507046 13:110824196-110824218 TCCTTCGCACTAAGGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113507039 Original CRISPR GCTTAGAGATTGGACCAGCC TGG (reversed) Intergenic
No off target data available for this crispr